master
Tancre 5 years ago
parent ab9e5ecd7b
commit ae8ab2723a

Binary file not shown.

After

Width:  |  Height:  |  Size: 3.3 KiB

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<meta http-equiv="content-type" content="text/html; charset=UTF-8">
<title>Ilinx-0</title>
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<h1>Index of /ilinx</h1>
<table>
<tbody>
<tr><th colspan="5"><hr></th></tr>
<tr><td valign="top"><img src="Index%20of%20_ilinx_files/unknown.html" alt="[.]"></td><td><a href="./ilinx_00.html">ilinx</a></td><td align="right">-</td><td align="right"> 0 </td><td>&nbsp;</td></tr>
<tr><th colspan="5"><hr></th></tr>
</tbody>
</table>
</body>
</html>

@ -0,0 +1,48 @@
<!DOCTYPE html>
<html>
<head>
<meta http-equiv="content-type" content="text/html; charset=UTF-8">
<title>Ilinx-0</title>
<link rel="stylesheet" type="text/css" href="style.css">
<style type="text/css">
iframe{
position: absolute;
width: 390px;
height: 60px;
left: 454px;
top: 360px;}
</style>
</head>
<body>
<h1>Index of /ilinx</h1>
<table>
<tbody>
<tr><th colspan="5"><hr></th></tr>
<tr><td valign="top"><img src="Index%20of%20_ilinx_files/unknown.html" alt="[.]"></td><td><a href="#">ilinx</a></td><td align="right">-</td><td align="right"> 00 </td><td>&nbsp;</td></tr>
<tr><th colspan="5"><hr></th></tr>
</tbody>
</table>
<p id="i0">The most merciful thing in the world, I think, is the ability (
<a href="real.html" target="real" onclick="createIframe()">real</a>
or
<a href="imaginary.html" target="imaginary" onclick="newW()">imaginary</a>
) of the human mind to correlate all its contents. </p>
<iframe id="real" style="visibility: hidden;" src="" name = "real"></iframe>
<script type="text/javascript">
function newW(){
var w = window.open('imaginary.html','imaginary','width=420, height=60, left=954, top=450');
w.focus();
// setTimeout( w.close(), 30000);
}
function createIframe() {
document.getElementById("real").style.visibility = "visible";
}
</script>
</body>
</html>

@ -0,0 +1,27 @@
<!DOCTYPE html>
<html>
<head>
<meta http-equiv="content-type" content="text/html; charset=UTF-8">
<title>Ilinx-0</title>
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<h1>Index of /ilinx</h1>
<table>
<tbody>
<tr><th colspan="5"><hr></th></tr>
<tr><td valign="top"><img src="Index%20of%20_ilinx_files/unknown.html" alt="[.]"></td><td><a href="#">ilinx</a></td><td align="right">-</td><td align="right"> 000 </td><td>&nbsp;</td></tr>
<tr><th colspan="5"><hr></th></tr>
</tbody>
</table>
<p id="i0">We live on a placid island of ignorance in the midst of the <a href="../black_sea.html" target="black_sea" onclick="visible()">black seas of infinity</a>, and it was not meant that we should voyage so far. </p>
<iframe style="visibility: hidden;" id="black_sea" src="" name = "black_sea"></iframe>
<script type="text/javascript">
function visible() {
document.getElementById("black_sea").style.visibility = "visible";
}
</script>
</body>
</html>

@ -0,0 +1,17 @@
<!DOCTYPE html>
<html>
<head>
<style type="text/css">
body{font-family: mono;}
</style>
</head>
<body>
<p>Think of it as a ship taking of a <a href="" onclick="next()">voyage</a></p>
<script type="text/javascript">
function next(){
window.opener.location.href = "ilinx_000.html";
window.close();
}
</script>
</body>
</html>

@ -0,0 +1,13 @@
<!DOCTYPE html>
<html>
<head>
<style type="text/css">
body{font-family: mono;}
</style>
</head>
<body>
<p>Think of it as you reading this text</p>
</body>
</html>

@ -0,0 +1,7 @@
body { font-family: mono; }
table { float: left; }
#i0 { float: left; margin: 25px 180px;}
#black_sea { width:100%; height: 80vh; }

@ -48,7 +48,7 @@
<h1>4.2: <a href="https://dl.acm.org/doi/pdf/10.1145/800197.806036" onClick="return popup(this, '000', '1000', '800','1000','500')">A File Structure for The Complex, The Changing and the Indeterminate</a></h1> <br> <h1>4.2: <a href="https://dl.acm.org/doi/pdf/10.1145/800197.806036" onClick="return popup(this, '000', '1000', '800','1000','500')">A File Structure for The Complex, The Changing and the Indeterminate</a></h1> <br>
<h2>T. H. Nelson Vassar College, Poughkeepsie, N.Y.</h2> <br><br> <h2>T. H. Nelson Vassar College, Poughkeepsie, N.Y.</h2> <br><br>
<div id="b">
THE KINDS OF FILE structures required if we are to use the computer for personal files and as an adjunct to creativity are wholly different in character from those customary in business and scientific data processing. They need to provide the capacity for intricate and idiosyncratic arrangements, total modifiability, undecided alternatives, and thorough internal documentation. <br><br> THE KINDS OF FILE structures required if we are to use the computer for personal files and as an adjunct to creativity are wholly different in character from those customary in business and scientific data processing. They need to provide the capacity for intricate and idiosyncratic arrangements, total modifiability, undecided alternatives, and thorough internal documentation. <br><br>
The original idea was to make a file for writers and scientists, much like the personal side of <a class="VB01" href="VB01.html">Bush's Memex</a>, that would do the things such people need with the richness they would want. But there are so many possible specific functions that the mind reels. These uses and considerations become so complex that the only answer is a simple and generalized building-block structure, user-oriented and wholly general-purpose. <br><br> The original idea was to make a file for writers and scientists, much like the personal side of <a class="VB01" href="VB01.html">Bush's Memex</a>, that would do the things such people need with the richness they would want. But there are so many possible specific functions that the mind reels. These uses and considerations become so complex that the only answer is a simple and generalized building-block structure, user-oriented and wholly general-purpose. <br><br>
The resulting file structure is explained and examples of its use are given. It bears generic similarities <a class="r" href="#">to</a> list-processing systems but is slower and bigger. It employs zippered lists plus certain facilities for modification and spin-off of variations. This is technically accomplished by index manipulation and text patching, but to the user it acts like a multifarious, polymorphic, many-dimensional, infinite blackboard. <br><br> The resulting file structure is explained and examples of its use are given. It bears generic similarities <a class="r" href="#">to</a> list-processing systems but is slower and bigger. It employs zippered lists plus certain facilities for modification and spin-off of variations. This is technically accomplished by index manipulation and text patching, but to the user it acts like a multifarious, polymorphic, many-dimensional, infinite blackboard. <br><br>
@ -96,9 +96,26 @@
17 Bachman, C. W., "Software for Random Access Process- ing," Datamation; April, ].965. '" <br> 17 Bachman, C. W., "Software for Random Access Process- ing," Datamation; April, ].965. '" <br>
18 General Electric Computer Department, "Integrated Data Store: New General Electric Technique for Organizing Busi- ,less Data"; January, 1965 '<br> 18 General Electric Computer Department, "Integrated Data Store: New General Electric Technique for Organizing Busi- ,less Data"; January, 1965 '<br>
19 Corbin, H. S., and Stock, G. J., "On-Line Querying via a Display Console," Fourth Nat~o~al Symposium on Informa- t:oa Display: Technical S~'ssio~ Proceedings, p. 127-154; 1964. 19 Corbin, H. S., and Stock, G. J., "On-Line Querying via a Display Console," Fourth Nat~o~al Symposium on Informa- t:oa Display: Technical S~'ssio~ Proceedings, p. 127-154; 1964.
</div>
</div> </div>
<script> <script>
var rooms = ['VB01.html','Ixse.html','./0/ilinx_0.html','Ixse2.html','cyberSit.html','./home/doorway.html','./AxS/index.html'];
function rand(){ return Math.ceil(Math.random() * res.length) }
function rand2(){ return Math.ceil(Math.random() * rooms.length)-1 }
for (var i = 0; i < 50; i++) {
var str = $('#b').html();
var res = str.split(" ");
var word = res[rand()];
console.log(rand());
var newstr = str.replace(word, '<a href="'+ rooms[rand2()] + '">'+ word + '</a>');
console.log(word);
$('#b').html(newstr);
}
var div = document.getElementById("vBush"); var div = document.getElementById("vBush");
div.addEventListener("click", x => { div.addEventListener("click", x => {

@ -0,0 +1,669 @@
<!DOCTYPE html>
<html>
<head>
<meta http-equiv="content-type" content="text/html; charset=UTF-8">
<title> @@@ilinχ </title>
<script src="https://code.jquery.com/jquery-1.12.4.js"></script>
<script src="https://code.jquery.com/ui/1.12.1/jquery-ui.js"></script>
<style type="text/css">
body {
background-color: black;
font-family: mono;
overflow: hidden;
}
#page_1{
width: 2000px;
height: 8000px;
cursor: move;
}
.ocrx_word{
cursor: grab;
}
.b {color: red !important;}
.w {color: white !important;}
</style>
</head>
<body>
<div class='ocr_page draggable' id='page_1' title='image "hypervirus2-01.tif"; bbox 0 0 1749 12409; ppageno 0'>
<div class='ocr_carea' id='block_1_1' title="bbox 78 91 352 146">
<p class='ocr_par' dir='ltr' id='par_1_1' title="bbox 78 91 352 146">
<span class='ocr_line' id='line_1_1' title="bbox 78 91 352 146; baseline 0 -12; x_size 55; x_descenders 12; x_ascenders 13"><span class='ocrx_word' id='word_1_1' title='bbox 78 91 352 146; x_wconf 84' lang='eng' dir='ltr' style="font-size: 30px; color: white;"><b>Hypervirus</b></span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_2' title="bbox 348 247 1379 9101">
<p class='ocr_par' dir='ltr' id='par_1_2' title="bbox 349 247 1358 465">
<span class='ocr_line' id='line_1_2' title="bbox 350 247 1358 288; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_2' title='bbox 350 247 529 277; x_wconf 84' lang='eng' dir='ltr'>Whatever</span> <span class='ocrx_word' id='word_1_3' title='bbox 547 247 832 288; x_wconf 97' lang='eng' dir='ltr'>ultramodernity</span> <span class='ocrx_word' id='word_1_4' title='bbox 850 247 963 287; x_wconf 85' lang='eng' dir='ltr'>places</span> <span class='ocrx_word' id='word_1_5' title='bbox 983 247 1090 277; x_wconf 98' lang='eng' dir='ltr'>under</span> <span class='ocrx_word' id='word_1_6' title='bbox 1108 247 1163 277; x_wconf 85' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_7' title='bbox 1182 247 1358 277; x_wconf 87' lang='eng' dir='ltr'>dominion</span>
</span>
<span class='ocr_line' id='line_1_3' title="bbox 350 306 1358 347; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_8' title='bbox 350 306 389 336; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_9' title='bbox 401 306 494 347; x_wconf 85' lang='eng' dir='ltr'>signs</span> <span class='ocrx_word' id='word_1_10' title='bbox 509 306 782 347; x_wconf 97' lang='eng' dir='ltr'>postmodernity</span> <span class='ocrx_word' id='word_1_11' title='bbox 799 306 949 336; x_wconf 85' lang='eng' dir='ltr'>subverts</span> <span class='ocrx_word' id='word_1_12' title='bbox 966 306 1042 336; x_wconf 92' lang='eng' dir='ltr'>with</span> <span class='ocrx_word' id='word_1_13' title='bbox 1059 306 1156 336; x_wconf 89' lang='eng' dir='ltr'>virus.</span> <span class='ocrx_word' id='word_1_14' title='bbox 1171 307 1218 336; x_wconf 93' lang='eng' dir='ltr'>As</span> <span class='ocrx_word' id='word_1_15' title='bbox 1234 306 1358 336; x_wconf 90' lang='eng' dir='ltr'>culture</span>
</span>
<span class='ocr_line' id='line_1_4' title="bbox 350 363 1358 407; baseline 0 -13; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_16' title='bbox 350 364 504 405; x_wconf 84' lang='eng' dir='ltr'>migrates</span> <span class='ocrx_word' id='word_1_17' title='bbox 518 364 590 394; x_wconf 98' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_18' title='bbox 603 364 908 404; x_wconf 88' lang='eng' dir='ltr'>partial-machines</span> <span class='ocrx_word' id='word_1_19' title='bbox 923 363 1068 407; x_wconf 93' lang='eng' dir='ltr'>(lacking</span> <span class='ocrx_word' id='word_1_20' title='bbox 1082 374 1121 394; x_wconf 95' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_21' title='bbox 1136 370 1358 394; x_wconf 88' lang='eng' dir='ltr'>autonomous</span>
</span>
<span class='ocr_line' id='line_1_5' title="bbox 349 421 1357 465; baseline 0 -12; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_22' title='bbox 349 423 575 463; x_wconf 91' lang='eng' dir='ltr'>reproductive</span> <span class='ocrx_word' id='word_1_23' title='bbox 586 421 719 465; x_wconf 89' lang='eng' dir='ltr'>system)</span> <span class='ocrx_word' id='word_1_24' title='bbox 731 423 897 453; x_wconf 90' lang='eng' dir='ltr'>semiotics</span> <span class='ocrx_word' id='word_1_25' title='bbox 905 423 1052 453; x_wconf 94' lang='eng' dir='ltr'>subsides</span> <span class='ocrx_word' id='word_1_26' title='bbox 1060 423 1129 453; x_wconf 98' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_27' title='bbox 1139 423 1357 453; x_wconf 93' lang='eng' dir='ltr'>virotechnics.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_3' title="bbox 348 489 1358 813">
<span class='ocr_line' id='line_1_6' title="bbox 414 489 1356 511; baseline 0.001 -1; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_28' title='bbox 414 489 1356 511; x_wconf 96' lang='eng'>0010101011011100101101010101001100100010001010</span>
</span>
<span class='ocr_line' id='line_1_7' title="bbox 350 547 1357 569; baseline 0.001 -1; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_29' title='bbox 350 547 1357 569; x_wconf 96' lang='eng'>1011101000010101100101001010001100100111001000100</span>
</span>
<span class='ocr_line' id='line_1_8' title="bbox 350 606 1355 628; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_30' title='bbox 350 606 1355 628; x_wconf 94' lang='eng'>000000010011111100010010010101010100001000010101</span>
</span>
<span class='ocr_line' id='line_1_9' title="bbox 350 665 1354 687; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_31' title='bbox 350 665 1354 687; x_wconf 96' lang='eng'>00111111001001000100011010010001010010101111000101</span>
</span>
<span class='ocr_line' id='line_1_10' title="bbox 350 715 1358 756; baseline 0 -11; x_size 40; x_descenders 11; x_ascenders 9"><span class='ocrx_word' id='word_1_32' title='bbox 350 723 735 745; x_wconf 96' lang='eng'>001000010001110100</span> <span class='ocrx_word' id='word_1_33' title='bbox 748 716 807 745; x_wconf 94' lang='eng' dir='ltr'>Yes</span> <span class='ocrx_word' id='word_1_34' title='bbox 822 716 878 745; x_wconf 95' lang='eng' dir='ltr'>No</span> <span class='ocrx_word' id='word_1_35' title='bbox 891 716 950 745; x_wconf 94' lang='eng' dir='ltr'>Yes</span> <span class='ocrx_word' id='word_1_36' title='bbox 965 716 1018 745; x_wconf 96' lang='eng' dir='ltr'>No</span> <span class='ocrx_word' id='word_1_37' title='bbox 1031 716 1090 745; x_wconf 94' lang='eng' dir='ltr'>Yes</span> <span class='ocrx_word' id='word_1_38' title='bbox 1103 716 1162 745; x_wconf 98' lang='eng' dir='ltr'>Yes</span> <span class='ocrx_word' id='word_1_39' title='bbox 1175 716 1230 745; x_wconf 95' lang='eng' dir='ltr'>No</span> <span class='ocrx_word' id='word_1_40' title='bbox 1244 715 1358 756; x_wconf 85' lang='eng' dir='ltr'>longer</span>
</span>
<span class='ocr_line' id='line_1_11' title="bbox 348 773 1145 813; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_41' title='bbox 348 773 437 803; x_wconf 93' lang='eng' dir='ltr'>what</span> <span class='ocrx_word' id='word_1_42' title='bbox 451 773 531 803; x_wconf 98' lang='eng' dir='ltr'>does</span> <span class='ocrx_word' id='word_1_43' title='bbox 545 773 569 803; x_wconf 98' lang='eng' dir='ltr'>it</span> <span class='ocrx_word' id='word_1_44' title='bbox 582 773 700 803; x_wconf 82' lang='eng' dir='ltr'>mean?</span> <span class='ocrx_word' id='word_1_45' title='bbox 714 773 776 803; x_wconf 98' lang='eng' dir='ltr'>but</span> <span class='ocrx_word' id='word_1_46' title='bbox 789 773 866 803; x_wconf 96' lang='eng' dir='ltr'>how</span> <span class='ocrx_word' id='word_1_47' title='bbox 878 773 959 803; x_wconf 98' lang='eng' dir='ltr'>does</span> <span class='ocrx_word' id='word_1_48' title='bbox 973 773 997 803; x_wconf 98' lang='eng' dir='ltr'>it</span> <span class='ocrx_word' id='word_1_49' title='bbox 1010 773 1145 813; x_wconf 80' lang='eng' dir='ltr'>spread?</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_4' title="bbox 349 832 1356 978">
<span class='ocr_line' id='line_1_12' title="bbox 413 832 1356 873; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_50' title='bbox 413 832 548 873; x_wconf 84' lang='eng' dir='ltr'>Having</span> <span class='ocrx_word' id='word_1_51' title='bbox 557 842 603 862; x_wconf 98' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_52' title='bbox 612 842 738 872; x_wconf 97' lang='eng' dir='ltr'>proper</span> <span class='ocrx_word' id='word_1_53' title='bbox 747 832 935 868; x_wconf 79' lang='eng' dir='ltr'>substance,</span> <span class='ocrx_word' id='word_1_54' title='bbox 944 842 983 862; x_wconf 97' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_55' title='bbox 992 842 1082 862; x_wconf 98' lang='eng' dir='ltr'>sense</span> <span class='ocrx_word' id='word_1_56' title='bbox 1092 832 1225 873; x_wconf 88' lang='eng' dir='ltr'>beyond</span> <span class='ocrx_word' id='word_1_57' title='bbox 1234 832 1273 862; x_wconf 98' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_58' title='bbox 1279 842 1314 862; x_wconf 97' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_59' title='bbox 1322 842 1356 862; x_wconf 98' lang='eng' dir='ltr'>re</span>
</span>
<span class='ocr_line' id='line_1_13' title="bbox 349 890 1355 931; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_60' title='bbox 349 900 382 920; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_61' title='bbox 393 890 598 930; x_wconf 79' lang='eng' dir='ltr'>replication,</span> <span class='ocrx_word' id='word_1_62' title='bbox 608 900 665 931; x_wconf 89' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_63' title='bbox 676 900 723 920; x_wconf 98' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_64' title='bbox 734 900 779 920; x_wconf 98' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_65' title='bbox 790 900 891 931; x_wconf 98' lang='eng' dir='ltr'>usage</span> <span class='ocrx_word' id='word_1_66' title='bbox 902 890 941 920; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_67' title='bbox 945 890 1033 920; x_wconf 96' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_68' title='bbox 1043 890 1068 920; x_wconf 98' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_69' title='bbox 1076 900 1154 920; x_wconf 98' lang='eng' dir='ltr'>ever</span> <span class='ocrx_word' id='word_1_70' title='bbox 1162 890 1355 930; x_wconf 92' lang='eng' dir='ltr'>metaphori-</span>
</span>
<span class='ocr_line' id='line_1_14' title="bbox 350 946 1065 978; baseline 0 0; x_size 42.988487; x_descenders 10.988487; x_ascenders 12"><span class='ocrx_word' id='word_1_71' title='bbox 350 948 408 978; x_wconf 91' lang='eng' dir='ltr'>cal.</span> <span class='ocrx_word' id='word_1_72' title='bbox 423 949 490 978; x_wconf 92' lang='eng' dir='ltr'>The</span> <span class='ocrx_word' id='word_1_73' title='bbox 502 948 596 978; x_wconf 97' lang='eng' dir='ltr'>word</span> <span class='ocrx_word' id='word_1_74' title='bbox 610 946 719 978; x_wconf 73' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_75' title='bbox 734 948 761 978; x_wconf 99' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_76' title='bbox 774 958 866 978; x_wconf 97' lang='eng' dir='ltr'>more</span> <span class='ocrx_word' id='word_1_77' title='bbox 879 958 912 978; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_78' title='bbox 925 958 957 978; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_79' title='bbox 969 948 1065 978; x_wconf 89' lang='eng' dir='ltr'>virus.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_5' title="bbox 348 1006 1355 1281">
<span class='ocr_line' id='line_1_15' title="bbox 414 1006 1355 1036; baseline 0 0; x_size 40.988487; x_descenders 10.988487; x_ascenders 10"><span class='ocrx_word' id='word_1_80' title='bbox 414 1006 631 1036; x_wconf 92' lang='eng' dir='ltr'>Postmodern</span> <span class='ocrx_word' id='word_1_81' title='bbox 641 1006 769 1036; x_wconf 99' lang='eng' dir='ltr'>culture</span> <span class='ocrx_word' id='word_1_82' title='bbox 778 1016 813 1036; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_83' title='bbox 820 1016 855 1036; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_84' title='bbox 864 1006 1074 1036; x_wconf 89' lang='eng' dir='ltr'>chatters-out</span> <span class='ocrx_word' id='word_1_85' title='bbox 1082 1006 1168 1036; x_wconf 89' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_86' title='bbox 1177 1006 1262 1036; x_wconf 94' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_87' title='bbox 1269 1006 1355 1036; x_wconf 94' lang='eng' dir='ltr'>virus</span>
</span>
<span class='ocr_line' id='line_1_16' title="bbox 348 1064 1353 1094; baseline 0 0; x_size 42.087334; x_descenders 12.087336; x_ascenders 8"><span class='ocrx_word' id='word_1_88' title='bbox 348 1064 437 1094; x_wconf 91' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_89' title='bbox 453 1064 543 1094; x_wconf 91' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_90' title='bbox 560 1064 650 1094; x_wconf 92' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_91' title='bbox 668 1064 758 1094; x_wconf 92' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_92' title='bbox 776 1064 866 1094; x_wconf 92' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_93' title='bbox 883 1064 971 1094; x_wconf 92' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_94' title='bbox 987 1064 1075 1094; x_wconf 92' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_95' title='bbox 1092 1072 1353 1094; x_wconf 92' lang='eng'>0110001001001</span>
</span>
<span class='ocr_line' id='line_1_17' title="bbox 349 1120 1354 1165; baseline 0 -13; x_size 44.087334; x_descenders 12.087336; x_ascenders 10"><span class='ocrx_word' id='word_1_96' title='bbox 349 1130 985 1153; x_wconf 97' lang='eng'>011010010010110010010010010010</span> <span class='ocrx_word' id='word_1_97' title='bbox 1005 1120 1113 1152; x_wconf 87' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_98' title='bbox 1134 1121 1354 1165; x_wconf 88' lang='eng' dir='ltr'>(viroductile,</span>
</span>
<span class='ocr_line' id='line_1_18' title="bbox 348 1180 1355 1221; baseline 0 -11; x_size 36; x_descenders 6; x_ascenders 10"><span class='ocrx_word' id='word_1_99' title='bbox 348 1180 526 1221; x_wconf 97' lang='eng' dir='ltr'>virogenic,</span> <span class='ocrx_word' id='word_1_100' title='bbox 544 1180 900 1220; x_wconf 98' lang='eng' dir='ltr'>immunosuppressor</span> <span class='ocrx_word' id='word_1_101' title='bbox 913 1180 983 1210; x_wconf 98' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_102' title='bbox 998 1180 1062 1210; x_wconf 98' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_103' title='bbox 1079 1190 1125 1216; x_wconf 99' lang='eng' dir='ltr'>or,</span> <span class='ocrx_word' id='word_1_104' title='bbox 1143 1186 1248 1216; x_wconf 92' lang='eng' dir='ltr'>meta-,</span> <span class='ocrx_word' id='word_1_105' title='bbox 1264 1190 1300 1210; x_wconf 91' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_106' title='bbox 1316 1190 1355 1210; x_wconf 97' lang='eng' dir='ltr'>or</span>
</span>
<span class='ocr_line' id='line_1_19' title="bbox 349 1237 725 1281; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_107' title='bbox 349 1239 417 1269; x_wconf 98' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_108' title='bbox 429 1249 467 1269; x_wconf 98' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_109' title='bbox 479 1237 611 1281; x_wconf 89' lang='eng' dir='ltr'>hyper-)</span> <span class='ocrx_word' id='word_1_110' title='bbox 625 1239 725 1269; x_wconf 92' lang='eng' dir='ltr'>virus.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_6' title="bbox 353 1304 1364 1403">
<span class='ocr_line' id='line_1_20' title="bbox 353 1304 1364 1345; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 9"><span class='ocrx_word' id='word_1_111' title='bbox 353 1313 943 1334; x_wconf 89' lang='eng'>10110010010011101100001001001.</span> <span class='ocrx_word' id='word_1_112' title='bbox 955 1304 1146 1345; x_wconf 93' lang='eng' dir='ltr'>hypervirus</span> <span class='ocrx_word' id='word_1_113' title='bbox 1156 1310 1224 1334; x_wconf 94' lang='eng' dir='ltr'>eats</span> <span class='ocrx_word' id='word_1_114' title='bbox 1236 1304 1287 1334; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_115' title='bbox 1298 1304 1364 1334; x_wconf 92' lang='eng' dir='ltr'>end</span>
</span>
<span class='ocr_line' id='line_1_21' title="bbox 353 1362 524 1403; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_116' title='bbox 353 1362 391 1392; x_wconf 98' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_117' title='bbox 402 1362 524 1403; x_wconf 94' lang='eng' dir='ltr'>history</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_7' title="bbox 353 1429 1365 1857">
<span class='ocr_line' id='line_1_22' title="bbox 415 1429 1365 1450; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_118' title='bbox 415 1429 1365 1450; x_wconf 78' lang='eng'>00100100100010]1110100001001101010101010101000</span>
</span>
<span class='ocr_line' id='line_1_23' title="bbox 353 1487 1363 1508; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_119' title='bbox 353 1487 1363 1508; x_wconf 89' lang='eng'>10011010100100101001001010010110100100101111010001</span>
</span>
<span class='ocr_line' id='line_1_24' title="bbox 353 1545 1365 1566; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_120' title='bbox 353 1545 1365 1566; x_wconf 89' lang='eng'>0101010101010100101010010101101010010000001000101</span>
</span>
<span class='ocr_line' id='line_1_25' title="bbox 354 1603 1365 1624; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_121' title='bbox 354 1603 1365 1624; x_wconf 89' lang='eng'>1101010010010101001010010010101010010001001001001</span>
</span>
<span class='ocr_line' id='line_1_26' title="bbox 353 1661 1364 1682; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_122' title='bbox 353 1661 1364 1682; x_wconf 89' lang='eng'>00100100101001001010110101001001001010110101010101</span>
</span>
<span class='ocr_line' id='line_1_27' title="bbox 353 1719 1365 1740; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_123' title='bbox 353 1719 1365 1740; x_wconf 78' lang='eng'>0101111010000100]1010101010101000100110110101010100</span>
</span>
<span class='ocr_line' id='line_1_28' title="bbox 355 1776 1364 1798; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_124' title='bbox 355 1776 1364 1798; x_wconf 86' lang='eng'>11001000100010101011101000010101100101001010001100</span>
</span>
<span class='ocr_line' id='line_1_29' title="bbox 354 1836 1363 1857; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_125' title='bbox 354 1836 1363 1857; x_wconf 89' lang='eng'>1001110010001000000000000100111111100010010010101</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_8' title="bbox 354 1883 1365 2276">
<span class='ocr_line' id='line_1_30' title="bbox 416 1883 1365 1927; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 11"><span class='ocrx_word' id='word_1_126' title='bbox 416 1894 700 1915; x_wconf 90' lang='eng'>0101000010000</span> <span class='ocrx_word' id='word_1_127' title='bbox 723 1883 905 1927; x_wconf 87' lang='eng' dir='ltr'>K-(coding</span> <span class='ocrx_word' id='word_1_128' title='bbox 923 1885 976 1915; x_wconf 90' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_129' title='bbox 994 1883 1253 1927; x_wconf 93' lang='eng' dir='ltr'>cyber)p0sitive</span> <span class='ocrx_word' id='word_1_130' title='bbox 1272 1895 1365 1925; x_wconf 94' lang='eng' dir='ltr'>proc-</span>
</span>
<span class='ocr_line' id='line_1_31' title="bbox 354 1942 1365 1983; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_131' title='bbox 354 1952 438 1972; x_wconf 95' lang='eng' dir='ltr'>esses</span> <span class='ocrx_word' id='word_1_132' title='bbox 454 1942 700 1983; x_wconf 91' lang='eng' dir='ltr'>auto-intensify</span> <span class='ocrx_word' id='word_1_133' title='bbox 714 1942 759 1983; x_wconf 98' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_134' title='bbox 772 1942 959 1983; x_wconf 91' lang='eng' dir='ltr'>occurring.</span> <span class='ocrx_word' id='word_1_135' title='bbox 974 1943 1004 1972; x_wconf 93' lang='eng' dir='ltr'><strong>A</strong></span> <span class='ocrx_word' id='word_1_136' title='bbox 1017 1942 1157 1972; x_wconf 96' lang='eng' dir='ltr'>cultural</span> <span class='ocrx_word' id='word_1_137' title='bbox 1172 1942 1324 1982; x_wconf 89' lang='eng' dir='ltr'>example</span> <span class='ocrx_word' id='word_1_138' title='bbox 1339 1942 1365 1972; x_wconf 99' lang='eng' dir='ltr'>is</span>
</span>
<span class='ocr_line' id='line_1_32' title="bbox 355 2001 1365 2042; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_139' title='bbox 355 2001 451 2042; x_wconf 89' lang='eng' dir='ltr'>hype:</span> <span class='ocrx_word' id='word_1_140' title='bbox 464 2001 621 2042; x_wconf 91' lang='eng' dir='ltr'>products</span> <span class='ocrx_word' id='word_1_141' title='bbox 635 2001 704 2031; x_wconf 96' lang='eng' dir='ltr'>that</span> <span class='ocrx_word' id='word_1_142' title='bbox 714 2002 771 2031; x_wconf 89' lang='eng' dir='ltr'>AT</span> <span class='ocrx_word' id='word_1_143' title='bbox 780 2002 837 2031; x_wconf 89' lang='eng' dir='ltr'>AT</span> <span class='ocrx_word' id='word_1_144' title='bbox 849 2001 942 2031; x_wconf 95' lang='eng' dir='ltr'>trade</span> <span class='ocrx_word' id='word_1_145' title='bbox 953 2011 999 2031; x_wconf 98' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_146' title='bbox 1012 2001 1100 2031; x_wconf 92' lang='eng' dir='ltr'>what</span> <span class='ocrx_word' id='word_1_147' title='bbox 1112 2001 1188 2042; x_wconf 97' lang='eng' dir='ltr'>they</span> <span class='ocrx_word' id='word_1_148' title='bbox 1199 2001 1263 2031; x_wconf 98' lang='eng' dir='ltr'>will</span> <span class='ocrx_word' id='word_1_149' title='bbox 1277 2001 1319 2031; x_wconf 98' lang='eng' dir='ltr'>be</span> <span class='ocrx_word' id='word_1_150' title='bbox 1331 2001 1365 2031; x_wconf 98' lang='eng' dir='ltr'>in</span>
</span>
<span class='ocr_line' id='line_1_33' title="bbox 355 2059 1365 2096; baseline 0 -7; x_size 37; x_descenders 7; x_ascenders 10"><span class='ocrx_word' id='word_1_151' title='bbox 355 2059 408 2089; x_wconf 98' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_152' title='bbox 421 2059 538 2096; x_wconf 87' lang='eng' dir='ltr'>future,</span> <span class='ocrx_word' id='word_1_153' title='bbox 550 2059 600 2089; x_wconf 94' lang='eng' dir='ltr'>vir</span> <span class='ocrx_word' id='word_1_154' title='bbox 608 2059 729 2089; x_wconf 93' lang='eng' dir='ltr'>virtual</span> <span class='ocrx_word' id='word_1_155' title='bbox 741 2059 875 2089; x_wconf 90' lang='eng' dir='ltr'>fashion</span> <span class='ocrx_word' id='word_1_156' title='bbox 888 2069 933 2089; x_wconf 98' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_157' title='bbox 945 2059 1002 2096; x_wconf 84' lang='eng' dir='ltr'>off,</span> <span class='ocrx_word' id='word_1_158' title='bbox 1016 2059 1190 2089; x_wconf 92' lang='eng' dir='ltr'>imminent</span> <span class='ocrx_word' id='word_1_159' title='bbox 1204 2059 1365 2090; x_wconf 91' lang='eng' dir='ltr'>technical</span>
</span>
<span class='ocr_line' id='line_1_34' title="bbox 355 2117 1364 2158; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_160' title='bbox 355 2117 535 2154; x_wconf 89' lang='eng' dir='ltr'>standards,</span> <span class='ocrx_word' id='word_1_161' title='bbox 545 2117 776 2158; x_wconf 92' lang='eng' dir='ltr'>self-fulfilling</span> <span class='ocrx_word' id='word_1_162' title='bbox 784 2117 982 2157; x_wconf 94' lang='eng' dir='ltr'>prophecies</span> <span class='ocrx_word' id='word_1_163' title='bbox 993 2117 1060 2147; x_wconf 95' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_164' title='bbox 1069 2117 1136 2147; x_wconf 93' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_165' title='bbox 1145 2127 1183 2147; x_wconf 98' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_166' title='bbox 1192 2117 1257 2147; x_wconf 95' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_167' title='bbox 1268 2117 1364 2147; x_wconf 92' lang='eng' dir='ltr'>artifi-</span>
</span>
<span class='ocr_line' id='line_1_35' title="bbox 354 2176 1365 2217; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_168' title='bbox 354 2176 413 2207; x_wconf 91' lang='eng' dir='ltr'>cial</span> <span class='ocrx_word' id='word_1_169' title='bbox 422 2176 582 2206; x_wconf 88' lang='eng' dir='ltr'>destinies.</span> <span class='ocrx_word' id='word_1_170' title='bbox 592 2176 818 2217; x_wconf 93' lang='eng' dir='ltr'>Anticipating</span> <span class='ocrx_word' id='word_1_171' title='bbox 826 2186 844 2206; x_wconf 99' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_172' title='bbox 856 2176 949 2206; x_wconf 95' lang='eng' dir='ltr'>trend</span> <span class='ocrx_word' id='word_1_173' title='bbox 958 2176 1024 2206; x_wconf 95' lang='eng' dir='ltr'>end</span> <span class='ocrx_word' id='word_1_174' title='bbox 1034 2176 1099 2206; x_wconf 93' lang='eng' dir='ltr'>end</span> <span class='ocrx_word' id='word_1_175' title='bbox 1107 2176 1173 2206; x_wconf 95' lang='eng' dir='ltr'>end</span> <span class='ocrx_word' id='word_1_176' title='bbox 1179 2176 1270 2206; x_wconf 99' lang='eng' dir='ltr'>ACC</span> <span class='ocrx_word' id='word_1_177' title='bbox 1277 2176 1365 2206; x_wconf 99' lang='eng' dir='ltr'>ACC</span>
</span>
<span class='ocr_line' id='line_1_36' title="bbox 355 2232 1328 2276; baseline 0 -12; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_178' title='bbox 355 2234 544 2265; x_wconf 91' lang='eng' dir='ltr'>accelerates</span> <span class='ocrx_word' id='word_1_179' title='bbox 556 2234 579 2264; x_wconf 91' lang='eng' dir='ltr'>it</span> <span class='ocrx_word' id='word_1_180' title='bbox 595 2233 718 2276; x_wconf 85' lang='eng' dir='ltr'>(which</span> <span class='ocrx_word' id='word_1_181' title='bbox 732 2234 756 2264; x_wconf 98' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_182' title='bbox 770 2234 804 2264; x_wconf 98' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_183' title='bbox 818 2234 910 2264; x_wconf 82' lang='eng' dir='ltr'>itself</span> <span class='ocrx_word' id='word_1_184' title='bbox 918 2244 936 2264; x_wconf 99' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_185' title='bbox 951 2244 983 2264; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_186' title='bbox 997 2244 1030 2264; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_187' title='bbox 1044 2234 1204 2264; x_wconf 89' lang='eng' dir='ltr'>recursive</span> <span class='ocrx_word' id='word_1_188' title='bbox 1218 2232 1328 2276; x_wconf 91' lang='eng' dir='ltr'>trend)</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_9' title="bbox 355 2293 1367 2451">
<span class='ocr_line' id='line_1_37' title="bbox 416 2293 1365 2334; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_189' title='bbox 416 2293 554 2334; x_wconf 94' lang='eng' dir='ltr'>Hyping</span> <span class='ocrx_word' id='word_1_190' title='bbox 569 2293 731 2333; x_wconf 94' lang='eng' dir='ltr'>collapses</span> <span class='ocrx_word' id='word_1_191' title='bbox 751 2302 786 2323; x_wconf 87' lang='eng' dir='ltr'>SF</span> <span class='ocrx_word' id='word_1_192' title='bbox 808 2293 878 2323; x_wconf 98' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_193' title='bbox 898 2293 1010 2323; x_wconf 95' lang='eng' dir='ltr'>CATA</span> <span class='ocrx_word' id='word_1_194' title='bbox 1027 2293 1137 2323; x_wconf 95' lang='eng' dir='ltr'>CATA</span> <span class='ocrx_word' id='word_1_195' title='bbox 1154 2293 1305 2334; x_wconf 97' lang='eng' dir='ltr'>catalytic</span> <span class='ocrx_word' id='word_1_196' title='bbox 1324 2293 1365 2323; x_wconf 99' lang='eng' dir='ltr'>tic</span>
</span>
<span class='ocr_line' id='line_1_38' title="bbox 355 2351 1367 2392; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_197' title='bbox 355 2351 524 2392; x_wconf 84' lang='eng' dir='ltr'>efficiency,</span> <span class='ocrx_word' id='word_1_198' title='bbox 534 2351 713 2392; x_wconf 93' lang='eng' dir='ltr'>re-routing</span> <span class='ocrx_word' id='word_1_199' title='bbox 723 2357 903 2381; x_wconf 98' lang='eng' dir='ltr'><a href="islands.html">tomorrow</a></span> <span class='ocrx_word' id='word_1_200' title='bbox 912 2351 1057 2392; x_wconf 96' lang='eng' dir='ltr'>through</span> <span class='ocrx_word' id='word_1_201' title='bbox 1065 2351 1153 2381; x_wconf 98' lang='eng' dir='ltr'>what</span> <span class='ocrx_word' id='word_1_202' title='bbox 1162 2351 1202 2381; x_wconf 98' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_203' title='bbox 1211 2357 1367 2391; x_wconf 94' lang='eng' dir='ltr'>prospect</span>
</span>
<span class='ocr_line' id='line_1_39' title="bbox 356 2410 793 2451; baseline -0.002 -10; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_204' title='bbox 356 2411 412 2441; x_wconf 89' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_205' title='bbox 422 2410 482 2440; x_wconf 89' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_206' title='bbox 491 2410 551 2440; x_wconf 89' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_207' title='bbox 559 2410 673 2440; x_wconf 88' lang='eng' dir='ltr'>makes</span> <span class='ocrx_word' id='word_1_208' title='bbox 686 2410 793 2451; x_wconf 88' lang='eng' dir='ltr'>today.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_10' title="bbox 414 2468 1363 2509">
<span class='ocr_line' id='line_1_40' title="bbox 414 2468 1363 2509; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_209' title='bbox 414 2468 617 2509; x_wconf 93' lang='eng' dir='ltr'>Virohyping</span> <span class='ocrx_word' id='word_1_210' title='bbox 628 2478 754 2508; x_wconf 94' lang='eng' dir='ltr'>sweeps</span> <span class='ocrx_word' id='word_1_211' title='bbox 766 2468 913 2509; x_wconf 96' lang='eng' dir='ltr'>through</span> <span class='ocrx_word' id='word_1_212' title='bbox 927 2468 983 2498; x_wconf 98' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_213' title='bbox 995 2468 1197 2509; x_wconf 94' lang='eng' dir='ltr'>advertising</span> <span class='ocrx_word' id='word_1_214' title='bbox 1208 2468 1363 2509; x_wconf 95' lang='eng' dir='ltr'>industry.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_11' title="bbox 418 2526 883 2567">
<span class='ocr_line' id='line_1_41' title="bbox 418 2526 883 2567; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_215' title='bbox 418 2527 582 2567; x_wconf 90' lang='eng' dir='ltr'>Everyone</span> <span class='ocrx_word' id='word_1_216' title='bbox 596 2526 660 2556; x_wconf 95' lang='eng' dir='ltr'>will</span> <span class='ocrx_word' id='word_1_217' title='bbox 674 2526 716 2556; x_wconf 98' lang='eng' dir='ltr'>be</span> <span class='ocrx_word' id='word_1_218' title='bbox 729 2526 836 2567; x_wconf 95' lang='eng' dir='ltr'>doing</span> <span class='ocrx_word' id='word_1_219' title='bbox 848 2526 883 2556; x_wconf 98' lang='eng' dir='ltr'>it.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_12' title="bbox 355 2585 1369 3154">
<span class='ocr_line' id='line_1_42' title="bbox 414 2585 1367 2626; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_220' title='bbox 414 2585 508 2615; x_wconf 93' lang='eng' dir='ltr'>Virus</span> <span class='ocrx_word' id='word_1_221' title='bbox 524 2585 551 2615; x_wconf 99' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_222' title='bbox 566 2585 719 2625; x_wconf 94' lang='eng' dir='ltr'>parasitic</span> <span class='ocrx_word' id='word_1_223' title='bbox 737 2585 780 2615; x_wconf 98' lang='eng' dir='ltr'>tic</span> <span class='ocrx_word' id='word_1_224' title='bbox 797 2585 976 2625; x_wconf 94' lang='eng' dir='ltr'>replicator</span> <span class='ocrx_word' id='word_1_225' title='bbox 991 2585 1087 2615; x_wconf 90' lang='eng' dir='ltr'>code:</span> <span class='ocrx_word' id='word_1_226' title='bbox 1105 2595 1147 2615; x_wconf 99' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_227' title='bbox 1165 2585 1367 2626; x_wconf 94' lang='eng' dir='ltr'>asignifying</span>
</span>
<span class='ocr_line' id='line_1_43' title="bbox 356 2643 1365 2683; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_228' title='bbox 356 2653 515 2683; x_wconf 93' lang='eng' dir='ltr'>sequence</span> <span class='ocrx_word' id='word_1_229' title='bbox 529 2643 567 2673; x_wconf 94' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_230' title='bbox 578 2643 741 2673; x_wconf 98' lang='eng' dir='ltr'><a href="home/doorway.html">machinic</a></span> <span class='ocrx_word' id='word_1_231' title='bbox 757 2643 833 2673; x_wconf 95' lang='eng' dir='ltr'>data</span> <span class='ocrx_word' id='word_1_232' title='bbox 846 2643 930 2673; x_wconf 91' lang='eng' dir='ltr'>ATA</span> <span class='ocrx_word' id='word_1_233' title='bbox 941 2644 1025 2673; x_wconf 95' lang='eng' dir='ltr'>ATA</span> <span class='ocrx_word' id='word_1_234' title='bbox 1040 2643 1229 2673; x_wconf 91' lang='eng' dir='ltr'>flow-break</span> <span class='ocrx_word' id='word_1_235' title='bbox 1243 2643 1365 2681; x_wconf 86' lang='eng' dir='ltr'>on/off,</span>
</span>
<span class='ocr_line' id='line_1_44' title="bbox 356 2703 1369 2744; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_236' title='bbox 356 2703 419 2741; x_wconf 94' lang='eng'>1/0,</span> <span class='ocrx_word' id='word_1_237' title='bbox 434 2703 594 2744; x_wconf 96' lang='eng' dir='ltr'>yang/yin</span> <span class='ocrx_word' id='word_1_238' title='bbox 609 2703 824 2744; x_wconf 93' lang='eng' dir='ltr'>intrinsically</span> <span class='ocrx_word' id='word_1_239' title='bbox 838 2703 994 2733; x_wconf 95' lang='eng' dir='ltr'>destined</span> <span class='ocrx_word' id='word_1_240' title='bbox 1010 2703 1062 2733; x_wconf 94' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_241' title='bbox 1076 2713 1148 2733; x_wconf 98' lang='eng' dir='ltr'>war.</span> <span class='ocrx_word' id='word_1_242' title='bbox 1167 2704 1206 2733; x_wconf 93' lang='eng' dir='ltr'>In</span> <span class='ocrx_word' id='word_1_243' title='bbox 1220 2703 1314 2743; x_wconf 94' lang='eng' dir='ltr'>place</span> <span class='ocrx_word' id='word_1_244' title='bbox 1330 2703 1369 2733; x_wconf 94' lang='eng' dir='ltr'>of</span>
</span>
<span class='ocr_line' id='line_1_45' title="bbox 355 2761 1365 2802; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_245' title='bbox 355 2771 441 2791; x_wconf 92' lang='eng' dir='ltr'>mess</span> <span class='ocrx_word' id='word_1_246' title='bbox 456 2767 752 2802; x_wconf 94' lang='eng' dir='ltr'>message-content</span> <span class='ocrx_word' id='word_1_247' title='bbox 768 2761 919 2791; x_wconf 93' lang='eng' dir='ltr'>virodata</span> <span class='ocrx_word' id='word_1_248' title='bbox 937 2761 963 2791; x_wconf 99' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_249' title='bbox 981 2761 1167 2791; x_wconf 95' lang='eng' dir='ltr'>assembled</span> <span class='ocrx_word' id='word_1_250' title='bbox 1182 2761 1263 2791; x_wconf 95' lang='eng' dir='ltr'>bled</span> <span class='ocrx_word' id='word_1_251' title='bbox 1279 2761 1365 2791; x_wconf 94' lang='eng' dir='ltr'>from</span>
</span>
<span class='ocr_line' id='line_1_46' title="bbox 357 2818 1366 2862; baseline 0 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_252' title='bbox 357 2818 552 2861; x_wconf 88' lang='eng' dir='ltr'>asignifying</span> <span class='ocrx_word' id='word_1_253' title='bbox 564 2820 727 2850; x_wconf 95' lang='eng' dir='ltr'>materials</span> <span class='ocrx_word' id='word_1_254' title='bbox 743 2820 818 2850; x_wconf 99' lang='eng' dir='ltr'>with</span> <span class='ocrx_word' id='word_1_255' title='bbox 834 2820 947 2851; x_wconf 91' lang='eng' dir='ltr'>CATA</span> <span class='ocrx_word' id='word_1_256' title='bbox 960 2820 1110 2861; x_wconf 91' lang='eng' dir='ltr'>catalytic</span> <span class='ocrx_word' id='word_1_257' title='bbox 1127 2818 1176 2862; x_wconf 93' lang='eng' dir='ltr'>(or</span> <span class='ocrx_word' id='word_1_258' title='bbox 1190 2820 1366 2861; x_wconf 93' lang='eng' dir='ltr'>positively</span>
</span>
<span class='ocr_line' id='line_1_47' title="bbox 358 2876 1368 2920; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_259' title='bbox 358 2876 671 2920; x_wconf 90' lang='eng' dir='ltr'>disproportionate)</span> <span class='ocrx_word' id='word_1_260' title='bbox 682 2878 856 2918; x_wconf 84' lang='eng' dir='ltr'>efficiency:</span> <span class='ocrx_word' id='word_1_261' title='bbox 867 2878 1012 2908; x_wconf 91' lang='eng' dir='ltr'>intruder</span> <span class='ocrx_word' id='word_1_262' title='bbox 1019 2878 1187 2918; x_wconf 93' lang='eng' dir='ltr'>passcode,</span> <span class='ocrx_word' id='word_1_263' title='bbox 1197 2878 1368 2908; x_wconf 92' lang='eng' dir='ltr'>locational</span>
</span>
<span class='ocr_line' id='line_1_48' title="bbox 359 2936 1367 2977; baseline 0 -11; x_size 37; x_descenders 7; x_ascenders 10"><span class='ocrx_word' id='word_1_264' title='bbox 359 2936 520 2973; x_wconf 83' lang='eng' dir='ltr'>ZIP-code,</span> <span class='ocrx_word' id='word_1_265' title='bbox 534 2936 824 2977; x_wconf 91' lang='eng' dir='ltr'>pseudogenomic</span> <span class='ocrx_word' id='word_1_266' title='bbox 838 2936 1016 2966; x_wconf 94' lang='eng' dir='ltr'>substitute</span> <span class='ocrx_word' id='word_1_267' title='bbox 1030 2936 1251 2973; x_wconf 86' lang='eng' dir='ltr'>instructions,</span> <span class='ocrx_word' id='word_1_268' title='bbox 1267 2942 1367 2966; x_wconf 92' lang='eng' dir='ltr'>muta-</span>
</span>
<span class='ocr_line' id='line_1_49' title="bbox 359 2993 1367 3038; baseline 0.003 -13; x_size 43; x_descenders 11; x_ascenders 12"><span class='ocrx_word' id='word_1_269' title='bbox 359 2995 462 3030; x_wconf 85' lang='eng' dir='ltr'>tional</span> <span class='ocrx_word' id='word_1_270' title='bbox 469 2995 557 3036; x_wconf 86' lang='eng' dir='ltr'>junk</span> <span class='ocrx_word' id='word_1_271' title='bbox 570 2993 743 3038; x_wconf 90' lang='eng' dir='ltr'>(complex</span> <span class='ocrx_word' id='word_1_272' title='bbox 754 2995 815 3025; x_wconf 94' lang='eng' dir='ltr'>but</span> <span class='ocrx_word' id='word_1_273' title='bbox 828 2995 931 3025; x_wconf 92' lang='eng' dir='ltr'>latent</span> <span class='ocrx_word' id='word_1_274' title='bbox 943 2993 1134 3037; x_wconf 86' lang='eng' dir='ltr'>segments),</span> <span class='ocrx_word' id='word_1_275' title='bbox 1148 2995 1214 3025; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_276' title='bbox 1225 2997 1367 3038; x_wconf 91' lang='eng' dir='ltr'>garbage</span>
</span>
<span class='ocr_line' id='line_1_50' title="bbox 359 3051 1367 3096; baseline 0 -13; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_277' title='bbox 359 3051 572 3096; x_wconf 91' lang='eng' dir='ltr'>(redundant</span> <span class='ocrx_word' id='word_1_278' title='bbox 591 3063 1367 3093; x_wconf 89' lang='eng' dir='ltr'>scrapcrapcrapcrapcrapcrapcrapcrapcrap-</span>
</span>
<span class='ocr_line' id='line_1_51' title="bbox 358 3110 708 3154; baseline 0 -12; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_279' title='bbox 358 3110 708 3154; x_wconf 92' lang='eng' dir='ltr'>crapcrapcrapcrap).</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_13' title="bbox 357 3171 1368 3563">
<span class='ocr_line' id='line_1_52' title="bbox 423 3171 1368 3212; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_280' title='bbox 423 3171 572 3201; x_wconf 94' lang='eng' dir='ltr'>Biovirus</span> <span class='ocrx_word' id='word_1_281' title='bbox 586 3171 646 3201; x_wconf 90' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_282' title='bbox 655 3171 716 3201; x_wconf 92' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_283' title='bbox 724 3171 785 3201; x_wconf 92' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_284' title='bbox 799 3177 918 3212; x_wconf 94' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_285' title='bbox 935 3171 1126 3212; x_wconf 86' lang='eng' dir='ltr'>organisms,</span> <span class='ocrx_word' id='word_1_286' title='bbox 1145 3171 1287 3212; x_wconf 85' lang='eng' dir='ltr'>hacking</span> <span class='ocrx_word' id='word_1_287' title='bbox 1299 3171 1368 3201; x_wconf 92' lang='eng' dir='ltr'>and</span>
</span>
<span class='ocr_line' id='line_1_53' title="bbox 358 3229 1368 3270; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_288' title='bbox 358 3229 641 3270; x_wconf 92' lang='eng' dir='ltr'>reprogramming</span> <span class='ocrx_word' id='word_1_289' title='bbox 647 3229 1368 3259; x_wconf 71' lang='eng' dir='ltr'>ATGAC&#39;ITATCCACGGTACATTCAGT</span>
</span>
<span class='ocr_line' id='line_1_54' title="bbox 358 3287 1366 3327; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_290' title='bbox 358 3287 492 3317; x_wconf 94' lang='eng' dir='ltr'>cellular</span> <span class='ocrx_word' id='word_1_291' title='bbox 502 3296 578 3317; x_wconf 89' lang='eng' dir='ltr'>DNA</span> <span class='ocrx_word' id='word_1_292' title='bbox 592 3293 624 3317; x_wconf 99' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_293' title='bbox 634 3287 784 3327; x_wconf 92' lang='eng' dir='ltr'>produce</span> <span class='ocrx_word' id='word_1_294' title='bbox 795 3297 887 3317; x_wconf 94' lang='eng' dir='ltr'>more</span> <span class='ocrx_word' id='word_1_295' title='bbox 896 3287 984 3317; x_wconf 93' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_296' title='bbox 994 3287 1079 3317; x_wconf 94' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_297' title='bbox 1089 3287 1176 3317; x_wconf 94' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_298' title='bbox 1185 3287 1271 3317; x_wconf 95' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_299' title='bbox 1280 3287 1366 3317; x_wconf 94' lang='eng' dir='ltr'>virus</span>
</span>
<span class='ocr_line' id='line_1_55' title="bbox 358 3345 1365 3385; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_300' title='bbox 358 3345 445 3375; x_wconf 93' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_301' title='bbox 459 3345 547 3375; x_wconf 93' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_302' title='bbox 563 3345 660 3375; x_wconf 92' lang='eng' dir='ltr'>virus.</span> <span class='ocrx_word' id='word_1_303' title='bbox 680 3346 726 3375; x_wconf 95' lang='eng' dir='ltr'>Its</span> <span class='ocrx_word' id='word_1_304' title='bbox 740 3345 889 3385; x_wconf 92' lang='eng' dir='ltr'>enzymic</span> <span class='ocrx_word' id='word_1_305' title='bbox 905 3345 1127 3385; x_wconf 91' lang='eng' dir='ltr'>cut-and-past</span> <span class='ocrx_word' id='word_1_306' title='bbox 1141 3345 1365 3375; x_wconf 91' lang='eng' dir='ltr'>recombinant</span>
</span>
<span class='ocr_line' id='line_1_56' title="bbox 357 3404 1365 3445; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_307' title='bbox 357 3404 678 3445; x_wconf 92' lang='eng' dir='ltr'>wetware-splicing</span> <span class='ocrx_word' id='word_1_308' title='bbox 699 3414 829 3434; x_wconf 94' lang='eng' dir='ltr'>crosses</span> <span class='ocrx_word' id='word_1_309' title='bbox 852 3404 1054 3445; x_wconf 91' lang='eng' dir='ltr'>singularity</span> <span class='ocrx_word' id='word_1_310' title='bbox 1074 3404 1173 3434; x_wconf 92' lang='eng' dir='ltr'>when</span> <span class='ocrx_word' id='word_1_311' title='bbox 1195 3404 1365 3434; x_wconf 94' lang='eng' dir='ltr'>retroviral</span>
</span>
<span class='ocr_line' id='line_1_57' title="bbox 358 3460 1364 3505; baseline 0 -13; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_312' title='bbox 358 3462 723 3502; x_wconf 91' lang='eng' dir='ltr'>reverse-transcriptase</span> <span class='ocrx_word' id='word_1_313' title='bbox 733 3462 832 3492; x_wconf 92' lang='eng' dir='ltr'>clicks</span> <span class='ocrx_word' id='word_1_314' title='bbox 841 3462 876 3492; x_wconf 91' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_315' title='bbox 887 3460 1057 3505; x_wconf 91' lang='eng' dir='ltr'>(enabling</span> <span class='ocrx_word' id='word_1_316' title='bbox 1065 3462 1271 3503; x_wconf 91' lang='eng' dir='ltr'>ontogenetic</span> <span class='ocrx_word' id='word_1_317' title='bbox 1281 3471 1364 3492; x_wconf 91' lang='eng' dir='ltr'>DNA-</span>
</span>
<span class='ocr_line' id='line_1_58' title="bbox 360 3519 1187 3563; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_318' title='bbox 360 3530 433 3551; x_wconf 90' lang='eng' dir='ltr'>RNA</span> <span class='ocrx_word' id='word_1_319' title='bbox 446 3521 599 3561; x_wconf 92' lang='eng' dir='ltr'>circuitry</span> <span class='ocrx_word' id='word_1_320' title='bbox 611 3521 680 3551; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_321' title='bbox 692 3521 920 3551; x_wconf 91' lang='eng' dir='ltr'>endocellular</span> <span class='ocrx_word' id='word_1_322' title='bbox 932 3519 1187 3563; x_wconf 91' lang='eng' dir='ltr'>computation).</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_14' title="bbox 357 3579 1364 3901">
<span class='ocr_line' id='line_1_59' title="bbox 419 3579 1364 3609; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_323' title='bbox 419 3579 1364 3609; x_wconf 92' lang='eng' dir='ltr'>ATAGGTCATGAATCTACCGATTGCAGCTGC</span>
</span>
<span class='ocr_line' id='line_1_60' title="bbox 357 3637 1363 3667; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_324' title='bbox 357 3637 1363 3667; x_wconf 90' lang='eng' dir='ltr'>TATTCCTCGATGATCGCATGGGCTGTGATG</span>
</span>
<span class='ocr_line' id='line_1_61' title="bbox 358 3696 1363 3726; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_325' title='bbox 358 3696 1363 3726; x_wconf 77' lang='eng' dir='ltr'><a href="VB01.html">GCATCGTATCCGATCGATTCGAGCGATTGCAGC</a></span>
</span>
<span class='ocr_line' id='line_1_62' title="bbox 357 3754 1362 3784; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_326' title='bbox 357 3754 1362 3784; x_wconf 75' lang='eng' dir='ltr'>TACGCTATTCCTCCGAGGGATTGCAGCTACGTC</span>
</span>
<span class='ocr_line' id='line_1_63' title="bbox 358 3812 1363 3843; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_327' title='bbox 358 3812 1363 3843; x_wconf 91' lang='eng' dir='ltr'>GCATCGGGCTCAGATGTAGGTCATGAATCTACC</span>
</span>
<span class='ocr_line' id='line_1_64' title="bbox 359 3871 1327 3901; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_328' title='bbox 359 3871 747 3901; x_wconf 79' lang='eng' dir='ltr'>GATTGCATGACTT</span> <span class='ocrx_word' id='word_1_329' title='bbox 743 3871 1298 3901; x_wconf 79' lang='eng' dir='ltr'>ATCCACGGTACAITCGACT</span> <span class='ocrx_word' id='word_1_330' title='bbox 1299 3871 1327 3901; x_wconf 96' lang='eng' dir='ltr'>C</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_15' title="bbox 358 3929 1372 4539">
<span class='ocr_line' id='line_1_65' title="bbox 423 3929 1362 3970; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_331' title='bbox 423 3929 623 3959; x_wconf 90' lang='eng' dir='ltr'>Ethnovirus</span> <span class='ocrx_word' id='word_1_332' title='bbox 639 3935 759 3970; x_wconf 93' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_333' title='bbox 774 3929 884 3959; x_wconf 92' lang='eng' dir='ltr'>brains</span> <span class='ocrx_word' id='word_1_334' title='bbox 897 3929 1117 3959; x_wconf 92' lang='eng' dir='ltr'>Technovirus</span> <span class='ocrx_word' id='word_1_335' title='bbox 1132 3935 1248 3970; x_wconf 92' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_336' title='bbox 1262 3929 1362 3959; x_wconf 94' lang='eng' dir='ltr'>socio-</span>
</span>
<span class='ocr_line' id='line_1_66' title="bbox 358 3988 1361 4028; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_337' title='bbox 358 3988 531 4018; x_wconf 92' lang='eng' dir='ltr'>economic</span> <span class='ocrx_word' id='word_1_338' title='bbox 549 3998 611 4028; x_wconf 93' lang='eng' dir='ltr'>pro</span> <span class='ocrx_word' id='word_1_339' title='bbox 628 3998 690 4028; x_wconf 93' lang='eng' dir='ltr'>pro</span> <span class='ocrx_word' id='word_1_340' title='bbox 707 3988 912 4028; x_wconf 91' lang='eng' dir='ltr'>production</span> <span class='ocrx_word' id='word_1_341' title='bbox 929 3998 990 4028; x_wconf 93' lang='eng' dir='ltr'>pro</span> <span class='ocrx_word' id='word_1_342' title='bbox 1007 3998 1182 4028; x_wconf 92' lang='eng' dir='ltr'>processes.</span> <span class='ocrx_word' id='word_1_343' title='bbox 1202 3988 1361 4018; x_wconf 91' lang='eng' dir='ltr'>Infovirus</span>
</span>
<span class='ocr_line' id='line_1_67' title="bbox 360 4046 1361 4087; baseline -0.001 -11; x_size 41; x_descenders 11; x_ascenders 9"><span class='ocrx_word' id='word_1_344' title='bbox 360 4052 474 4087; x_wconf 90' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_345' title='bbox 484 4046 597 4087; x_wconf 91' lang='eng' dir='ltr'>digital</span> <span class='ocrx_word' id='word_1_346' title='bbox 606 4054 1361 4076; x_wconf 94' lang='eng'>010010010001011110100001001101010101010</span>
</span>
<span class='ocr_line' id='line_1_68' title="bbox 360 4111 1360 4145; baseline 0 -10; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_347' title='bbox 360 4111 1360 4145; x_wconf 91' lang='eng' dir='ltr'>10001001101010010010100computers100101001011010010</span>
</span>
<span class='ocr_line' id='line_1_69' title="bbox 360 4171 1360 4192; baseline 0.001 -1; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_348' title='bbox 360 4171 1360 4192; x_wconf 89' lang='eng'>101111010001010101010101010010101001010110101001</span>
</span>
<span class='ocr_line' id='line_1_70' title="bbox 358 4228 1359 4250; baseline -0.001 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_349' title='bbox 358 4228 1359 4250; x_wconf 94' lang='eng'>000000100010111010100100101010010100100101010101</span>
</span>
<span class='ocr_line' id='line_1_71' title="bbox 359 4286 1358 4308; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_350' title='bbox 359 4286 1358 4308; x_wconf 91' lang='eng'>00100010010010010010010010100100101011010100100</span>
</span>
<span class='ocr_line' id='line_1_72' title="bbox 360 4344 1358 4366; baseline 0.001 -1; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_351' title='bbox 360 4344 1358 4366; x_wconf 94' lang='eng'>10010101101010101010111101000010011010101010101000</span>
</span>
<span class='ocr_line' id='line_1_73' title="bbox 361 4403 1359 4425; baseline 0.001 -1; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_352' title='bbox 361 4403 1359 4425; x_wconf 91' lang='eng'>1001101101010101001100100010001010101110100001010</span>
</span>
<span class='ocr_line' id='line_1_74' title="bbox 360 4461 1372 4482; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_353' title='bbox 360 4461 1372 4482; x_wconf 96' lang='eng'>110010100101000110010011100100010000000001001111</span>
</span>
<span class='ocr_line' id='line_1_75' title="bbox 360 4517 680 4539; baseline -0.003 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_354' title='bbox 360 4517 680 4539; x_wconf 94' lang='eng'>1100010010010101</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_16' title="bbox 360 4568 1375 5015">
<span class='ocr_line' id='line_1_76' title="bbox 425 4568 1372 4609; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_355' title='bbox 425 4568 626 4608; x_wconf 92' lang='eng' dir='ltr'>Hypervirus</span> <span class='ocrx_word' id='word_1_356' title='bbox 639 4574 759 4609; x_wconf 94' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_357' title='bbox 770 4568 957 4609; x_wconf 91' lang='eng' dir='ltr'>intelligent</span> <span class='ocrx_word' id='word_1_358' title='bbox 968 4568 1264 4608; x_wconf 91' lang='eng' dir='ltr'>immunosecurity</span> <span class='ocrx_word' id='word_1_359' title='bbox 1274 4574 1372 4598; x_wconf 94' lang='eng' dir='ltr'>struc-</span>
</span>
<span class='ocr_line' id='line_1_77' title="bbox 361 4626 1372 4667; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_360' title='bbox 361 4633 458 4656; x_wconf 89' lang='eng' dir='ltr'>tures:</span> <span class='ocrx_word' id='word_1_361' title='bbox 470 4636 525 4666; x_wconf 91' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_362' title='bbox 535 4636 589 4666; x_wconf 92' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_363' title='bbox 601 4636 646 4656; x_wconf 92' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_364' title='bbox 656 4636 712 4666; x_wconf 91' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_365' title='bbox 724 4636 769 4656; x_wconf 92' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_366' title='bbox 782 4626 1003 4666; x_wconf 91' lang='eng' dir='ltr'>nomadically</span> <span class='ocrx_word' id='word_1_367' title='bbox 1015 4626 1219 4667; x_wconf 91' lang='eng' dir='ltr'>abstracting</span> <span class='ocrx_word' id='word_1_368' title='bbox 1229 4626 1269 4656; x_wconf 94' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_369' title='bbox 1280 4636 1372 4666; x_wconf 93' lang='eng' dir='ltr'>proc-</span>
</span>
<span class='ocr_line' id='line_1_78' title="bbox 362 4682 1372 4726; baseline 0 -12; x_size 37; x_descenders 7; x_ascenders 10"><span class='ocrx_word' id='word_1_370' title='bbox 362 4694 444 4714; x_wconf 94' lang='eng' dir='ltr'>esses</span> <span class='ocrx_word' id='word_1_371' title='bbox 457 4684 540 4714; x_wconf 90' lang='eng' dir='ltr'>from</span> <span class='ocrx_word' id='word_1_372' title='bbox 552 4684 681 4724; x_wconf 88' lang='eng' dir='ltr'>specific</span> <span class='ocrx_word' id='word_1_373' title='bbox 694 4684 803 4714; x_wconf 95' lang='eng' dir='ltr'>media</span> <span class='ocrx_word' id='word_1_374' title='bbox 816 4682 918 4726; x_wconf 88' lang='eng' dir='ltr'>(DNA,</span> <span class='ocrx_word' id='word_1_375' title='bbox 928 4684 1050 4721; x_wconf 94' lang='eng' dir='ltr'>words,</span> <span class='ocrx_word' id='word_1_376' title='bbox 1061 4684 1222 4724; x_wconf 91' lang='eng' dir='ltr'>symbolic</span> <span class='ocrx_word' id='word_1_377' title='bbox 1232 4684 1372 4721; x_wconf 94' lang='eng' dir='ltr'>models,</span>
</span>
<span class='ocr_line' id='line_1_79' title="bbox 361 4741 1373 4784; baseline 0 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_378' title='bbox 361 4741 632 4784; x_wconf 91' lang='eng' dir='ltr'>bit-sequences),</span> <span class='ocrx_word' id='word_1_379' title='bbox 653 4742 722 4772; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_380' title='bbox 739 4742 921 4782; x_wconf 92' lang='eng' dir='ltr'>operantly</span> <span class='ocrx_word' id='word_1_381' title='bbox 938 4742 1207 4783; x_wconf 92' lang='eng' dir='ltr'>re-engineering</span> <span class='ocrx_word' id='word_1_382' title='bbox 1224 4742 1321 4772; x_wconf 82' lang='eng' dir='ltr'>itself.</span> <span class='ocrx_word' id='word_1_383' title='bbox 1345 4743 1373 4772; x_wconf 95' lang='eng' dir='ltr'>It</span>
</span>
<span class='ocr_line' id='line_1_80' title="bbox 361 4800 1375 4841; baseline 0 -11; x_size 37; x_descenders 7; x_ascenders 10"><span class='ocrx_word' id='word_1_384' title='bbox 361 4800 448 4830; x_wconf 82' lang='eng' dir='ltr'>folds</span> <span class='ocrx_word' id='word_1_385' title='bbox 462 4800 532 4830; x_wconf 92' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_386' title='bbox 544 4800 639 4837; x_wconf 82' lang='eng' dir='ltr'>itself,</span> <span class='ocrx_word' id='word_1_387' title='bbox 653 4800 828 4837; x_wconf 92' lang='eng' dir='ltr'>involutes,</span> <span class='ocrx_word' id='word_1_388' title='bbox 843 4810 881 4830; x_wconf 95' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_389' title='bbox 893 4800 1018 4840; x_wconf 90' lang='eng' dir='ltr'>plexes,</span> <span class='ocrx_word' id='word_1_390' title='bbox 1033 4800 1077 4840; x_wconf 93' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_391' title='bbox 1089 4800 1375 4841; x_wconf 91' lang='eng' dir='ltr'>reprogramming</span>
</span>
<span class='ocr_line' id='line_1_81' title="bbox 360 4858 1372 4899; baseline 0 -11; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_392' title='bbox 360 4858 573 4898; x_wconf 89' lang='eng' dir='ltr'>corpuscular</span> <span class='ocrx_word' id='word_1_393' title='bbox 590 4858 674 4888; x_wconf 92' lang='eng' dir='ltr'>code</span> <span class='ocrx_word' id='word_1_394' title='bbox 696 4864 730 4888; x_wconf 97' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_395' title='bbox 749 4868 940 4899; x_wconf 92' lang='eng' dir='ltr'>reprogram</span> <span class='ocrx_word' id='word_1_396' title='bbox 960 4858 1247 4899; x_wconf 91' lang='eng' dir='ltr'>reprogramming</span> <span class='ocrx_word' id='word_1_397' title='bbox 1265 4868 1372 4898; x_wconf 92' lang='eng' dir='ltr'>repro-</span>
</span>
<span class='ocr_line' id='line_1_82' title="bbox 360 4916 1373 4958; baseline -0.001 -11; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_398' title='bbox 360 4917 547 4958; x_wconf 90' lang='eng' dir='ltr'>gramming</span> <span class='ocrx_word' id='word_1_399' title='bbox 556 4916 849 4957; x_wconf 92' lang='eng' dir='ltr'>reprogramming.</span> <span class='ocrx_word' id='word_1_400' title='bbox 865 4925 945 4946; x_wconf 90' lang='eng' dir='ltr'>ROM</span> <span class='ocrx_word' id='word_1_401' title='bbox 959 4916 986 4946; x_wconf 95' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_402' title='bbox 997 4916 1121 4946; x_wconf 95' lang='eng' dir='ltr'>melted</span> <span class='ocrx_word' id='word_1_403' title='bbox 1130 4916 1202 4946; x_wconf 91' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_404' title='bbox 1213 4916 1373 4946; x_wconf 94' lang='eng' dir='ltr'>recursive</span>
</span>
<span class='ocr_line' id='line_1_83' title="bbox 361 4975 666 5015; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_405' title='bbox 361 4975 666 5015; x_wconf 90' lang='eng' dir='ltr'>experimentation.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_17' title="bbox 363 5041 1374 5364">
<span class='ocr_line' id='line_1_84' title="bbox 423 5041 1373 5062; baseline -0.001 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_406' title='bbox 423 5041 1373 5062; x_wconf 96' lang='eng'>001010010010010110000101010101011101010010100</span>
</span>
<span class='ocr_line' id='line_1_85' title="bbox 363 5100 1373 5121; baseline 0.001 -1; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_407' title='bbox 363 5100 1373 5121; x_wconf 96' lang='eng'>10010101000011011001101001011000010001001001000</span>
</span>
<span class='ocr_line' id='line_1_86' title="bbox 363 5149 1374 5190; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_408' title='bbox 363 5149 548 5190; x_wconf 91' lang='eng' dir='ltr'>Recording</span> <span class='ocrx_word' id='word_1_409' title='bbox 556 5149 695 5179; x_wconf 94' lang='eng' dir='ltr'>devices.</span> <span class='ocrx_word' id='word_1_410' title='bbox 707 5149 856 5189; x_wconf 93' lang='eng' dir='ltr'>Copiers.</span> <span class='ocrx_word' id='word_1_411' title='bbox 869 5150 979 5179; x_wconf 90' lang='eng' dir='ltr'>Faxes.</span> <span class='ocrx_word' id='word_1_412' title='bbox 992 5149 1167 5189; x_wconf 92' lang='eng' dir='ltr'>Samplers.</span> <span class='ocrx_word' id='word_1_413' title='bbox 1181 5155 1374 5179; x_wconf 90' lang='eng' dir='ltr'>K-stammer</span>
</span>
<span class='ocr_line' id='line_1_87' title="bbox 363 5207 1372 5252; baseline 0 -14; x_size 43; x_descenders 12; x_ascenders 11"><span class='ocrx_word' id='word_1_414' title='bbox 363 5207 639 5252; x_wconf 90' lang='eng' dir='ltr'>(((re)re)reruns)</span> <span class='ocrx_word' id='word_1_415' title='bbox 656 5214 814 5238; x_wconf 90' lang='eng' dir='ltr'>cross-cut</span> <span class='ocrx_word' id='word_1_416' title='bbox 829 5208 873 5248; x_wconf 92' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_417' title='bbox 886 5208 1016 5248; x_wconf 91' lang='eng' dir='ltr'>orphan</span> <span class='ocrx_word' id='word_1_418' title='bbox 1032 5207 1117 5238; x_wconf 82' lang='eng' dir='ltr'>drift.</span> <span class='ocrx_word' id='word_1_419' title='bbox 1136 5209 1261 5248; x_wconf 90' lang='eng' dir='ltr'>Repeat</span> <span class='ocrx_word' id='word_1_420' title='bbox 1274 5208 1372 5238; x_wconf 91' lang='eng' dir='ltr'>infec-</span>
</span>
<span class='ocr_line' id='line_1_88' title="bbox 363 5266 1372 5306; baseline 0 -10; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_421' title='bbox 363 5266 442 5296; x_wconf 91' lang='eng' dir='ltr'>tion.</span> <span class='ocrx_word' id='word_1_422' title='bbox 462 5266 515 5296; x_wconf 95' lang='eng' dir='ltr'>All</span> <span class='ocrx_word' id='word_1_423' title='bbox 533 5266 619 5306; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_424' title='bbox 638 5266 728 5306; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_425' title='bbox 747 5266 834 5306; x_wconf 91' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_426' title='bbox 854 5266 942 5306; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_427' title='bbox 963 5266 1051 5306; x_wconf 91' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_428' title='bbox 1070 5266 1160 5306; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_429' title='bbox 1179 5266 1266 5306; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_430' title='bbox 1286 5266 1372 5306; x_wconf 92' lang='eng' dir='ltr'>hype</span>
</span>
<span class='ocr_line' id='line_1_89' title="bbox 363 5324 1238 5364; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_431' title='bbox 363 5324 551 5364; x_wconf 92' lang='eng' dir='ltr'>hypervirus</span> <span class='ocrx_word' id='word_1_432' title='bbox 564 5324 682 5354; x_wconf 91' lang='eng' dir='ltr'>strains</span> <span class='ocrx_word' id='word_1_433' title='bbox 696 5334 748 5354; x_wconf 95' lang='eng' dir='ltr'>are</span> <span class='ocrx_word' id='word_1_434' title='bbox 761 5324 879 5364; x_wconf 91' lang='eng' dir='ltr'>plastic</span> <span class='ocrx_word' id='word_1_435' title='bbox 894 5324 959 5354; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_436' title='bbox 973 5324 1238 5364; x_wconf 91' lang='eng' dir='ltr'>interoperative.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_18' title="bbox 361 5382 1376 6063">
<span class='ocr_line' id='line_1_90' title="bbox 425 5382 1371 5423; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_437' title='bbox 425 5383 587 5412; x_wconf 70' lang='eng' dir='ltr'>INSERT.</span> <span class='ocrx_word' id='word_1_438' title='bbox 602 5382 885 5423; x_wconf 80' lang='eng' dir='ltr'>hyper-prefixing</span> <span class='ocrx_word' id='word_1_439' title='bbox 896 5382 1045 5413; x_wconf 84' lang='eng' dir='ltr'>semiotic</span> <span class='ocrx_word' id='word_1_440' title='bbox 1058 5388 1178 5412; x_wconf 84' lang='eng' dir='ltr'>sectors</span> <span class='ocrx_word' id='word_1_441' title='bbox 1186 5382 1278 5412; x_wconf 86' lang='eng' dir='ltr'>TAG</span> <span class='ocrx_word' id='word_1_442' title='bbox 1285 5382 1371 5412; x_wconf 92' lang='eng' dir='ltr'>TAG</span>
</span>
<span class='ocr_line' id='line_1_91' title="bbox 361 5438 1372 5482; baseline 0 -12; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_443' title='bbox 361 5440 446 5470; x_wconf 90' lang='eng' dir='ltr'>TAG</span> <span class='ocrx_word' id='word_1_444' title='bbox 455 5446 521 5481; x_wconf 89' lang='eng' dir='ltr'>tags</span> <span class='ocrx_word' id='word_1_445' title='bbox 529 5440 616 5470; x_wconf 93' lang='eng' dir='ltr'>them</span> <span class='ocrx_word' id='word_1_446' title='bbox 624 5440 675 5470; x_wconf 95' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_447' title='bbox 683 5440 817 5470; x_wconf 92' lang='eng' dir='ltr'>transfer</span> <span class='ocrx_word' id='word_1_448' title='bbox 824 5440 894 5470; x_wconf 92' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_449' title='bbox 902 5440 1041 5470; x_wconf 94' lang='eng' dir='ltr'>abstract</span> <span class='ocrx_word' id='word_1_450' title='bbox 1048 5440 1134 5470; x_wconf 89' lang='eng' dir='ltr'>ACT</span> <span class='ocrx_word' id='word_1_451' title='bbox 1140 5440 1225 5470; x_wconf 89' lang='eng' dir='ltr'>ACT</span> <span class='ocrx_word' id='word_1_452' title='bbox 1234 5438 1372 5482; x_wconf 91' lang='eng' dir='ltr'>(nonlin-</span>
</span>
<span class='ocr_line' id='line_1_92' title="bbox 363 5497 1375 5540; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_453' title='bbox 363 5508 415 5528; x_wconf 91' lang='eng' dir='ltr'>ear</span> <span class='ocrx_word' id='word_1_454' title='bbox 423 5497 657 5540; x_wconf 91' lang='eng' dir='ltr'>transcodable)</span> <span class='ocrx_word' id='word_1_455' title='bbox 667 5498 829 5528; x_wconf 92' lang='eng' dir='ltr'>machinic</span> <span class='ocrx_word' id='word_1_456' title='bbox 837 5504 980 5538; x_wconf 91' lang='eng' dir='ltr'>systems,</span> <span class='ocrx_word' id='word_1_457' title='bbox 992 5498 1094 5528; x_wconf 92' lang='eng' dir='ltr'>tuned</span> <span class='ocrx_word' id='word_1_458' title='bbox 1103 5504 1136 5528; x_wconf 97' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_459' title='bbox 1144 5498 1329 5528; x_wconf 94' lang='eng' dir='ltr'>virtualities</span> <span class='ocrx_word' id='word_1_460' title='bbox 1338 5508 1375 5528; x_wconf 95' lang='eng' dir='ltr'>or</span>
</span>
<span class='ocr_line' id='line_1_93' title="bbox 364 5556 1371 5600; baseline 0 -13; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_461' title='bbox 364 5557 576 5597; x_wconf 91' lang='eng' dir='ltr'>hyperspeeds</span> <span class='ocrx_word' id='word_1_462' title='bbox 586 5556 720 5600; x_wconf 95' lang='eng' dir='ltr'>(futural</span> <span class='ocrx_word' id='word_1_463' title='bbox 728 5557 906 5587; x_wconf 91' lang='eng' dir='ltr'>currencies</span> <span class='ocrx_word' id='word_1_464' title='bbox 914 5557 1137 5597; x_wconf 91' lang='eng' dir='ltr'>independent</span> <span class='ocrx_word' id='word_1_465' title='bbox 1146 5557 1184 5587; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_466' title='bbox 1189 5557 1246 5587; x_wconf 95' lang='eng' dir='ltr'>def</span> <span class='ocrx_word' id='word_1_467' title='bbox 1248 5557 1371 5587; x_wconf 94' lang='eng' dir='ltr'>uturali-</span>
</span>
<span class='ocr_line' id='line_1_94' title="bbox 365 5614 1373 5657; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_468' title='bbox 365 5614 494 5657; x_wconf 91' lang='eng' dir='ltr'>zation).</span> <span class='ocrx_word' id='word_1_469' title='bbox 507 5615 725 5655; x_wconf 91' lang='eng' dir='ltr'>Hypermedia</span> <span class='ocrx_word' id='word_1_470' title='bbox 734 5615 900 5656; x_wconf 88' lang='eng' dir='ltr'>configure</span> <span class='ocrx_word' id='word_1_471' title='bbox 910 5625 942 5645; x_wconf 95' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_472' title='bbox 952 5625 983 5645; x_wconf 95' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_473' title='bbox 992 5625 1087 5655; x_wconf 92' lang='eng' dir='ltr'>every</span> <span class='ocrx_word' id='word_1_474' title='bbox 1095 5615 1373 5655; x_wconf 92' lang='eng' dir='ltr'>implementation</span>
</span>
<span class='ocr_line' id='line_1_95' title="bbox 362 5674 1376 5714; baseline 0.001 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_475' title='bbox 362 5674 476 5704; x_wconf 91' lang='eng' dir='ltr'>within</span> <span class='ocrx_word' id='word_1_476' title='bbox 487 5684 505 5704; x_wconf 96' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_477' title='bbox 517 5674 647 5714; x_wconf 88' lang='eng' dir='ltr'>specific</span> <span class='ocrx_word' id='word_1_478' title='bbox 661 5674 806 5704; x_wconf 95' lang='eng' dir='ltr'>medium</span> <span class='ocrx_word' id='word_1_479' title='bbox 820 5684 858 5704; x_wconf 95' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_480' title='bbox 870 5674 1022 5714; x_wconf 92' lang='eng' dir='ltr'>territory</span> <span class='ocrx_word' id='word_1_481' title='bbox 1032 5684 1066 5704; x_wconf 94' lang='eng' dir='ltr'>as</span> <span class='ocrx_word' id='word_1_482' title='bbox 1078 5684 1096 5704; x_wconf 96' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_483' title='bbox 1108 5674 1327 5704; x_wconf 91' lang='eng' dir='ltr'>subfunction</span> <span class='ocrx_word' id='word_1_484' title='bbox 1339 5674 1376 5704; x_wconf 98' lang='eng' dir='ltr'>of</span>
</span>
<span class='ocr_line' id='line_1_96' title="bbox 364 5730 1371 5776; baseline -0.001 -13; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_485' title='bbox 364 5732 624 5763; x_wconf 89' lang='eng' dir='ltr'>extraterritorial</span> <span class='ocrx_word' id='word_1_486' title='bbox 635 5742 815 5772; x_wconf 87' lang='eng' dir='ltr'>processes.</span> <span class='ocrx_word' id='word_1_487' title='bbox 830 5732 946 5773; x_wconf 92' lang='eng' dir='ltr'>Going</span> <span class='ocrx_word' id='word_1_488' title='bbox 959 5730 987 5775; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_489' title='bbox 1002 5730 1014 5774; x_wconf 96' lang='eng'>(</span> <span class='ocrx_word' id='word_1_490' title='bbox 1028 5730 1074 5775; x_wconf 92' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_491' title='bbox 1089 5730 1101 5774; x_wconf 96' lang='eng'>(</span> <span class='ocrx_word' id='word_1_492' title='bbox 1115 5730 1127 5774; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_493' title='bbox 1143 5730 1154 5774; x_wconf 91' lang='eng'>(</span> <span class='ocrx_word' id='word_1_494' title='bbox 1167 5730 1179 5774; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_495' title='bbox 1195 5731 1223 5775; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_496' title='bbox 1236 5730 1248 5774; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_497' title='bbox 1273 5730 1285 5774; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_498' title='bbox 1300 5731 1328 5776; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_499' title='bbox 1342 5731 1371 5776; x_wconf 89' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_97' title="bbox 367 5790 1373 5834; baseline 0 -13; x_size 42; x_descenders 11; x_ascenders 11"><span class='ocrx_word' id='word_1_500' title='bbox 367 5790 378 5834; x_wconf 91' lang='eng'>(</span> <span class='ocrx_word' id='word_1_501' title='bbox 392 5790 404 5834; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_502' title='bbox 419 5791 519 5831; x_wconf 92' lang='eng' dir='ltr'>hyper</span> <span class='ocrx_word' id='word_1_503' title='bbox 531 5791 690 5821; x_wconf 93' lang='eng' dir='ltr'>dissolves</span> <span class='ocrx_word' id='word_1_504' title='bbox 703 5791 806 5832; x_wconf 91' lang='eng' dir='ltr'>being</span> <span class='ocrx_word' id='word_1_505' title='bbox 818 5791 889 5821; x_wconf 91' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_506' title='bbox 900 5791 990 5821; x_wconf 93' lang='eng' dir='ltr'>ACT</span> <span class='ocrx_word' id='word_1_507' title='bbox 999 5791 1089 5821; x_wconf 93' lang='eng' dir='ltr'>ACT</span> <span class='ocrx_word' id='word_1_508' title='bbox 1099 5791 1187 5821; x_wconf 89' lang='eng' dir='ltr'>ACT</span> <span class='ocrx_word' id='word_1_509' title='bbox 1199 5791 1340 5831; x_wconf 87' lang='eng' dir='ltr'>activity;</span> <span class='ocrx_word' id='word_1_510' title='bbox 1355 5801 1373 5821; x_wconf 96' lang='eng' dir='ltr'>a</span>
</span>
<span class='ocr_line' id='line_1_98' title="bbox 365 5850 1372 5890; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_511' title='bbox 365 5850 508 5880; x_wconf 90' lang='eng' dir='ltr'>material</span> <span class='ocrx_word' id='word_1_512' title='bbox 523 5850 886 5880; x_wconf 91' lang='eng' dir='ltr'>desubstantialisation</span> <span class='ocrx_word' id='word_1_513' title='bbox 902 5860 945 5880; x_wconf 92' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_514' title='bbox 964 5850 1013 5880; x_wconf 83' lang='eng' dir='ltr'>off</span> <span class='ocrx_word' id='word_1_515' title='bbox 1027 5860 1070 5880; x_wconf 92' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_516' title='bbox 1087 5850 1145 5880; x_wconf 82' lang='eng' dir='ltr'>off.</span> <span class='ocrx_word' id='word_1_517' title='bbox 1164 5851 1372 5890; x_wconf 91' lang='eng' dir='ltr'>Hyperproc-</span>
</span>
<span class='ocr_line' id='line_1_99' title="bbox 363 5906 1372 5950; baseline 0 -12; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_518' title='bbox 363 5918 450 5938; x_wconf 93' lang='eng' dir='ltr'>esses</span> <span class='ocrx_word' id='word_1_519' title='bbox 460 5908 575 5948; x_wconf 93' lang='eng' dir='ltr'>spread</span> <span class='ocrx_word' id='word_1_520' title='bbox 585 5908 651 5938; x_wconf 92' lang='eng' dir='ltr'>like</span> <span class='ocrx_word' id='word_1_521' title='bbox 664 5908 878 5938; x_wconf 91' lang='eng' dir='ltr'>Heraklitean</span> <span class='ocrx_word' id='word_1_522' title='bbox 888 5908 947 5938; x_wconf 95' lang='eng' dir='ltr'>fire</span> <span class='ocrx_word' id='word_1_523' title='bbox 956 5918 991 5938; x_wconf 95' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_524' title='bbox 1001 5918 1036 5938; x_wconf 95' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_525' title='bbox 1046 5918 1081 5938; x_wconf 95' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_526' title='bbox 1094 5906 1271 5950; x_wconf 92' lang='eng' dir='ltr'>(although</span> <span class='ocrx_word' id='word_1_527' title='bbox 1284 5908 1372 5938; x_wconf 95' lang='eng' dir='ltr'>there</span>
</span>
<span class='ocr_line' id='line_1_100' title="bbox 361 5962 1370 6003; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_528' title='bbox 361 5972 418 5992; x_wconf 94' lang='eng' dir='ltr'>are</span> <span class='ocrx_word' id='word_1_529' title='bbox 431 5972 476 5992; x_wconf 94' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_530' title='bbox 490 5962 660 6003; x_wconf 89' lang='eng' dir='ltr'>analogies</span> <span class='ocrx_word' id='word_1_531' title='bbox 675 5972 714 5992; x_wconf 94' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_532' title='bbox 728 5962 919 6002; x_wconf 91' lang='eng' dir='ltr'>metaphors</span> <span class='ocrx_word' id='word_1_533' title='bbox 935 5962 970 5992; x_wconf 94' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_534' title='bbox 984 5962 1069 6003; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_535' title='bbox 1085 5962 1171 6003; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_536' title='bbox 1186 5962 1270 6003; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_537' title='bbox 1287 5962 1370 6003; x_wconf 91' lang='eng' dir='ltr'>hype</span>
</span>
<span class='ocr_line' id='line_1_101' title="bbox 364 6019 594 6063; baseline 0.004 -13; x_size 42; x_descenders 10; x_ascenders 12"><span class='ocrx_word' id='word_1_538' title='bbox 364 6019 594 6063; x_wconf 92' lang='eng' dir='ltr'>hyperspace).</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_19' title="bbox 359 6079 1372 6939">
<span class='ocr_line' id='line_1_102' title="bbox 428 6079 1370 6120; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_539' title='bbox 428 6079 530 6120; x_wconf 89' lang='eng' dir='ltr'>Being</span> <span class='ocrx_word' id='word_1_540' title='bbox 538 6079 629 6109; x_wconf 93' lang='eng' dir='ltr'>CAG</span> <span class='ocrx_word' id='word_1_541' title='bbox 637 6079 729 6109; x_wconf 93' lang='eng' dir='ltr'>CAG</span> <span class='ocrx_word' id='word_1_542' title='bbox 738 6089 829 6120; x_wconf 90' lang='eng' dir='ltr'>cages</span> <span class='ocrx_word' id='word_1_543' title='bbox 841 6079 917 6109; x_wconf 96' lang='eng' dir='ltr'>flow</span> <span class='ocrx_word' id='word_1_544' title='bbox 927 6079 1035 6109; x_wconf 94' lang='eng' dir='ltr'>within</span> <span class='ocrx_word' id='word_1_545' title='bbox 1046 6089 1193 6120; x_wconf 90' lang='eng' dir='ltr'>memory.</span> <span class='ocrx_word' id='word_1_546' title='bbox 1206 6079 1370 6109; x_wconf 90' lang='eng' dir='ltr'>Function-</span>
</span>
<span class='ocr_line' id='line_1_103' title="bbox 364 6138 1372 6179; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_547' title='bbox 364 6138 421 6179; x_wconf 89' lang='eng' dir='ltr'>ing</span> <span class='ocrx_word' id='word_1_548' title='bbox 432 6148 466 6168; x_wconf 91' lang='eng' dir='ltr'>as</span> <span class='ocrx_word' id='word_1_549' title='bbox 478 6148 510 6168; x_wconf 94' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_550' title='bbox 522 6148 556 6168; x_wconf 94' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_551' title='bbox 568 6138 634 6168; x_wconf 94' lang='eng' dir='ltr'>real</span> <span class='ocrx_word' id='word_1_552' title='bbox 647 6138 887 6179; x_wconf 90' lang='eng' dir='ltr'>antiontology,</span> <span class='ocrx_word' id='word_1_553' title='bbox 899 6138 980 6168; x_wconf 94' lang='eng' dir='ltr'>viral</span> <span class='ocrx_word' id='word_1_554' title='bbox 993 6138 1133 6168; x_wconf 91' lang='eng' dir='ltr'>amnesia</span> <span class='ocrx_word' id='word_1_555' title='bbox 1146 6138 1372 6179; x_wconf 89' lang='eng' dir='ltr'>machinically</span>
</span>
<span class='ocr_line' id='line_1_104' title="bbox 364 6196 1370 6237; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_556' title='bbox 364 6196 496 6226; x_wconf 91' lang='eng' dir='ltr'>realizes</span> <span class='ocrx_word' id='word_1_557' title='bbox 516 6196 583 6226; x_wconf 94' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_558' title='bbox 602 6196 764 6226; x_wconf 92' lang='eng' dir='ltr'>dissolves</span> <span class='ocrx_word' id='word_1_559' title='bbox 784 6196 965 6237; x_wconf 89' lang='eng' dir='ltr'>biological</span> <span class='ocrx_word' id='word_1_560' title='bbox 982 6196 1370 6226; x_wconf 65' lang='eng' dir='ltr'>TGACTCACI&#39;ITAC-</span>
</span>
<span class='ocr_line' id='line_1_105' title="bbox 364 6254 1369 6290; baseline 0 -6; x_size 36; x_descenders 6; x_ascenders 8"><span class='ocrx_word' id='word_1_561' title='bbox 364 6254 549 6290; x_wconf 76' lang='eng' dir='ltr'>CGA&#39;ITG,</span> <span class='ocrx_word' id='word_1_562' title='bbox 559 6254 707 6290; x_wconf 90' lang='eng' dir='ltr'>cultural,</span> <span class='ocrx_word' id='word_1_563' title='bbox 718 6254 784 6284; x_wconf 91' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_564' title='bbox 794 6254 953 6284; x_wconf 91' lang='eng' dir='ltr'>technical</span> <span class='ocrx_word' id='word_1_565' title='bbox 963 6262 1369 6284; x_wconf 91' lang='eng'>010110100100010110100</span>
</span>
<span class='ocr_line' id='line_1_106' title="bbox 364 6313 1368 6343; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_566' title='bbox 364 6321 1031 6343; x_wconf 93' lang='eng'>101001001011101001010100100100100</span> <span class='ocrx_word' id='word_1_567' title='bbox 1038 6313 1181 6343; x_wconf 92' lang='eng' dir='ltr'>mnemic</span> <span class='ocrx_word' id='word_1_568' title='bbox 1189 6319 1368 6343; x_wconf 89' lang='eng' dir='ltr'>structures:</span>
</span>
<span class='ocr_line' id='line_1_107' title="bbox 363 6371 1369 6412; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_569' title='bbox 363 6371 598 6412; x_wconf 90' lang='eng' dir='ltr'>chopping-up</span> <span class='ocrx_word' id='word_1_570' title='bbox 618 6371 1038 6412; x_wconf 90' lang='eng' dir='ltr'>hierarchic-generational</span> <span class='ocrx_word' id='word_1_571' title='bbox 1056 6371 1288 6412; x_wconf 92' lang='eng' dir='ltr'>descendency,</span> <span class='ocrx_word' id='word_1_572' title='bbox 1307 6371 1369 6402; x_wconf 89' lang='eng' dir='ltr'>col-</span>
</span>
<span class='ocr_line' id='line_1_108' title="bbox 364 6430 1370 6471; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_573' title='bbox 364 6430 495 6471; x_wconf 89' lang='eng' dir='ltr'>lapsing</span> <span class='ocrx_word' id='word_1_574' title='bbox 505 6430 743 6471; x_wconf 89' lang='eng' dir='ltr'>phylogenetic</span> <span class='ocrx_word' id='word_1_575' title='bbox 756 6430 799 6460; x_wconf 97' lang='eng' dir='ltr'>tic</span> <span class='ocrx_word' id='word_1_576' title='bbox 812 6430 1024 6460; x_wconf 89' lang='eng' dir='ltr'>frozen-code</span> <span class='ocrx_word' id='word_1_577' title='bbox 1037 6430 1107 6460; x_wconf 94' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_578' title='bbox 1119 6436 1291 6471; x_wconf 90' lang='eng' dir='ltr'>ontogeny,</span> <span class='ocrx_word' id='word_1_579' title='bbox 1304 6430 1370 6460; x_wconf 94' lang='eng' dir='ltr'>and</span>
</span>
<span class='ocr_line' id='line_1_109' title="bbox 364 6488 1369 6529; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_580' title='bbox 364 6488 639 6529; x_wconf 90' lang='eng' dir='ltr'>immanentizing</span> <span class='ocrx_word' id='word_1_581' title='bbox 659 6488 713 6518; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_582' title='bbox 730 6494 805 6528; x_wconf 92' lang='eng' dir='ltr'>past</span> <span class='ocrx_word' id='word_1_583' title='bbox 825 6494 860 6518; x_wconf 96' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_584' title='bbox 878 6488 1045 6528; x_wconf 91' lang='eng' dir='ltr'>operative</span> <span class='ocrx_word' id='word_1_585' title='bbox 1064 6494 1202 6518; x_wconf 87' lang='eng' dir='ltr'>current.</span> <span class='ocrx_word' id='word_1_586' title='bbox 1223 6489 1265 6518; x_wconf 93' lang='eng' dir='ltr'>Its</span> <span class='ocrx_word' id='word_1_587' title='bbox 1285 6498 1369 6518; x_wconf 90' lang='eng' dir='ltr'>com-</span>
</span>
<span class='ocr_line' id='line_1_110' title="bbox 363 6547 1371 6588; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_588' title='bbox 363 6547 498 6587; x_wconf 94' lang='eng' dir='ltr'>petitive</span> <span class='ocrx_word' id='word_1_589' title='bbox 511 6547 723 6588; x_wconf 86' lang='eng' dir='ltr'>just-in-time</span> <span class='ocrx_word' id='word_1_590' title='bbox 741 6547 955 6577; x_wconf 92' lang='eng' dir='ltr'>innovations</span> <span class='ocrx_word' id='word_1_591' title='bbox 973 6547 1078 6577; x_wconf 96' lang='eng' dir='ltr'>delete</span> <span class='ocrx_word' id='word_1_592' title='bbox 1096 6553 1224 6588; x_wconf 89' lang='eng' dir='ltr'>storage</span> <span class='ocrx_word' id='word_1_593' title='bbox 1240 6547 1298 6577; x_wconf 93' lang='eng' dir='ltr'>CA</span> <span class='ocrx_word' id='word_1_594' title='bbox 1312 6547 1371 6577; x_wconf 95' lang='eng' dir='ltr'>CA</span>
</span>
<span class='ocr_line' id='line_1_111' title="bbox 364 6605 1369 6646; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_595' title='bbox 364 6605 517 6645; x_wconf 92' lang='eng' dir='ltr'>capacity,</span> <span class='ocrx_word' id='word_1_596' title='bbox 529 6605 576 6635; x_wconf 89' lang='eng' dir='ltr'>flu</span> <span class='ocrx_word' id='word_1_597' title='bbox 587 6605 632 6635; x_wconf 90' lang='eng' dir='ltr'>flu</span> <span class='ocrx_word' id='word_1_598' title='bbox 643 6605 689 6635; x_wconf 89' lang='eng' dir='ltr'>flu</span> <span class='ocrx_word' id='word_1_599' title='bbox 700 6605 849 6635; x_wconf 94' lang='eng' dir='ltr'>fluidizin</span> <span class='ocrx_word' id='word_1_600' title='bbox 851 6615 874 6646; x_wconf 90' lang='eng' dir='ltr'>g</span> <span class='ocrx_word' id='word_1_601' title='bbox 882 6605 1045 6646; x_wconf 89' lang='eng' dir='ltr'>energetic</span> <span class='ocrx_word' id='word_1_602' title='bbox 1054 6605 1119 6635; x_wconf 94' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_603' title='bbox 1128 6605 1369 6635; x_wconf 87' lang='eng' dir='ltr'>informational</span>
</span>
<span class='ocr_line' id='line_1_112' title="bbox 364 6663 1369 6703; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_604' title='bbox 364 6663 474 6693; x_wconf 92' lang='eng' dir='ltr'>stocks</span> <span class='ocrx_word' id='word_1_605' title='bbox 488 6663 560 6693; x_wconf 94' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_606' title='bbox 573 6663 642 6693; x_wconf 94' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_607' title='bbox 654 6663 722 6693; x_wconf 94' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_608' title='bbox 734 6673 772 6693; x_wconf 94' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_609' title='bbox 785 6663 854 6693; x_wconf 94' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_610' title='bbox 866 6663 934 6693; x_wconf 94' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_611' title='bbox 946 6673 984 6693; x_wconf 94' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_612' title='bbox 996 6663 1280 6703; x_wconf 92' lang='eng' dir='ltr'>orphan-vampire</span> <span class='ocrx_word' id='word_1_613' title='bbox 1290 6673 1324 6693; x_wconf 94' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_614' title='bbox 1337 6673 1369 6693; x_wconf 94' lang='eng' dir='ltr'>re</span>
</span>
<span class='ocr_line' id='line_1_113' title="bbox 365 6721 1370 6751; baseline 0 0; x_size 42.087334; x_descenders 12.087336; x_ascenders 8"><span class='ocrx_word' id='word_1_615' title='bbox 365 6721 556 6751; x_wconf 91' lang='eng' dir='ltr'>transversal</span> <span class='ocrx_word' id='word_1_616' title='bbox 566 6729 908 6751; x_wconf 91' lang='eng'>110111100010101010</span> <span class='ocrx_word' id='word_1_617' title='bbox 917 6721 963 6751; x_wconf 89' lang='eng' dir='ltr'>vir</span> <span class='ocrx_word' id='word_1_618' title='bbox 972 6721 1020 6751; x_wconf 91' lang='eng' dir='ltr'>vir</span> <span class='ocrx_word' id='word_1_619' title='bbox 1026 6721 1370 6751; x_wconf 85' lang='eng' dir='ltr'>virocommunication</span>
</span>
<span class='ocr_line' id='line_1_114' title="bbox 363 6778 1366 6822; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_620' title='bbox 363 6790 509 6820; x_wconf 92' lang='eng' dir='ltr'>process,</span> <span class='ocrx_word' id='word_1_621' title='bbox 529 6780 726 6821; x_wconf 89' lang='eng' dir='ltr'>expressing</span> <span class='ocrx_word' id='word_1_622' title='bbox 743 6790 761 6810; x_wconf 97' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_623' title='bbox 781 6780 914 6820; x_wconf 93' lang='eng' dir='ltr'>surplus</span> <span class='ocrx_word' id='word_1_624' title='bbox 934 6780 1028 6810; x_wconf 94' lang='eng' dir='ltr'>value</span> <span class='ocrx_word' id='word_1_625' title='bbox 1047 6780 1085 6810; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_626' title='bbox 1099 6780 1184 6810; x_wconf 96' lang='eng' dir='ltr'>code</span> <span class='ocrx_word' id='word_1_627' title='bbox 1203 6778 1366 6822; x_wconf 90' lang='eng' dir='ltr'>(content)</span>
</span>
<span class='ocr_line' id='line_1_115' title="bbox 364 6836 1367 6880; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_628' title='bbox 364 6848 398 6868; x_wconf 92' lang='eng' dir='ltr'>as</span> <span class='ocrx_word' id='word_1_629' title='bbox 417 6838 905 6878; x_wconf 94' lang='eng' dir='ltr'>xenoreplication-behaviour</span> <span class='ocrx_word' id='word_1_630' title='bbox 924 6836 1063 6880; x_wconf 94' lang='eng' dir='ltr'>(and/0r</span> <span class='ocrx_word' id='word_1_631' title='bbox 1079 6836 1284 6880; x_wconf 94' lang='eng' dir='ltr'>c0n(nective</span> <span class='ocrx_word' id='word_1_632' title='bbox 1302 6836 1367 6880; x_wconf 91' lang='eng' dir='ltr'>dis)</span>
</span>
<span class='ocr_line' id='line_1_116' title="bbox 359 6895 542 6939; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_633' title='bbox 359 6895 542 6939; x_wconf 86' lang='eng' dir='ltr'>junction).</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_20' title="bbox 362 6955 1377 8107">
<span class='ocr_line' id='line_1_117' title="bbox 425 6955 1366 6996; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_634' title='bbox 425 6956 468 6985; x_wconf 91' lang='eng' dir='ltr'>As</span> <span class='ocrx_word' id='word_1_635' title='bbox 478 6965 543 6985; x_wconf 94' lang='eng' dir='ltr'>war</span> <span class='ocrx_word' id='word_1_636' title='bbox 552 6955 710 6985; x_wconf 92' lang='eng' dir='ltr'>increases</span> <span class='ocrx_word' id='word_1_637' title='bbox 721 6955 753 6985; x_wconf 92' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_638' title='bbox 763 6955 797 6985; x_wconf 94' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_639' title='bbox 807 6955 840 6985; x_wconf 94' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_640' title='bbox 849 6955 1065 6996; x_wconf 90' lang='eng' dir='ltr'>intelligence,</span> <span class='ocrx_word' id='word_1_641' title='bbox 1074 6955 1097 6985; x_wconf 98' lang='eng' dir='ltr'>it</span> <span class='ocrx_word' id='word_1_642' title='bbox 1106 6955 1254 6985; x_wconf 92' lang='eng' dir='ltr'>becomes</span> <span class='ocrx_word' id='word_1_643' title='bbox 1265 6955 1366 6985; x_wconf 87' lang='eng' dir='ltr'>softer.</span>
</span>
<span class='ocr_line' id='line_1_118' title="bbox 367 7014 1369 7055; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_644' title='bbox 367 7015 412 7055; x_wconf 92' lang='eng' dir='ltr'>By</span> <span class='ocrx_word' id='word_1_645' title='bbox 423 7014 571 7055; x_wconf 89' lang='eng' dir='ltr'>trashing</span> <span class='ocrx_word' id='word_1_646' title='bbox 582 7014 666 7044; x_wconf 94' lang='eng' dir='ltr'>their</span> <span class='ocrx_word' id='word_1_647' title='bbox 676 7014 766 7044; x_wconf 92' lang='eng' dir='ltr'>hosts</span> <span class='ocrx_word' id='word_1_648' title='bbox 779 7014 877 7044; x_wconf 94' lang='eng' dir='ltr'>crude</span> <span class='ocrx_word' id='word_1_649' title='bbox 888 7014 1011 7044; x_wconf 93' lang='eng' dir='ltr'>viruses</span> <span class='ocrx_word' id='word_1_650' title='bbox 1023 7014 1181 7044; x_wconf 88' lang='eng' dir='ltr'>feedback</span> <span class='ocrx_word' id='word_1_651' title='bbox 1189 7014 1369 7055; x_wconf 89' lang='eng' dir='ltr'>negatively</span>
</span>
<span class='ocr_line' id='line_1_119' title="bbox 365 7071 1367 7112; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_652' title='bbox 365 7081 459 7111; x_wconf 94' lang='eng' dir='ltr'>upon</span> <span class='ocrx_word' id='word_1_653' title='bbox 477 7071 684 7107; x_wconf 92' lang='eng' dir='ltr'>themselves,</span> <span class='ocrx_word' id='word_1_654' title='bbox 703 7071 930 7112; x_wconf 89' lang='eng' dir='ltr'>autolimiting</span> <span class='ocrx_word' id='word_1_655' title='bbox 949 7071 1028 7101; x_wconf 94' lang='eng' dir='ltr'>their</span> <span class='ocrx_word' id='word_1_656' title='bbox 1045 7081 1143 7112; x_wconf 89' lang='eng' dir='ltr'>range</span> <span class='ocrx_word' id='word_1_657' title='bbox 1160 7071 1198 7101; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_658' title='bbox 1211 7081 1243 7101; x_wconf 94' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_659' title='bbox 1259 7081 1367 7112; x_wconf 91' lang='eng' dir='ltr'>regen-</span>
</span>
<span class='ocr_line' id='line_1_120' title="bbox 364 7130 1368 7170; baseline -0.001 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_660' title='bbox 364 7130 484 7160; x_wconf 94' lang='eng' dir='ltr'>erative</span> <span class='ocrx_word' id='word_1_661' title='bbox 501 7130 719 7160; x_wconf 90' lang='eng' dir='ltr'>infilitration.</span> <span class='ocrx_word' id='word_1_662' title='bbox 739 7130 847 7170; x_wconf 92' lang='eng' dir='ltr'>Crazy</span> <span class='ocrx_word' id='word_1_663' title='bbox 861 7130 999 7160; x_wconf 92' lang='eng' dir='ltr'>vandals</span> <span class='ocrx_word' id='word_1_664' title='bbox 1017 7130 1079 7160; x_wconf 93' lang='eng' dir='ltr'>like</span> <span class='ocrx_word' id='word_1_665' title='bbox 1097 7130 1201 7160; x_wconf 90' lang='eng' dir='ltr'>Ebola</span> <span class='ocrx_word' id='word_1_666' title='bbox 1217 7130 1368 7161; x_wconf 90' lang='eng' dir='ltr'>CGCGT</span>
</span>
<span class='ocr_line' id='line_1_121' title="bbox 364 7187 1366 7231; baseline 0 -12; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_667' title='bbox 364 7189 1222 7219; x_wconf 78' lang='eng' dir='ltr'>GAGCAATCGGACTCGGCTGCTGTGC&#39;ITG</span> <span class='ocrx_word' id='word_1_668' title='bbox 1238 7187 1366 7231; x_wconf 92' lang='eng' dir='ltr'>(bodies</span>
</span>
<span class='ocr_line' id='line_1_122' title="bbox 364 7245 1367 7289; baseline 0 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_669' title='bbox 364 7247 533 7277; x_wconf 92' lang='eng' dir='ltr'>dissolved</span> <span class='ocrx_word' id='word_1_670' title='bbox 543 7247 679 7287; x_wconf 92' lang='eng' dir='ltr'>quickly</span> <span class='ocrx_word' id='word_1_671' title='bbox 688 7247 760 7277; x_wconf 94' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_672' title='bbox 772 7245 879 7289; x_wconf 92' lang='eng' dir='ltr'>slime)</span> <span class='ocrx_word' id='word_1_673' title='bbox 891 7245 992 7277; x_wconf 78' lang='eng' dir='ltr'>arent</span> <span class='ocrx_word' id='word_1_674' title='bbox 1000 7257 1077 7277; x_wconf 94' lang='eng' dir='ltr'>ever</span> <span class='ocrx_word' id='word_1_675' title='bbox 1083 7247 1186 7288; x_wconf 89' lang='eng' dir='ltr'>going</span> <span class='ocrx_word' id='word_1_676' title='bbox 1197 7253 1229 7277; x_wconf 96' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_677' title='bbox 1239 7247 1333 7277; x_wconf 85' lang='eng' dir='ltr'>make</span> <span class='ocrx_word' id='word_1_678' title='bbox 1342 7247 1367 7277; x_wconf 98' lang='eng' dir='ltr'>it</span>
</span>
<span class='ocr_line' id='line_1_123' title="bbox 364 7304 1367 7345; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_679' title='bbox 364 7304 428 7345; x_wconf 90' lang='eng' dir='ltr'>big.</span> <span class='ocrx_word' id='word_1_680' title='bbox 439 7304 581 7334; x_wconf 93' lang='eng' dir='ltr'>General</span> <span class='ocrx_word' id='word_1_681' title='bbox 589 7304 748 7344; x_wconf 94' lang='eng' dir='ltr'>principle</span> <span class='ocrx_word' id='word_1_682' title='bbox 758 7304 810 7334; x_wconf 89' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_683' title='bbox 816 7304 895 7334; x_wconf 94' lang='eng' dir='ltr'>viral</span> <span class='ocrx_word' id='word_1_684' title='bbox 906 7304 1079 7334; x_wconf 89' lang='eng' dir='ltr'>take-overs</span> <span class='ocrx_word' id='word_1_685' title='bbox 1088 7304 1121 7334; x_wconf 94' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_686' title='bbox 1129 7304 1184 7334; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_687' title='bbox 1191 7304 1301 7334; x_wconf 86' lang='eng' dir='ltr'>media:</span> <span class='ocrx_word' id='word_1_688' title='bbox 1312 7304 1367 7334; x_wconf 96' lang='eng' dir='ltr'>the</span>
</span>
<span class='ocr_line' id='line_1_124' title="bbox 362 7363 1366 7404; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_689' title='bbox 362 7373 455 7393; x_wconf 92' lang='eng' dir='ltr'>more</span> <span class='ocrx_word' id='word_1_690' title='bbox 464 7363 746 7403; x_wconf 92' lang='eng' dir='ltr'>unsophisticated</span> <span class='ocrx_word' id='word_1_691' title='bbox 755 7363 810 7393; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_692' title='bbox 819 7363 1007 7404; x_wconf 89' lang='eng' dir='ltr'>contagion,</span> <span class='ocrx_word' id='word_1_693' title='bbox 1016 7363 1071 7393; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_694' title='bbox 1079 7363 1190 7404; x_wconf 90' lang='eng' dir='ltr'>bigger</span> <span class='ocrx_word' id='word_1_695' title='bbox 1200 7363 1250 7393; x_wconf 90' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_696' title='bbox 1259 7363 1366 7403; x_wconf 89' lang='eng' dir='ltr'>splash</span>
</span>
<span class='ocr_line' id='line_1_125' title="bbox 366 7419 1367 7463; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_697' title='bbox 366 7419 614 7463; x_wconf 89' lang='eng' dir='ltr'>(diversionary</span> <span class='ocrx_word' id='word_1_698' title='bbox 634 7421 750 7451; x_wconf 92' lang='eng' dir='ltr'>tactics</span> <span class='ocrx_word' id='word_1_699' title='bbox 770 7419 965 7463; x_wconf 94' lang='eng' dir='ltr'>excepted).</span> <span class='ocrx_word' id='word_1_700' title='bbox 986 7421 1367 7451; x_wconf 82' lang='eng' dir='ltr'>CAGCTACGCTATT</span>
</span>
<span class='ocr_line' id='line_1_126' title="bbox 365 7479 1366 7509; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_701' title='bbox 365 7479 1366 7509; x_wconf 90' lang='eng' dir='ltr'>CTCCGAGGCTAGATTGCAGCTACGTCGCATCG</span>
</span>
<span class='ocr_line' id='line_1_127' title="bbox 364 7543 1377 7573; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_702' title='bbox 364 7543 1377 7573; x_wconf 77' lang='eng' dir='ltr'>GGCTGACCGATGTAGGTCATGAATCTACCGAIT</span>
</span>
<span class='ocr_line' id='line_1_128' title="bbox 364 7601 1377 7632; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_703' title='bbox 364 7601 1377 7632; x_wconf 85' lang='eng' dir='ltr'>GCACATGACTTATCCACGGTCTATTCCTCGAT</span>
</span>
<span class='ocr_line' id='line_1_129' title="bbox 365 7660 1373 7690; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_704' title='bbox 365 7660 717 7690; x_wconf 90' lang='eng' dir='ltr'>GATCGCATCGGG</span> <span class='ocrx_word' id='word_1_705' title='bbox 720 7660 777 7690; x_wconf 92' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_706' title='bbox 777 7660 1248 7690; x_wconf 89' lang='eng' dir='ltr'>GACCGATGGCATCGTA</span> <span class='ocrx_word' id='word_1_707' title='bbox 1253 7660 1373 7690; x_wconf 88' lang='eng' dir='ltr'>COPY.</span>
</span>
<span class='ocr_line' id='line_1_130' title="bbox 365 7717 1375 7759; baseline -0.001 -10; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_708' title='bbox 365 7719 462 7749; x_wconf 89' lang='eng' dir='ltr'>CUT.</span> <span class='ocrx_word' id='word_1_709' title='bbox 478 7718 615 7748; x_wconf 86' lang='eng' dir='ltr'>PASTE.</span> <span class='ocrx_word' id='word_1_710' title='bbox 632 7718 748 7748; x_wconf 92' lang='eng' dir='ltr'>Subtle</span> <span class='ocrx_word' id='word_1_711' title='bbox 761 7718 886 7748; x_wconf 91' lang='eng' dir='ltr'>viruses</span> <span class='ocrx_word' id='word_1_712' title='bbox 900 7728 953 7748; x_wconf 93' lang='eng' dir='ltr'>are</span> <span class='ocrx_word' id='word_1_713' title='bbox 968 7718 1056 7755; x_wconf 92' lang='eng' dir='ltr'>slow,</span> <span class='ocrx_word' id='word_1_714' title='bbox 1071 7718 1228 7759; x_wconf 90' lang='eng' dir='ltr'>synergic,</span> <span class='ocrx_word' id='word_1_715' title='bbox 1245 7717 1375 7748; x_wconf 87' lang='eng' dir='ltr'>flexible</span>
</span>
<span class='ocr_line' id='line_1_131' title="bbox 365 7777 1374 7818; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_716' title='bbox 365 7777 432 7807; x_wconf 89' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_717' title='bbox 452 7777 585 7807; x_wconf 86' lang='eng' dir='ltr'>elusive.</span> <span class='ocrx_word' id='word_1_718' title='bbox 606 7777 697 7818; x_wconf 90' lang='eng' dir='ltr'>They</span> <span class='ocrx_word' id='word_1_719' title='bbox 716 7783 856 7807; x_wconf 90' lang='eng' dir='ltr'>execute</span> <span class='ocrx_word' id='word_1_720' title='bbox 876 7777 1036 7807; x_wconf 92' lang='eng' dir='ltr'>sensitive</span> <span class='ocrx_word' id='word_1_721' title='bbox 1056 7777 1276 7807; x_wconf 89' lang='eng' dir='ltr'>behavioural</span> <span class='ocrx_word' id='word_1_722' title='bbox 1296 7787 1374 7807; x_wconf 90' lang='eng' dir='ltr'>con-</span>
</span>
<span class='ocr_line' id='line_1_132' title="bbox 367 7834 1374 7875; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_723' title='bbox 367 7834 426 7864; x_wconf 94' lang='eng' dir='ltr'>trol</span> <span class='ocrx_word' id='word_1_724' title='bbox 442 7834 513 7864; x_wconf 89' lang='eng' dir='ltr'>that</span> <span class='ocrx_word' id='word_1_725' title='bbox 523 7834 684 7875; x_wconf 92' lang='eng' dir='ltr'>prolongs</span> <span class='ocrx_word' id='word_1_726' title='bbox 700 7834 754 7864; x_wconf 95' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_727' title='bbox 769 7834 824 7864; x_wconf 93' lang='eng' dir='ltr'>life</span> <span class='ocrx_word' id='word_1_728' title='bbox 838 7834 877 7864; x_wconf 93' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_729' title='bbox 889 7834 944 7864; x_wconf 95' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_730' title='bbox 959 7834 1183 7864; x_wconf 91' lang='eng' dir='ltr'>biomachinic</span> <span class='ocrx_word' id='word_1_731' title='bbox 1198 7844 1374 7871; x_wconf 91' lang='eng' dir='ltr'>resources,</span>
</span>
<span class='ocr_line' id='line_1_133' title="bbox 366 7892 1375 7933; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_732' title='bbox 366 7892 553 7922; x_wconf 92' lang='eng' dir='ltr'>maximizes</span> <span class='ocrx_word' id='word_1_733' title='bbox 562 7892 810 7932; x_wconf 92' lang='eng' dir='ltr'>opportunities</span> <span class='ocrx_word' id='word_1_734' title='bbox 820 7892 872 7922; x_wconf 93' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_735' title='bbox 879 7892 1118 7933; x_wconf 92' lang='eng' dir='ltr'>propogation,</span> <span class='ocrx_word' id='word_1_736' title='bbox 1129 7892 1299 7922; x_wconf 91' lang='eng' dir='ltr'>infiltrates</span> <span class='ocrx_word' id='word_1_737' title='bbox 1309 7892 1375 7922; x_wconf 92' lang='eng' dir='ltr'>and</span>
</span>
<span class='ocr_line' id='line_1_134' title="bbox 365 7951 1374 7992; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_738' title='bbox 365 7951 508 7981; x_wconf 93' lang='eng' dir='ltr'>disables</span> <span class='ocrx_word' id='word_1_739' title='bbox 526 7951 643 7981; x_wconf 94' lang='eng' dir='ltr'>hostile</span> <span class='ocrx_word' id='word_1_740' title='bbox 663 7951 806 7992; x_wconf 91' lang='eng' dir='ltr'>security</span> <span class='ocrx_word' id='word_1_741' title='bbox 824 7957 973 7992; x_wconf 94' lang='eng' dir='ltr'>systems,</span> <span class='ocrx_word' id='word_1_742' title='bbox 993 7951 1060 7981; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_743' title='bbox 1080 7951 1271 7981; x_wconf 91' lang='eng' dir='ltr'>feeds-back</span> <span class='ocrx_word' id='word_1_744' title='bbox 1287 7951 1374 7991; x_wconf 88' lang='eng' dir='ltr'>posi-</span>
</span>
<span class='ocr_line' id='line_1_135' title="bbox 367 8009 1376 8039; baseline 0 0; x_size 40.988487; x_descenders 10.988487; x_ascenders 10"><span class='ocrx_word' id='word_1_745' title='bbox 367 8009 428 8039; x_wconf 94' lang='eng' dir='ltr'>tive</span> <span class='ocrx_word' id='word_1_746' title='bbox 446 8020 608 8037; x_wconf 91' lang='eng'>-+-++-+-++</span> <span class='ocrx_word' id='word_1_747' title='bbox 625 8009 659 8039; x_wconf 88' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_748' title='bbox 675 8009 708 8039; x_wconf 92' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_749' title='bbox 724 8009 758 8039; x_wconf 92' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_750' title='bbox 774 8009 971 8039; x_wconf 89' lang='eng' dir='ltr'>innovation</span> <span class='ocrx_word' id='word_1_751' title='bbox 987 8009 1247 8039; x_wconf 91' lang='eng' dir='ltr'>technoscience.</span> <span class='ocrx_word' id='word_1_752' title='bbox 1267 8010 1305 8039; x_wconf 88' lang='eng' dir='ltr'>In</span> <span class='ocrx_word' id='word_1_753' title='bbox 1321 8009 1376 8039; x_wconf 94' lang='eng' dir='ltr'>the</span>
</span>
<span class='ocr_line' id='line_1_136' title="bbox 366 8064 1372 8107; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_754' title='bbox 366 8066 614 8103; x_wconf 91' lang='eng' dir='ltr'>macroversion,</span> <span class='ocrx_word' id='word_1_755' title='bbox 628 8076 646 8096; x_wconf 95' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_756' title='bbox 658 8075 706 8096; x_wconf 83' lang='eng' dir='ltr'>VR</span> <span class='ocrx_word' id='word_1_757' title='bbox 718 8076 800 8107; x_wconf 93' lang='eng' dir='ltr'>prey</span> <span class='ocrx_word' id='word_1_758' title='bbox 812 8066 933 8096; x_wconf 92' lang='eng' dir='ltr'>animal</span> <span class='ocrx_word' id='word_1_759' title='bbox 948 8066 1006 8096; x_wconf 95' lang='eng' dir='ltr'>hid</span> <span class='ocrx_word' id='word_1_760' title='bbox 1020 8066 1054 8096; x_wconf 88' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_761' title='bbox 1068 8066 1108 8096; x_wconf 92' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_762' title='bbox 1121 8064 1263 8107; x_wconf 79' lang='eng' dir='ltr'>enemys</span> <span class='ocrx_word' id='word_1_763' title='bbox 1276 8066 1372 8096; x_wconf 95' lang='eng' dir='ltr'>head.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_21' title="bbox 367 8124 1377 8924">
<span class='ocr_line' id='line_1_137' title="bbox 426 8124 1377 8165; baseline 0.001 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_764' title='bbox 426 8124 532 8154; x_wconf 92' lang='eng' dir='ltr'>When</span> <span class='ocrx_word' id='word_1_765' title='bbox 545 8124 687 8165; x_wconf 89' lang='eng' dir='ltr'>hunting</span> <span class='ocrx_word' id='word_1_766' title='bbox 699 8124 751 8154; x_wconf 93' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_767' title='bbox 761 8124 849 8165; x_wconf 93' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_768' title='bbox 861 8124 1056 8165; x_wconf 93' lang='eng' dir='ltr'>hypervirus</span> <span class='ocrx_word' id='word_1_769' title='bbox 1068 8124 1148 8154; x_wconf 94' lang='eng' dir='ltr'>look</span> <span class='ocrx_word' id='word_1_770' title='bbox 1158 8124 1204 8154; x_wconf 94' lang='eng' dir='ltr'>0k</span> <span class='ocrx_word' id='word_1_771' title='bbox 1215 8124 1258 8154; x_wconf 97' lang='eng' dir='ltr'>0k</span> <span class='ocrx_word' id='word_1_772' title='bbox 1269 8124 1314 8154; x_wconf 94' lang='eng' dir='ltr'>ok</span> <span class='ocrx_word' id='word_1_773' title='bbox 1325 8124 1377 8154; x_wconf 93' lang='eng' dir='ltr'>for</span>
</span>
<span class='ocr_line' id='line_1_138' title="bbox 367 8182 1374 8225; baseline -0.002 -11; x_size 41; x_descenders 11; x_ascenders 9"><span class='ocrx_word' id='word_1_774' title='bbox 367 8184 404 8214; x_wconf 89' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_775' title='bbox 416 8184 559 8225; x_wconf 91' lang='eng' dir='ltr'>primary</span> <span class='ocrx_word' id='word_1_776' title='bbox 569 8184 644 8214; x_wconf 93' lang='eng' dir='ltr'>host</span> <span class='ocrx_word' id='word_1_777' title='bbox 655 8184 793 8224; x_wconf 90' lang='eng' dir='ltr'>species,</span> <span class='ocrx_word' id='word_1_778' title='bbox 804 8184 912 8214; x_wconf 90' lang='eng' dir='ltr'>which</span> <span class='ocrx_word' id='word_1_779' title='bbox 924 8184 990 8214; x_wconf 94' lang='eng' dir='ltr'>will</span> <span class='ocrx_word' id='word_1_780' title='bbox 1004 8184 1043 8214; x_wconf 91' lang='eng' dir='ltr'>be</span> <span class='ocrx_word' id='word_1_781' title='bbox 1057 8182 1268 8224; x_wconf 85' lang='eng' dir='ltr'>undergoing</span> <span class='ocrx_word' id='word_1_782' title='bbox 1280 8183 1374 8224; x_wconf 88' lang='eng' dir='ltr'>logis-</span>
</span>
<span class='ocr_line' id='line_1_139' title="bbox 367 8241 1375 8282; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_783' title='bbox 367 8241 440 8271; x_wconf 90' lang='eng' dir='ltr'>tical</span> <span class='ocrx_word' id='word_1_784' title='bbox 454 8241 644 8271; x_wconf 93' lang='eng' dir='ltr'>behavioral</span> <span class='ocrx_word' id='word_1_785' title='bbox 659 8241 914 8281; x_wconf 90' lang='eng' dir='ltr'>sophistication</span> <span class='ocrx_word' id='word_1_786' title='bbox 932 8241 1073 8271; x_wconf 92' lang='eng' dir='ltr'>indexed</span> <span class='ocrx_word' id='word_1_787' title='bbox 1092 8241 1135 8282; x_wconf 96' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_788' title='bbox 1149 8251 1191 8271; x_wconf 92' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_789' title='bbox 1207 8241 1375 8281; x_wconf 93' lang='eng' dir='ltr'>explosive</span>
</span>
<span class='ocr_line' id='line_1_140' title="bbox 368 8300 1374 8341; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_790' title='bbox 368 8300 505 8330; x_wconf 91' lang='eng' dir='ltr'>increase</span> <span class='ocrx_word' id='word_1_791' title='bbox 518 8300 552 8330; x_wconf 88' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_792' title='bbox 562 8300 839 8330; x_wconf 90' lang='eng' dir='ltr'>communicative</span> <span class='ocrx_word' id='word_1_793' title='bbox 850 8300 1013 8341; x_wconf 92' lang='eng' dir='ltr'>intensity,</span> <span class='ocrx_word' id='word_1_794' title='bbox 1025 8300 1228 8340; x_wconf 92' lang='eng' dir='ltr'>population</span> <span class='ocrx_word' id='word_1_795' title='bbox 1238 8300 1374 8341; x_wconf 92' lang='eng' dir='ltr'>density,</span>
</span>
<span class='ocr_line' id='line_1_141' title="bbox 367 8358 1375 8399; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_796' title='bbox 367 8358 473 8388; x_wconf 92' lang='eng' dir='ltr'>sexual</span> <span class='ocrx_word' id='word_1_797' title='bbox 482 8358 761 8399; x_wconf 92' lang='eng' dir='ltr'>disorganisation,</span> <span class='ocrx_word' id='word_1_798' title='bbox 771 8358 908 8388; x_wconf 90' lang='eng' dir='ltr'>cultural</span> <span class='ocrx_word' id='word_1_799' title='bbox 917 8358 1135 8399; x_wconf 91' lang='eng' dir='ltr'>promiscuity,</span> <span class='ocrx_word' id='word_1_800' title='bbox 1144 8358 1209 8388; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_801' title='bbox 1220 8358 1375 8388; x_wconf 90' lang='eng' dir='ltr'>technical</span>
</span>
<span class='ocr_line' id='line_1_142' title="bbox 367 8415 1376 8459; baseline 0 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_802' title='bbox 367 8417 427 8447; x_wconf 94' lang='eng' dir='ltr'>sub</span> <span class='ocrx_word' id='word_1_803' title='bbox 437 8417 498 8447; x_wconf 93' lang='eng' dir='ltr'>sub</span> <span class='ocrx_word' id='word_1_804' title='bbox 508 8417 732 8447; x_wconf 92' lang='eng' dir='ltr'>subtilization</span> <span class='ocrx_word' id='word_1_805' title='bbox 743 8415 892 8459; x_wconf 92' lang='eng' dir='ltr'>(leading</span> <span class='ocrx_word' id='word_1_806' title='bbox 902 8423 936 8447; x_wconf 94' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_807' title='bbox 945 8417 1205 8458; x_wconf 91' lang='eng' dir='ltr'>neurogenomic</span> <span class='ocrx_word' id='word_1_808' title='bbox 1215 8417 1376 8447; x_wconf 91' lang='eng' dir='ltr'>feedback</span>
</span>
<span class='ocr_line' id='line_1_143' title="bbox 367 8474 1377 8515; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_809' title='bbox 367 8474 431 8504; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_810' title='bbox 450 8474 653 8504; x_wconf 88' lang='eng' dir='ltr'>fluidization</span> <span class='ocrx_word' id='word_1_811' title='bbox 671 8484 717 8504; x_wconf 92' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_812' title='bbox 733 8474 785 8504; x_wconf 82' lang='eng' dir='ltr'>off</span> <span class='ocrx_word' id='word_1_813' title='bbox 798 8484 844 8504; x_wconf 89' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_814' title='bbox 861 8474 912 8504; x_wconf 82' lang='eng' dir='ltr'>off</span> <span class='ocrx_word' id='word_1_815' title='bbox 925 8474 976 8504; x_wconf 82' lang='eng' dir='ltr'>off</span> <span class='ocrx_word' id='word_1_816' title='bbox 989 8484 1035 8504; x_wconf 92' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_817' title='bbox 1052 8474 1091 8504; x_wconf 93' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_818' title='bbox 1104 8474 1147 8504; x_wconf 95' lang='eng' dir='ltr'>all</span> <span class='ocrx_word' id='word_1_819' title='bbox 1165 8474 1377 8515; x_wconf 87' lang='eng' dir='ltr'>hard-wiring</span>
</span>
<span class='ocr_line' id='line_1_144' title="bbox 367 8531 1376 8575; baseline 0 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_820' title='bbox 367 8533 437 8563; x_wconf 92' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_821' title='bbox 456 8533 525 8563; x_wconf 92' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_822' title='bbox 543 8533 731 8574; x_wconf 89' lang='eng' dir='ltr'>cybernetic</span> <span class='ocrx_word' id='word_1_823' title='bbox 751 8531 883 8575; x_wconf 91' lang='eng' dir='ltr'>fluxes).</span> <span class='ocrx_word' id='word_1_824' title='bbox 901 8533 976 8574; x_wconf 89' lang='eng' dir='ltr'>Any</span> <span class='ocrx_word' id='word_1_825' title='bbox 994 8533 1094 8573; x_wconf 92' lang='eng' dir='ltr'>plane</span> <span class='ocrx_word' id='word_1_826' title='bbox 1112 8533 1227 8573; x_wconf 89' lang='eng' dir='ltr'>planet</span> <span class='ocrx_word' id='word_1_827' title='bbox 1245 8539 1301 8563; x_wconf 92' lang='eng' dir='ltr'>net</span> <span class='ocrx_word' id='word_1_828' title='bbox 1318 8539 1376 8563; x_wconf 92' lang='eng' dir='ltr'>net</span>
</span>
<span class='ocr_line' id='line_1_145' title="bbox 367 8591 1376 8632; baseline 0.001 -12; x_size 41; x_descenders 11; x_ascenders 8"><span class='ocrx_word' id='word_1_829' title='bbox 367 8599 820 8621; x_wconf 91' lang='eng'>00011011010010010101011</span> <span class='ocrx_word' id='word_1_830' title='bbox 832 8591 968 8632; x_wconf 87' lang='eng' dir='ltr'>hosting</span> <span class='ocrx_word' id='word_1_831' title='bbox 977 8591 1063 8621; x_wconf 90' lang='eng' dir='ltr'>such</span> <span class='ocrx_word' id='word_1_832' title='bbox 1073 8601 1115 8621; x_wconf 90' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_833' title='bbox 1126 8597 1223 8621; x_wconf 92' lang='eng' dir='ltr'>event</span> <span class='ocrx_word' id='word_1_834' title='bbox 1233 8591 1259 8621; x_wconf 92' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_835' title='bbox 1271 8591 1376 8621; x_wconf 90' lang='eng' dir='ltr'>about</span>
</span>
<span class='ocr_line' id='line_1_146' title="bbox 368 8648 1376 8692; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_836' title='bbox 368 8656 401 8680; x_wconf 97' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_837' title='bbox 412 8649 470 8690; x_wconf 88' lang='eng' dir='ltr'>flip</span> <span class='ocrx_word' id='word_1_838' title='bbox 479 8660 561 8680; x_wconf 93' lang='eng' dir='ltr'>over.</span> <span class='ocrx_word' id='word_1_839' title='bbox 573 8650 684 8680; x_wconf 92' lang='eng' dir='ltr'>CATA</span> <span class='ocrx_word' id='word_1_840' title='bbox 693 8650 915 8690; x_wconf 91' lang='eng' dir='ltr'>catastrophic</span> <span class='ocrx_word' id='word_1_841' title='bbox 925 8650 1163 8680; x_wconf 92' lang='eng' dir='ltr'>OKOOKOK</span> <span class='ocrx_word' id='word_1_842' title='bbox 1174 8650 1241 8680; x_wconf 93' lang='eng' dir='ltr'>OK</span> <span class='ocrx_word' id='word_1_843' title='bbox 1251 8660 1326 8680; x_wconf 93' lang='eng' dir='ltr'>zero</span> <span class='ocrx_word' id='word_1_844' title='bbox 1338 8648 1376 8692; x_wconf 93' lang='eng'>(0</span>
</span>
<span class='ocr_line' id='line_1_147' title="bbox 369 8706 1375 8751; baseline 0 -13; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_845' title='bbox 369 8706 431 8750; x_wconf 93' lang='eng' dir='ltr'>(or</span> <span class='ocrx_word' id='word_1_846' title='bbox 443 8706 488 8751; x_wconf 90' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_847' title='bbox 501 8706 514 8750; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_848' title='bbox 527 8706 554 8750; x_wconf 93' lang='eng'>))</span> <span class='ocrx_word' id='word_1_849' title='bbox 570 8706 598 8750; x_wconf 89' lang='eng'>((</span> <span class='ocrx_word' id='word_1_850' title='bbox 612 8706 624 8750; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_851' title='bbox 638 8706 650 8750; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_852' title='bbox 666 8706 679 8750; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_853' title='bbox 694 8706 721 8750; x_wconf 93' lang='eng'>))</span> <span class='ocrx_word' id='word_1_854' title='bbox 737 8706 748 8750; x_wconf 93' lang='eng'>)</span> <span class='ocrx_word' id='word_1_855' title='bbox 762 8706 835 8750; x_wconf 89' lang='eng' dir='ltr'>o°))</span> <span class='ocrx_word' id='word_1_856' title='bbox 848 8708 977 8738; x_wconf 87' lang='eng' dir='ltr'>K-virus</span> <span class='ocrx_word' id='word_1_857' title='bbox 989 8708 1057 8738; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_858' title='bbox 1070 8706 1156 8750; x_wconf 90' lang='eng' dir='ltr'>(RT)</span> <span class='ocrx_word' id='word_1_859' title='bbox 1171 8708 1375 8748; x_wconf 89' lang='eng' dir='ltr'>retroscripts</span>
</span>
<span class='ocr_line' id='line_1_148' title="bbox 369 8764 1374 8809; baseline 0 -13; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_860' title='bbox 369 8765 490 8809; x_wconf 93' lang='eng' dir='ltr'>(Kobe,</span> <span class='ocrx_word' id='word_1_861' title='bbox 504 8766 626 8807; x_wconf 93' lang='eng' dir='ltr'>Tokyo,</span> <span class='ocrx_word' id='word_1_862' title='bbox 643 8766 836 8796; x_wconf 93' lang='eng' dir='ltr'>Oklahoma</span> <span class='ocrx_word' id='word_1_863' title='bbox 854 8764 1010 8808; x_wconf 93' lang='eng' dir='ltr'>(Koresh,</span> <span class='ocrx_word' id='word_1_864' title='bbox 1028 8764 1227 8808; x_wconf 92' lang='eng' dir='ltr'>Koernke)).</span> <span class='ocrx_word' id='word_1_865' title='bbox 1244 8766 1374 8806; x_wconf 93' lang='eng' dir='ltr'>Apoka-</span>
</span>
<span class='ocr_line' id='line_1_149' title="bbox 368 8822 1375 8865; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_866' title='bbox 368 8824 459 8865; x_wconf 92' lang='eng' dir='ltr'>lypse</span> <span class='ocrx_word' id='word_1_867' title='bbox 478 8824 596 8864; x_wconf 92' lang='eng' dir='ltr'>spread</span> <span class='ocrx_word' id='word_1_868' title='bbox 615 8824 660 8865; x_wconf 96' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_869' title='bbox 681 8824 734 8854; x_wconf 94' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_870' title='bbox 756 8824 838 8854; x_wconf 91' lang='eng' dir='ltr'>coke</span> <span class='ocrx_word' id='word_1_871' title='bbox 859 8824 1026 8854; x_wconf 89' lang='eng' dir='ltr'>machine.</span> <span class='ocrx_word' id='word_1_872' title='bbox 1046 8822 1267 8854; x_wconf 83' lang='eng' dir='ltr'>Tomorrows</span> <span class='ocrx_word' id='word_1_873' title='bbox 1286 8834 1375 8854; x_wconf 88' lang='eng' dir='ltr'>news</span>
</span>
<span class='ocr_line' id='line_1_150' title="bbox 367 8884 858 8924; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_874' title='bbox 367 8884 529 8924; x_wconf 93' lang='eng' dir='ltr'>brews-up</span> <span class='ocrx_word' id='word_1_875' title='bbox 541 8884 575 8914; x_wconf 88' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_876' title='bbox 587 8884 706 8921; x_wconf 93' lang='eng' dir='ltr'>Korea,</span> <span class='ocrx_word' id='word_1_877' title='bbox 721 8884 858 8914; x_wconf 92' lang='eng' dir='ltr'>Kosovo</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_22' title="bbox 367 8941 1379 9101">
<span class='ocr_line' id='line_1_151' title="bbox 429 8941 1379 8982; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_878' title='bbox 429 8941 598 8982; x_wconf 92' lang='eng' dir='ltr'>Climbing</span> <span class='ocrx_word' id='word_1_879' title='bbox 615 8947 676 8971; x_wconf 94' lang='eng' dir='ltr'>out</span> <span class='ocrx_word' id='word_1_880' title='bbox 692 8941 734 8971; x_wconf 93' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_881' title='bbox 748 8951 766 8971; x_wconf 95' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_882' title='bbox 785 8941 1053 8971; x_wconf 90' lang='eng' dir='ltr'>recombination</span> <span class='ocrx_word' id='word_1_883' title='bbox 1072 8947 1251 8981; x_wconf 93' lang='eng' dir='ltr'>apparatus</span> <span class='ocrx_word' id='word_1_884' title='bbox 1269 8941 1307 8971; x_wconf 93' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_885' title='bbox 1322 8941 1379 8971; x_wconf 92' lang='eng' dir='ltr'>TA</span>
</span>
<span class='ocr_line' id='line_1_152' title="bbox 367 9001 1375 9042; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_886' title='bbox 367 9001 420 9031; x_wconf 92' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_887' title='bbox 434 9001 488 9031; x_wconf 92' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_888' title='bbox 504 9001 759 9041; x_wconf 91' lang='eng' dir='ltr'>tape-recorders</span> <span class='ocrx_word' id='word_1_889' title='bbox 778 9001 841 9031; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_890' title='bbox 859 9007 1004 9041; x_wconf 90' lang='eng' dir='ltr'>cut-ups,</span> <span class='ocrx_word' id='word_1_891' title='bbox 1021 9001 1215 9042; x_wconf 93' lang='eng' dir='ltr'>hypervirus</span> <span class='ocrx_word' id='word_1_892' title='bbox 1231 9001 1375 9031; x_wconf 91' lang='eng' dir='ltr'>infected</span>
</span>
<span class='ocr_line' id='line_1_153' title="bbox 369 9057 1375 9101; baseline 0 -12; x_size 43; x_descenders 11; x_ascenders 12"><span class='ocrx_word' id='word_1_893' title='bbox 369 9059 556 9100; x_wconf 93' lang='eng' dir='ltr'>Burroughs</span> <span class='ocrx_word' id='word_1_894' title='bbox 571 9059 605 9089; x_wconf 92' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_895' title='bbox 621 9067 706 9100; x_wconf 83' lang='eng'>1972,</span> <span class='ocrx_word' id='word_1_896' title='bbox 723 9065 757 9089; x_wconf 95' lang='eng' dir='ltr'>at</span> <span class='ocrx_word' id='word_1_897' title='bbox 772 9059 828 9089; x_wconf 94' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_898' title='bbox 843 9069 925 9099; x_wconf 91' lang='eng' dir='ltr'>cusp</span> <span class='ocrx_word' id='word_1_899' title='bbox 941 9059 980 9089; x_wconf 93' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_900' title='bbox 993 9057 1340 9101; x_wconf 83' lang='eng' dir='ltr'>K(ondratieff)-wave</span> <span class='ocrx_word' id='word_1_901' title='bbox 1355 9067 1375 9100; x_wconf 85' lang='eng'><em>9</em></span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_3' title="bbox 362 9127 1374 10513">
<p class='ocr_par' dir='ltr' id='par_1_23' title="bbox 362 9127 1374 9803">
<span class='ocr_line' id='line_1_154' title="bbox 365 9127 1374 9172; baseline 0 -13; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_902' title='bbox 365 9127 435 9172; x_wconf 94' lang='eng' dir='ltr'>(the</span> <span class='ocrx_word' id='word_1_903' title='bbox 448 9129 620 9159; x_wconf 93' lang='eng' dir='ltr'>threshold</span> <span class='ocrx_word' id='word_1_904' title='bbox 632 9129 669 9159; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_905' title='bbox 677 9128 974 9172; x_wconf 92' lang='eng' dir='ltr'>postmodernity).</span> <span class='ocrx_word' id='word_1_906' title='bbox 990 9130 1015 9159; x_wconf 95' lang='eng' dir='ltr'>It</span> <span class='ocrx_word' id='word_1_907' title='bbox 1027 9129 1155 9169; x_wconf 92' lang='eng' dir='ltr'>rapidly</span> <span class='ocrx_word' id='word_1_908' title='bbox 1164 9129 1374 9169; x_wconf 89' lang='eng' dir='ltr'>reprocessed</span>
</span>
<span class='ocr_line' id='line_1_155' title="bbox 364 9189 1374 9230; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_909' title='bbox 364 9189 405 9219; x_wconf 94' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_910' title='bbox 420 9195 523 9230; x_wconf 94' lang='eng' dir='ltr'>target</span> <span class='ocrx_word' id='word_1_911' title='bbox 536 9189 610 9219; x_wconf 93' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_912' title='bbox 623 9199 667 9219; x_wconf 93' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_913' title='bbox 681 9189 884 9230; x_wconf 93' lang='eng' dir='ltr'>intelligenic</span> <span class='ocrx_word' id='word_1_914' title='bbox 900 9199 944 9219; x_wconf 93' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_915' title='bbox 955 9199 1013 9229; x_wconf 93' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_916' title='bbox 1024 9199 1079 9229; x_wconf 91' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_917' title='bbox 1094 9199 1138 9219; x_wconf 93' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_918' title='bbox 1153 9199 1197 9219; x_wconf 93' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_919' title='bbox 1212 9199 1374 9219; x_wconf 90' lang='eng' dir='ltr'>nova-war</span>
</span>
<span class='ocr_line' id='line_1_156' title="bbox 365 9246 1372 9287; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_920' title='bbox 365 9246 561 9286; x_wconf 91' lang='eng' dir='ltr'>laboratory,</span> <span class='ocrx_word' id='word_1_921' title='bbox 570 9246 779 9287; x_wconf 93' lang='eng' dir='ltr'>volatilizing</span> <span class='ocrx_word' id='word_1_922' title='bbox 788 9246 842 9276; x_wconf 94' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_923' title='bbox 854 9246 980 9286; x_wconf 92' lang='eng' dir='ltr'>history</span> <span class='ocrx_word' id='word_1_924' title='bbox 988 9246 1026 9276; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_925' title='bbox 1032 9246 1194 9287; x_wconf 93' lang='eng' dir='ltr'>language</span> <span class='ocrx_word' id='word_1_926' title='bbox 1204 9246 1275 9276; x_wconf 93' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_927' title='bbox 1284 9246 1372 9276; x_wconf 92' lang='eng' dir='ltr'>invo-</span>
</span>
<span class='ocr_line' id='line_1_157' title="bbox 364 9305 1370 9346; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_928' title='bbox 364 9305 530 9345; x_wconf 91' lang='eng' dir='ltr'>lutionary</span> <span class='ocrx_word' id='word_1_929' title='bbox 539 9305 745 9335; x_wconf 94' lang='eng' dir='ltr'>word-virus.</span> <span class='ocrx_word' id='word_1_930' title='bbox 759 9305 931 9335; x_wconf 93' lang='eng' dir='ltr'>Mutation</span> <span class='ocrx_word' id='word_1_931' title='bbox 941 9311 990 9335; x_wconf 95' lang='eng' dir='ltr'>rat</span> <span class='ocrx_word' id='word_1_932' title='bbox 1000 9311 1047 9335; x_wconf 95' lang='eng' dir='ltr'>rat</span> <span class='ocrx_word' id='word_1_933' title='bbox 1058 9311 1106 9335; x_wconf 95' lang='eng' dir='ltr'>rat</span> <span class='ocrx_word' id='word_1_934' title='bbox 1116 9311 1164 9335; x_wconf 95' lang='eng' dir='ltr'>rat</span> <span class='ocrx_word' id='word_1_935' title='bbox 1175 9311 1259 9335; x_wconf 94' lang='eng' dir='ltr'>rates</span> <span class='ocrx_word' id='word_1_936' title='bbox 1264 9305 1370 9346; x_wconf 80' lang='eng' dir='ltr'>jump.</span>
</span>
<span class='ocr_line' id='line_1_158' title="bbox 362 9363 1373 9404; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_937' title='bbox 362 9364 479 9393; x_wconf 94' lang='eng' dir='ltr'>Vector</span> <span class='ocrx_word' id='word_1_938' title='bbox 498 9363 650 9393; x_wconf 94' lang='eng' dir='ltr'>switches</span> <span class='ocrx_word' id='word_1_939' title='bbox 670 9363 817 9404; x_wconf 94' lang='eng' dir='ltr'>through</span> <span class='ocrx_word' id='word_1_940' title='bbox 838 9363 958 9400; x_wconf 94' lang='eng' dir='ltr'>Butler,</span> <span class='ocrx_word' id='word_1_941' title='bbox 977 9363 1117 9400; x_wconf 93' lang='eng' dir='ltr'>Gibson,</span> <span class='ocrx_word' id='word_1_942' title='bbox 1136 9363 1206 9393; x_wconf 93' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_943' title='bbox 1222 9363 1373 9404; x_wconf 92' lang='eng' dir='ltr'>Cadigan</span>
</span>
<span class='ocr_line' id='line_1_159' title="bbox 364 9422 1371 9463; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_944' title='bbox 364 9422 523 9452; x_wconf 93' lang='eng' dir='ltr'>fine-tune</span> <span class='ocrx_word' id='word_1_945' title='bbox 540 9422 581 9452; x_wconf 94' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_946' title='bbox 596 9422 750 9463; x_wconf 92' lang='eng' dir='ltr'>synergic</span> <span class='ocrx_word' id='word_1_947' title='bbox 765 9422 1039 9459; x_wconf 90' lang='eng' dir='ltr'>interexcitation,</span> <span class='ocrx_word' id='word_1_948' title='bbox 1057 9422 1169 9462; x_wconf 93' lang='eng' dir='ltr'>silt-up</span> <span class='ocrx_word' id='word_1_949' title='bbox 1185 9422 1371 9462; x_wconf 90' lang='eng' dir='ltr'>cybershift-</span>
</span>
<span class='ocr_line' id='line_1_160' title="bbox 364 9478 1370 9523; baseline 0 -13; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_950' title='bbox 364 9480 527 9521; x_wconf 93' lang='eng' dir='ltr'>inducing</span> <span class='ocrx_word' id='word_1_951' title='bbox 543 9478 887 9523; x_wconf 89' lang='eng' dir='ltr'>K(uang)-potential,</span> <span class='ocrx_word' id='word_1_952' title='bbox 905 9480 972 9510; x_wconf 93' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_953' title='bbox 988 9480 1171 9510; x_wconf 92' lang='eng' dir='ltr'>trend-lock</span> <span class='ocrx_word' id='word_1_954' title='bbox 1184 9486 1267 9510; x_wconf 93' lang='eng' dir='ltr'>onto</span> <span class='ocrx_word' id='word_1_955' title='bbox 1284 9488 1370 9511; x_wconf 85' lang='eng'>11001</span>
</span>
<span class='ocr_line' id='line_1_161' title="bbox 364 9547 1371 9569; baseline 0.001 -1; x_size 41.848484; x_descenders 10.848485; x_ascenders 10.450311"><span class='ocrx_word' id='word_1_956' title='bbox 364 9547 1371 9569; x_wconf 91' lang='eng'>01001001010111101001011101011001000100010100100010</span>
</span>
<span class='ocr_line' id='line_1_162' title="bbox 364 9606 1371 9628; baseline 0 0; x_size 41.848484; x_descenders 10.848485; x_ascenders 10.450311"><span class='ocrx_word' id='word_1_957' title='bbox 364 9606 1371 9628; x_wconf 94' lang='eng'>01001001001001010010110100100100100100100100111010</span>
</span>
<span class='ocr_line' id='line_1_163' title="bbox 364 9656 1371 9696; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 9"><span class='ocrx_word' id='word_1_958' title='bbox 364 9665 1011 9686; x_wconf 97' lang='eng'>0100100100011001000101100101010</span> <span class='ocrx_word' id='word_1_959' title='bbox 1026 9656 1157 9696; x_wconf 88' lang='eng' dir='ltr'>K-punk</span> <span class='ocrx_word' id='word_1_960' title='bbox 1168 9656 1281 9696; x_wconf 91' lang='eng' dir='ltr'>pulses</span> <span class='ocrx_word' id='word_1_961' title='bbox 1291 9656 1371 9686; x_wconf 94' lang='eng' dir='ltr'>with</span>
</span>
<span class='ocr_line' id='line_1_164' title="bbox 365 9714 1372 9755; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_962' title='bbox 365 9714 828 9755; x_wconf 93' lang='eng' dir='ltr'>telematically-accelerating</span> <span class='ocrx_word' id='word_1_963' title='bbox 839 9714 1077 9754; x_wconf 93' lang='eng' dir='ltr'>neoreplicator</span> <span class='ocrx_word' id='word_1_964' title='bbox 1086 9714 1225 9754; x_wconf 93' lang='eng' dir='ltr'>plicator</span> <span class='ocrx_word' id='word_1_965' title='bbox 1234 9714 1372 9754; x_wconf 93' lang='eng' dir='ltr'>plicator</span>
</span>
<span class='ocr_line' id='line_1_165' title="bbox 363 9773 639 9803; baseline 0 0; x_size 40.558296; x_descenders 10.558295; x_ascenders 10"><span class='ocrx_word' id='word_1_966' title='bbox 363 9773 639 9803; x_wconf 93' lang='eng' dir='ltr'>contamination.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_24' title="bbox 362 9828 1370 10095">
<span class='ocr_line' id='line_1_166' title="bbox 428 9828 1370 9872; baseline 0.001 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_967' title='bbox 428 9828 595 9872; x_wconf 78' lang='eng' dir='ltr'>Looking</span> <span class='ocrx_word' id='word_1_968' title='bbox 605 9831 661 9861; x_wconf 95' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_969' title='bbox 672 9841 691 9861; x_wconf 94' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_970' title='bbox 705 9831 753 9861; x_wconf 96' lang='eng' dir='ltr'>hit</span> <span class='ocrx_word' id='word_1_971' title='bbox 766 9831 805 9861; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_972' title='bbox 815 9829 1032 9861; x_wconf 81' lang='eng' dir='ltr'>snowcrash?</span> <span class='ocrx_word' id='word_1_973' title='bbox 1045 9835 1065 9861; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_974' title='bbox 1077 9835 1138 9861; x_wconf 47' lang='eng' dir='ltr'>Wit</span> <span class='ocrx_word' id='word_1_975' title='bbox 1149 9835 1169 9861; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_976' title='bbox 1202 9835 1244 9861; x_wconf 72' lang='eng'>##</span> <span class='ocrx_word' id='word_1_977' title='bbox 1267 9836 1284 9861; x_wconf 74' lang='eng'>#</span> <span class='ocrx_word' id='word_1_978' title='bbox 1306 9836 1326 9862; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_979' title='bbox 1350 9836 1370 9862; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_167' title="bbox 362 9894 1370 9920; baseline 0 0; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_980' title='bbox 362 9894 446 9920; x_wconf 72' lang='eng'>###</span> <span class='ocrx_word' id='word_1_981' title='bbox 478 9894 849 9920; x_wconf 55' lang='eng' dir='ltr'>##W########</span> <span class='ocrx_word' id='word_1_982' title='bbox 882 9894 988 9920; x_wconf 44' lang='eng'>##1##</span> <span class='ocrx_word' id='word_1_983' title='bbox 1040 9894 1204 9920; x_wconf 69' lang='eng'>######</span> <span class='ocrx_word' id='word_1_984' title='bbox 1247 9894 1267 9920; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_985' title='bbox 1296 9894 1317 9920; x_wconf 70' lang='eng'>#</span> <span class='ocrx_word' id='word_1_986' title='bbox 1350 9894 1370 9920; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_168' title="bbox 362 9952 1369 9979; baseline 0 -1; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_987' title='bbox 362 9952 467 9978; x_wconf 70' lang='eng'>####</span> <span class='ocrx_word' id='word_1_988' title='bbox 502 9952 522 9978; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_989' title='bbox 557 9952 663 9978; x_wconf 54' lang='eng'>##1##</span> <span class='ocrx_word' id='word_1_990' title='bbox 697 9952 717 9978; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_991' title='bbox 752 9952 772 9978; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_992' title='bbox 807 9952 827 9978; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_993' title='bbox 861 9952 968 9978; x_wconf 71' lang='eng'>###</span> <span class='ocrx_word' id='word_1_994' title='bbox 1002 9952 1242 9978; x_wconf 71' lang='eng'>#######</span> <span class='ocrx_word' id='word_1_995' title='bbox 1275 9954 1293 9978; x_wconf 73' lang='eng'>#</span> <span class='ocrx_word' id='word_1_996' title='bbox 1349 9953 1369 9979; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_169' title="bbox 363 10011 1370 10037; baseline 0 0; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_997' title='bbox 363 10011 529 10037; x_wconf 71' lang='eng'>#######</span> <span class='ocrx_word' id='word_1_998' title='bbox 585 10011 732 10037; x_wconf 64' lang='eng'>#####=#</span> <span class='ocrx_word' id='word_1_999' title='bbox 798 10011 840 10037; x_wconf 70' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1000' title='bbox 861 10011 1008 10037; x_wconf 69' lang='eng'>#####</span> <span class='ocrx_word' id='word_1_1001' title='bbox 1040 10011 1080 10037; x_wconf 70' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1002' title='bbox 1112 10011 1132 10037; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1003' title='bbox 1185 10011 1205 10037; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1004' title='bbox 1238 10011 1370 10037; x_wconf 68' lang='eng'>#####</span>
</span>
<span class='ocr_line' id='line_1_170' title="bbox 362 10069 1191 10095; baseline 0 0; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_1005' title='bbox 362 10069 446 10095; x_wconf 71' lang='eng'>###</span> <span class='ocrx_word' id='word_1_1006' title='bbox 480 10069 1002 10095; x_wconf 70' lang='eng'>###############</span> <span class='ocrx_word' id='word_1_1007' title='bbox 1044 10069 1084 10095; x_wconf 70' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1008' title='bbox 1117 10069 1137 10095; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1009' title='bbox 1170 10069 1191 10095; x_wconf 70' lang='eng'>#</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_25' title="bbox 362 10123 1370 10513">
<span class='ocr_line' id='line_1_171' title="bbox 424 10123 1369 10163; baseline 0.001 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_1010' title='bbox 424 10123 469 10153; x_wconf 90' lang='eng' dir='ltr'>As</span> <span class='ocrx_word' id='word_1_1011' title='bbox 478 10123 699 10163; x_wconf 93' lang='eng' dir='ltr'>postmodern</span> <span class='ocrx_word' id='word_1_1012' title='bbox 708 10123 834 10153; x_wconf 94' lang='eng' dir='ltr'>culture</span> <span class='ocrx_word' id='word_1_1013' title='bbox 844 10133 967 10153; x_wconf 94' lang='eng' dir='ltr'>crosses</span> <span class='ocrx_word' id='word_1_1014' title='bbox 978 10129 1011 10153; x_wconf 97' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_1015' title='bbox 1020 10123 1228 10163; x_wconf 90' lang='eng' dir='ltr'>hypermania</span> <span class='ocrx_word' id='word_1_1016' title='bbox 1239 10123 1297 10153; x_wconf 91' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_1017' title='bbox 1307 10128 1369 10154; x_wconf 51' lang='eng'>##1##</span>
</span>
<span class='ocr_line' id='line_1_172' title="bbox 362 10186 1370 10213; baseline 0 -1; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_1018' title='bbox 362 10186 1288 10212; x_wconf 56' lang='eng' dir='ltr'>######################W#</span> <span class='ocrx_word' id='word_1_1019' title='bbox 1350 10187 1370 10213; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_173' title="bbox 363 10244 1368 10270; baseline 0 0; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_1020' title='bbox 363 10244 384 10270; x_wconf 70' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1021' title='bbox 416 10244 510 10270; x_wconf 71' lang='eng'>####</span> <span class='ocrx_word' id='word_1_1022' title='bbox 544 10244 779 10270; x_wconf 69' lang='eng'>#######</span> <span class='ocrx_word' id='word_1_1023' title='bbox 814 10244 834 10270; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1024' title='bbox 868 10244 1314 10270; x_wconf 56' lang='eng' dir='ltr'>##########W#</span> <span class='ocrx_word' id='word_1_1025' title='bbox 1348 10244 1368 10270; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_174' title="bbox 363 10302 1369 10329; baseline 0 -1; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_1026' title='bbox 363 10302 941 10328; x_wconf 68' lang='eng'>#################</span> <span class='ocrx_word' id='word_1_1027' title='bbox 983 10302 1043 10328; x_wconf 71' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1028' title='bbox 1084 10302 1104 10328; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1029' title='bbox 1146 10302 1305 10328; x_wconf 43' lang='eng' dir='ltr'>##fitfi</span> <span class='ocrx_word' id='word_1_1030' title='bbox 1349 10303 1369 10329; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_175' title="bbox 362 10361 1369 10387; baseline 0 0; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_1031' title='bbox 362 10361 476 10387; x_wconf 72' lang='eng'>#####</span> <span class='ocrx_word' id='word_1_1032' title='bbox 533 10361 574 10387; x_wconf 72' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1033' title='bbox 594 10361 738 10387; x_wconf 56' lang='eng'>######</span> <span class='ocrx_word' id='word_1_1034' title='bbox 777 10361 827 10387; x_wconf 71' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1035' title='bbox 847 10361 868 10387; x_wconf 70' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1036' title='bbox 888 10361 949 10387; x_wconf 51' lang='eng' dir='ltr'><em>W</em></span> <span class='ocrx_word' id='word_1_1037' title='bbox 969 10361 1009 10387; x_wconf 70' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1038' title='bbox 1036 10361 1076 10387; x_wconf 70' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1039' title='bbox 1104 10361 1124 10387; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1040' title='bbox 1143 10361 1251 10387; x_wconf 71' lang='eng'>####</span> <span class='ocrx_word' id='word_1_1041' title='bbox 1270 10361 1369 10387; x_wconf 69' lang='eng'>####</span>
</span>
<span class='ocr_line' id='line_1_176' title="bbox 362 10414 1368 10455; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_1042' title='bbox 362 10418 383 10444; x_wconf 70' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1043' title='bbox 395 10420 472 10454; x_wconf 92' lang='eng' dir='ltr'>stop</span> <span class='ocrx_word' id='word_1_1044' title='bbox 484 10420 561 10454; x_wconf 92' lang='eng' dir='ltr'>stop</span> <span class='ocrx_word' id='word_1_1045' title='bbox 573 10424 618 10455; x_wconf 94' lang='eng' dir='ltr'>go</span> <span class='ocrx_word' id='word_1_1046' title='bbox 631 10420 708 10454; x_wconf 92' lang='eng' dir='ltr'>stop</span> <span class='ocrx_word' id='word_1_1047' title='bbox 720 10424 765 10455; x_wconf 94' lang='eng' dir='ltr'>go</span> <span class='ocrx_word' id='word_1_1048' title='bbox 778 10420 854 10454; x_wconf 92' lang='eng' dir='ltr'>stop</span> <span class='ocrx_word' id='word_1_1049' title='bbox 866 10424 912 10455; x_wconf 94' lang='eng' dir='ltr'>go</span> <span class='ocrx_word' id='word_1_1050' title='bbox 924 10424 968 10455; x_wconf 93' lang='eng' dir='ltr'>go</span> <span class='ocrx_word' id='word_1_1051' title='bbox 980 10424 1059 10455; x_wconf 94' lang='eng' dir='ltr'>goes</span> <span class='ocrx_word' id='word_1_1052' title='bbox 1073 10424 1163 10451; x_wconf 92' lang='eng' dir='ltr'>nova,</span> <span class='ocrx_word' id='word_1_1053' title='bbox 1179 10414 1201 10444; x_wconf 95' lang='eng' dir='ltr'>it</span> <span class='ocrx_word' id='word_1_1054' title='bbox 1214 10414 1368 10455; x_wconf 85' lang='eng' dir='ltr'>singular-</span>
</span>
<span class='ocr_line' id='line_1_177' title="bbox 364 10472 1370 10513; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_1055' title='bbox 364 10472 429 10502; x_wconf 94' lang='eng' dir='ltr'>izes</span> <span class='ocrx_word' id='word_1_1056' title='bbox 437 10472 675 10512; x_wconf 93' lang='eng' dir='ltr'>multiplicities</span> <span class='ocrx_word' id='word_1_1057' title='bbox 682 10472 772 10502; x_wconf 94' lang='eng' dir='ltr'>cities</span> <span class='ocrx_word' id='word_1_1058' title='bbox 782 10472 871 10502; x_wconf 94' lang='eng' dir='ltr'>cities</span> <span class='ocrx_word' id='word_1_1059' title='bbox 881 10472 919 10502; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_1060' title='bbox 926 10472 1095 10512; x_wconf 92' lang='eng' dir='ltr'>invasively</span> <span class='ocrx_word' id='word_1_1061' title='bbox 1103 10472 1370 10513; x_wconf 90' lang='eng' dir='ltr'>autoreplicating</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_4' title="bbox 364 10529 1370 10634">
<p class='ocr_par' dir='ltr' id='par_1_26' title="bbox 364 10529 1370 10634">
<span class='ocr_line' id='line_1_178' title="bbox 364 10529 1365 10575; baseline -0.002 -14; x_size 42; x_descenders 11; x_ascenders 11"><span class='ocrx_word' id='word_1_1062' title='bbox 364 10531 644 10572; x_wconf 93' lang='eng' dir='ltr'>autoreplicating</span> <span class='ocrx_word' id='word_1_1063' title='bbox 652 10531 897 10571; x_wconf 89' lang='eng' dir='ltr'>plexoweapon</span> <span class='ocrx_word' id='word_1_1064' title='bbox 908 10547 930 10551; x_wconf 98' lang='eng'><em>-</em></span> <span class='ocrx_word' id='word_1_1065' title='bbox 941 10537 1074 10571; x_wconf 93' lang='eng' dir='ltr'>systems</span> <span class='ocrx_word' id='word_1_1066' title='bbox 1086 10529 1138 10574; x_wconf 70' lang='eng'>(0</span> <span class='ocrx_word' id='word_1_1067' title='bbox 1152 10530 1163 10574; x_wconf 91' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1068' title='bbox 1175 10530 1244 10575; x_wconf 89' lang='eng'>((()</span> <span class='ocrx_word' id='word_1_1069' title='bbox 1258 10529 1298 10574; x_wconf 91' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_1070' title='bbox 1312 10529 1324 10574; x_wconf 92' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1071' title='bbox 1337 10530 1365 10575; x_wconf 86' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_179' title="bbox 365 10586 1370 10634; baseline -0.006 0; x_size 59.8125; x_descenders 15.8125; x_ascenders 15.8125"><span class='ocrx_word' id='word_1_1072' title='bbox 365 10587 420 10634; x_wconf 86' lang='eng'>())</span> <span class='ocrx_word' id='word_1_1073' title='bbox 435 10589 481 10634; x_wconf 90' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_1074' title='bbox 494 10589 506 10633; x_wconf 91' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1075' title='bbox 521 10587 550 10632; x_wconf 89' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1076' title='bbox 562 10588 601 10632; x_wconf 88' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1077' title='bbox 617 10587 629 10632; x_wconf 91' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1078' title='bbox 643 10586 722 10632; x_wconf 69' lang='eng' dir='ltr'>D»)</span> <span class='ocrx_word' id='word_1_1079' title='bbox 737 10587 749 10632; x_wconf 93' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1080' title='bbox 763 10588 776 10632; x_wconf 90' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1081' title='bbox 790 10587 802 10632; x_wconf 93' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1082' title='bbox 816 10586 862 10630; x_wconf 85' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1083' title='bbox 885 10586 898 10630; x_wconf 88' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1084' title='bbox 914 10587 982 10617; x_wconf 65' lang='eng' dir='ltr'>that</span> <span class='ocrx_word' id='word_1_1085' title='bbox 993 10597 1044 10617; x_wconf 66' lang='eng' dir='ltr'>are</span> <span class='ocrx_word' id='word_1_1086' title='bbox 1056 10597 1087 10617; x_wconf 70' lang='eng' dir='ltr'>r6</span> <span class='ocrx_word' id='word_1_1087' title='bbox 1098 10597 1130 10617; x_wconf 70' lang='eng' dir='ltr'>r6</span> <span class='ocrx_word' id='word_1_1088' title='bbox 1142 10597 1174 10617; x_wconf 70' lang='eng' dir='ltr'>r6</span> <span class='ocrx_word' id='word_1_1089' title='bbox 1185 10597 1216 10617; x_wconf 70' lang='eng' dir='ltr'>r6</span> <span class='ocrx_word' id='word_1_1090' title='bbox 1229 10587 1370 10628; x_wconf 72' lang='eng' dir='ltr'>nothing</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_5' title="bbox 360 10647 1376 11679">
<p class='ocr_par' dir='ltr' id='par_1_27' title="bbox 360 10647 1376 11679">
<span class='ocr_line' id='line_1_180' title="bbox 365 10647 1367 10688; baseline -0.001 -10; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_1091' title='bbox 365 10648 500 10688; x_wconf 92' lang='eng' dir='ltr'>beyond</span> <span class='ocrx_word' id='word_1_1092' title='bbox 516 10647 598 10677; x_wconf 94' lang='eng' dir='ltr'>their</span> <span class='ocrx_word' id='word_1_1093' title='bbox 611 10657 679 10677; x_wconf 94' lang='eng' dir='ltr'>war</span> <span class='ocrx_word' id='word_1_1094' title='bbox 689 10647 786 10677; x_wconf 94' lang='eng' dir='ltr'>AGA</span> <span class='ocrx_word' id='word_1_1095' title='bbox 792 10647 889 10677; x_wconf 94' lang='eng' dir='ltr'>AGA</span> <span class='ocrx_word' id='word_1_1096' title='bbox 900 10647 1027 10688; x_wconf 93' lang='eng' dir='ltr'>against</span> <span class='ocrx_word' id='word_1_1097' title='bbox 1040 10647 1181 10687; x_wconf 92' lang='eng' dir='ltr'>security.</span> <span class='ocrx_word' id='word_1_1098' title='bbox 1195 10647 1269 10677; x_wconf 88' lang='eng' dir='ltr'>This</span> <span class='ocrx_word' id='word_1_1099' title='bbox 1281 10647 1307 10677; x_wconf 95' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_1100' title='bbox 1324 10657 1367 10677; x_wconf 93' lang='eng' dir='ltr'>no</span>
</span>
<span class='ocr_line' id='line_1_181' title="bbox 361 10706 1373 10747; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_1101' title='bbox 361 10706 478 10747; x_wconf 91' lang='eng' dir='ltr'>longer</span> <span class='ocrx_word' id='word_1_1102' title='bbox 487 10716 505 10736; x_wconf 97' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_1103' title='bbox 514 10706 668 10746; x_wconf 90' lang='eng' dir='ltr'>question</span> <span class='ocrx_word' id='word_1_1104' title='bbox 677 10716 723 10736; x_wconf 94' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_1105' title='bbox 733 10706 785 10736; x_wconf 85' lang='eng' dir='ltr'>off</span> <span class='ocrx_word' id='word_1_1106' title='bbox 790 10716 837 10736; x_wconf 94' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_1107' title='bbox 846 10706 885 10736; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_1108' title='bbox 892 10706 1092 10747; x_wconf 91' lang='eng' dir='ltr'>ideological</span> <span class='ocrx_word' id='word_1_1109' title='bbox 1103 10706 1373 10746; x_wconf 92' lang='eng' dir='ltr'>representation,</span>
</span>
<span class='ocr_line' id='line_1_182' title="bbox 361 10762 1375 10803; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_1110' title='bbox 361 10772 567 10803; x_wconf 90' lang='eng' dir='ltr'>exogeneous</span> <span class='ocrx_word' id='word_1_1111' title='bbox 577 10762 723 10802; x_wconf 94' lang='eng' dir='ltr'>political</span> <span class='ocrx_word' id='word_1_1112' title='bbox 733 10762 972 10799; x_wconf 92' lang='eng' dir='ltr'>mobilization,</span> <span class='ocrx_word' id='word_1_1113' title='bbox 984 10762 1170 10792; x_wconf 94' lang='eng' dir='ltr'>theoretical</span> <span class='ocrx_word' id='word_1_1114' title='bbox 1180 10762 1326 10802; x_wconf 94' lang='eng' dir='ltr'>critique,</span> <span class='ocrx_word' id='word_1_1115' title='bbox 1335 10767 1375 10792; x_wconf 75' lang='eng'>##</span>
</span>
<span class='ocr_line' id='line_1_183' title="bbox 360 10826 1374 10851; baseline 0 0; x_size 34.235298; x_descenders 9.2352991; x_ascenders 8.5866337"><span class='ocrx_word' id='word_1_1116' title='bbox 360 10826 555 10851; x_wconf 74' lang='eng'>########</span> <span class='ocrx_word' id='word_1_1117' title='bbox 577 10826 597 10851; x_wconf 76' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1118' title='bbox 618 10826 1227 10851; x_wconf 64' lang='eng'>######################</span> <span class='ocrx_word' id='word_1_1119' title='bbox 1271 10826 1374 10851; x_wconf 73' lang='eng'>####</span>
</span>
<span class='ocr_line' id='line_1_184' title="bbox 361 10880 1373 10921; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_1120' title='bbox 361 10885 402 10911; x_wconf 73' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1121' title='bbox 435 10885 455 10910; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1122' title='bbox 467 10885 487 10910; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1123' title='bbox 499 10885 519 10910; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1124' title='bbox 551 10885 571 10910; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1125' title='bbox 583 10885 603 10910; x_wconf 76' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1126' title='bbox 615 10885 677 10910; x_wconf 76' lang='eng'>###</span> <span class='ocrx_word' id='word_1_1127' title='bbox 734 10885 754 10910; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1128' title='bbox 777 10885 797 10910; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1129' title='bbox 844 10885 864 10910; x_wconf 76' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1130' title='bbox 876 10884 939 10910; x_wconf 54' lang='eng' dir='ltr'>#W</span> <span class='ocrx_word' id='word_1_1131' title='bbox 985 10885 1005 10910; x_wconf 76' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1132' title='bbox 1018 10890 1057 10910; x_wconf 94' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_1133' title='bbox 1070 10880 1222 10921; x_wconf 90' lang='eng' dir='ltr'>strategic</span> <span class='ocrx_word' id='word_1_1134' title='bbox 1235 10880 1373 10910; x_wconf 93' lang='eng' dir='ltr'>orienta-</span>
</span>
<span class='ocr_line' id='line_1_185' title="bbox 364 10938 1376 10979; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_1135' title='bbox 364 10938 443 10974; x_wconf 94' lang='eng' dir='ltr'>tion,</span> <span class='ocrx_word' id='word_1_1136' title='bbox 456 10938 516 10968; x_wconf 94' lang='eng' dir='ltr'>but</span> <span class='ocrx_word' id='word_1_1137' title='bbox 528 10938 564 10968; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_1138' title='bbox 573 10938 818 10968; x_wconf 94' lang='eng' dir='ltr'>decentralized</span> <span class='ocrx_word' id='word_1_1139' title='bbox 829 10938 971 10968; x_wconf 94' lang='eng' dir='ltr'>cultural</span> <span class='ocrx_word' id='word_1_1140' title='bbox 983 10938 1148 10979; x_wconf 90' lang='eng' dir='ltr'>diagrams</span> <span class='ocrx_word' id='word_1_1141' title='bbox 1163 10938 1376 10979; x_wconf 88' lang='eng' dir='ltr'>functioning</span>
</span>
<span class='ocr_line' id='line_1_186' title="bbox 362 10996 1373 11037; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_1142' title='bbox 362 11006 396 11026; x_wconf 92' lang='eng' dir='ltr'>as</span> <span class='ocrx_word' id='word_1_1143' title='bbox 407 10996 588 11026; x_wconf 92' lang='eng' dir='ltr'>immanent</span> <span class='ocrx_word' id='word_1_1144' title='bbox 599 10996 704 11026; x_wconf 89' lang='eng' dir='ltr'>forces</span> <span class='ocrx_word' id='word_1_1145' title='bbox 716 10996 755 11026; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_1146' title='bbox 762 10996 986 11037; x_wconf 90' lang='eng' dir='ltr'>antagonism.</span> <span class='ocrx_word' id='word_1_1147' title='bbox 1000 11005 1105 11026; x_wconf 89' lang='eng' dir='ltr'>K-war</span> <span class='ocrx_word' id='word_1_1148' title='bbox 1113 10996 1242 11026; x_wconf 92' lang='eng' dir='ltr'>derives</span> <span class='ocrx_word' id='word_1_1149' title='bbox 1253 10996 1292 11026; x_wconf 92' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_1150' title='bbox 1305 10996 1373 11026; x_wconf 92' lang='eng' dir='ltr'>sole</span>
</span>
<span class='ocr_line' id='line_1_187' title="bbox 362 11054 1207 11094; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_1151' title='bbox 362 11054 541 11084; x_wconf 94' lang='eng' dir='ltr'>coherence</span> <span class='ocrx_word' id='word_1_1152' title='bbox 555 11054 638 11084; x_wconf 88' lang='eng' dir='ltr'>from</span> <span class='ocrx_word' id='word_1_1153' title='bbox 653 11054 708 11084; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_1154' title='bbox 722 11054 815 11094; x_wconf 93' lang='eng' dir='ltr'>unity</span> <span class='ocrx_word' id='word_1_1155' title='bbox 828 11054 867 11084; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_1156' title='bbox 877 11054 916 11084; x_wconf 92' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_1157' title='bbox 933 11054 996 11084; x_wconf 88' lang='eng' dir='ltr'>foe.</span> <span class='ocrx_word' id='word_1_1158' title='bbox 1013 11055 1207 11084; x_wconf 92' lang='eng' dir='ltr'><a href="0.html"> RETURN.</a></span>
</span>
<span class='ocr_line' id='line_1_188' title="bbox 423 11109 1371 11155; baseline 0 -13; x_size 45; x_descenders 12; x_ascenders 13"><span class='ocrx_word' id='word_1_1159' title='bbox 423 11111 598 11150; x_wconf 92' lang='eng' dir='ltr'>Ana/Cata.</span> <span class='ocrx_word' id='word_1_1160' title='bbox 610 11112 728 11142; x_wconf 97' lang='eng' dir='ltr'>Switch</span> <span class='ocrx_word' id='word_1_1161' title='bbox 735 11110 1004 11155; x_wconf 89' lang='eng' dir='ltr'>cur((re)re)rent.</span> <span class='ocrx_word' id='word_1_1162' title='bbox 1016 11110 1044 11155; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1163' title='bbox 1054 11110 1066 11154; x_wconf 89' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1164' title='bbox 1078 11109 1106 11154; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1165' title='bbox 1116 11109 1159 11154; x_wconf 88' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1166' title='bbox 1170 11110 1235 11155; x_wconf 93' lang='eng' dir='ltr'>O(r</span> <span class='ocrx_word' id='word_1_1167' title='bbox 1241 11110 1338 11155; x_wconf 89' lang='eng' dir='ltr'>an)d(</span> <span class='ocrx_word' id='word_1_1168' title='bbox 1348 11111 1371 11155; x_wconf 89' lang='eng'>).</span>
</span>
<span class='ocr_line' id='line_1_189' title="bbox 365 11167 1372 11213; baseline 0 -13; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_1169' title='bbox 365 11168 430 11213; x_wconf 90' lang='eng' dir='ltr'>K0(</span> <span class='ocrx_word' id='word_1_1170' title='bbox 448 11171 461 11199; x_wconf 95' lang='eng' dir='ltr'>I</span> <span class='ocrx_word' id='word_1_1171' title='bbox 477 11170 588 11211; x_wconf 91' lang='eng' dir='ltr'>Ching</span> <span class='ocrx_word' id='word_1_1172' title='bbox 603 11170 781 11211; x_wconf 91' lang='eng' dir='ltr'>hexagram</span> <span class='ocrx_word' id='word_1_1173' title='bbox 811 11179 862 11211; x_wconf 78' lang='eng'>49:</span> <span class='ocrx_word' id='word_1_1174' title='bbox 882 11170 1085 11200; x_wconf 93' lang='eng' dir='ltr'>Revolution</span> <span class='ocrx_word' id='word_1_1175' title='bbox 1100 11167 1266 11212; x_wconf 91' lang='eng' dir='ltr'>(Molting</span> <span class='ocrx_word' id='word_1_1176' title='bbox 1280 11168 1309 11212; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1177' title='bbox 1326 11168 1372 11213; x_wconf 89' lang='eng'>)))</span>
</span>
<span class='ocr_line' id='line_1_190' title="bbox 363 11225 1372 11271; baseline 0 -13; x_size 45; x_descenders 12; x_ascenders 13"><span class='ocrx_word' id='word_1_1178' title='bbox 363 11228 466 11258; x_wconf 93' lang='eng' dir='ltr'>leaves</span> <span class='ocrx_word' id='word_1_1179' title='bbox 483 11225 495 11270; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1180' title='bbox 512 11226 524 11270; x_wconf 91' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1181' title='bbox 540 11228 684 11269; x_wconf 91' lang='eng' dir='ltr'>nothing</span> <span class='ocrx_word' id='word_1_1182' title='bbox 697 11227 816 11271; x_wconf 89' lang='eng' dir='ltr'>i)ntact</span> <span class='ocrx_word' id='word_1_1183' title='bbox 829 11228 945 11258; x_wconf 93' lang='eng' dir='ltr'>TACT</span> <span class='ocrx_word' id='word_1_1184' title='bbox 957 11228 1078 11258; x_wconf 91' lang='eng' dir='ltr'>TACT.</span> <span class='ocrx_word' id='word_1_1185' title='bbox 1097 11226 1141 11271; x_wconf 92' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_1186' title='bbox 1159 11226 1187 11270; x_wconf 92' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1187' title='bbox 1205 11226 1234 11270; x_wconf 92' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1188' title='bbox 1251 11227 1263 11271; x_wconf 89' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1189' title='bbox 1280 11226 1309 11270; x_wconf 92' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1190' title='bbox 1327 11226 1372 11271; x_wconf 89' lang='eng'>)))</span>
</span>
<span class='ocr_line' id='line_1_191' title="bbox 364 11284 1375 11330; baseline -0.003 0; x_size 80.018547; x_descenders 13; x_ascenders 23.018549"><span class='ocrx_word' id='word_1_1191' title='bbox 364 11286 392 11330; x_wconf 81' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1192' title='bbox 411 11285 423 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1193' title='bbox 440 11285 452 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1194' title='bbox 471 11286 515 11330; x_wconf 79' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1195' title='bbox 534 11284 561 11329; x_wconf 83' lang='eng'>(&lt;</span> <span class='ocrx_word' id='word_1_1196' title='bbox 580 11286 592 11330; x_wconf 79' lang='eng'><em>&gt;</em></span> <span class='ocrx_word' id='word_1_1197' title='bbox 610 11284 637 11329; x_wconf 81' lang='eng'>)&gt;</span> <span class='ocrx_word' id='word_1_1198' title='bbox 658 11285 670 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1199' title='bbox 689 11285 717 11329; x_wconf 83' lang='eng'>)&gt;</span> <span class='ocrx_word' id='word_1_1200' title='bbox 751 11284 780 11329; x_wconf 81' lang='eng'>&lt;&lt;</span> <span class='ocrx_word' id='word_1_1201' title='bbox 798 11286 810 11330; x_wconf 80' lang='eng'><em>)</em></span> <span class='ocrx_word' id='word_1_1202' title='bbox 830 11285 842 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1203' title='bbox 861 11285 873 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1204' title='bbox 892 11285 920 11329; x_wconf 83' lang='eng'>»</span> <span class='ocrx_word' id='word_1_1205' title='bbox 954 11284 1031 11330; x_wconf 79' lang='eng'><strong>()))</strong></span> <span class='ocrx_word' id='word_1_1206' title='bbox 1050 11285 1062 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1207' title='bbox 1081 11284 1126 11330; x_wconf 79' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1208' title='bbox 1158 11285 1375 11329; x_wconf 78' lang='eng' dir='ltr'><a href="cyberSit.html">)Cyberserk</a></span>
</span>
<span class='ocr_line' id='line_1_192' title="bbox 363 11342 1372 11387; baseline 0 -12; x_size 44; x_descenders 11; x_ascenders 13"><span class='ocrx_word' id='word_1_1209' title='bbox 363 11345 697 11386; x_wconf 91' lang='eng' dir='ltr'>repelting-slippage</span> <span class='ocrx_word' id='word_1_1210' title='bbox 719 11345 789 11375; x_wconf 94' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_1211' title='bbox 810 11345 983 11375; x_wconf 93' lang='eng' dir='ltr'>dark-side</span> <span class='ocrx_word' id='word_1_1212' title='bbox 1004 11342 1016 11387; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1213' title='bbox 1039 11342 1068 11387; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1214' title='bbox 1092 11342 1135 11386; x_wconf 89' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1215' title='bbox 1158 11345 1372 11375; x_wconf 92' lang='eng' dir='ltr'>distributive</span>
</span>
<span class='ocr_line' id='line_1_193' title="bbox 365 11400 1372 11446; baseline 0 -14; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_1216' title='bbox 365 11402 659 11443; x_wconf 81' lang='eng' dir='ltr'>ROM-scrambling</span> <span class='ocrx_word' id='word_1_1217' title='bbox 668 11402 783 11432; x_wconf 93' lang='eng' dir='ltr'>TACT</span> <span class='ocrx_word' id='word_1_1218' title='bbox 795 11402 918 11432; x_wconf 93' lang='eng' dir='ltr'>tactics.</span> <span class='ocrx_word' id='word_1_1219' title='bbox 934 11401 963 11445; x_wconf 94' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1220' title='bbox 979 11400 1005 11444; x_wconf 93' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1221' title='bbox 1019 11400 1031 11444; x_wconf 93' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1222' title='bbox 1048 11400 1060 11444; x_wconf 96' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1223' title='bbox 1074 11400 1086 11444; x_wconf 93' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1224' title='bbox 1102 11400 1114 11444; x_wconf 96' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1225' title='bbox 1128 11400 1153 11444; x_wconf 92' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1226' title='bbox 1171 11400 1199 11444; x_wconf 93' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1227' title='bbox 1213 11400 1241 11444; x_wconf 92' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1228' title='bbox 1257 11401 1269 11446; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1229' title='bbox 1283 11401 1311 11446; x_wconf 87' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1230' title='bbox 1326 11401 1372 11445; x_wconf 91' lang='eng'>(((</span>
</span>
<span class='ocr_line' id='line_1_194' title="bbox 364 11458 1372 11505; baseline 0 -1; x_size 60.254128; x_descenders 16.254128; x_ascenders 15.112474"><span class='ocrx_word' id='word_1_1231' title='bbox 364 11458 1195 11505; x_wconf 85' lang='eng'>)()))((((()((()))(((()())())(()))(((()</span> <span class='ocrx_word' id='word_1_1232' title='bbox 1212 11459 1372 11504; x_wconf 85' lang='eng'>(())((()</span>
</span>
<span class='ocr_line' id='line_1_195' title="bbox 364 11517 1372 11563; baseline -0.001 0; x_size 60.254128; x_descenders 16.254128; x_ascenders 15.112474"><span class='ocrx_word' id='word_1_1233' title='bbox 364 11517 927 11563; x_wconf 84' lang='eng'>((()))(()))))((())))((()(</span> <span class='ocrx_word' id='word_1_1234' title='bbox 970 11517 1372 11563; x_wconf 85' lang='eng'>()))(()))((())(((</span>
</span>
<span class='ocr_line' id='line_1_196' title="bbox 364 11574 1370 11622; baseline 0 -1; x_size 60.254128; x_descenders 16.254128; x_ascenders 15.112474"><span class='ocrx_word' id='word_1_1235' title='bbox 364 11577 497 11621; x_wconf 63' lang='eng' dir='ltr'>()ZCr0</span> <span class='ocrx_word' id='word_1_1236' title='bbox 509 11575 689 11619; x_wconf 69' lang='eng' dir='ltr'>Program)</span> <span class='ocrx_word' id='word_1_1237' title='bbox 706 11574 751 11618; x_wconf 85' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_1238' title='bbox 766 11575 812 11620; x_wconf 88' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1239' title='bbox 828 11575 918 11620; x_wconf 85' lang='eng'>(((()</span> <span class='ocrx_word' id='word_1_1240' title='bbox 1006 11576 1062 11621; x_wconf 72' lang='eng'>0)</span> <span class='ocrx_word' id='word_1_1241' title='bbox 1078 11577 1090 11621; x_wconf 93' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1242' title='bbox 1106 11577 1118 11621; x_wconf 93' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1243' title='bbox 1133 11576 1178 11621; x_wconf 85' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1244' title='bbox 1194 11576 1282 11622; x_wconf 86' lang='eng'>(((()</span> <span class='ocrx_word' id='word_1_1245' title='bbox 1299 11576 1328 11621; x_wconf 87' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1246' title='bbox 1343 11577 1370 11621; x_wconf 89' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_197' title="bbox 365 11634 1372 11679; baseline 0 -1; x_size 60.254128; x_descenders 16.254128; x_ascenders 15.112474"><span class='ocrx_word' id='word_1_1247' title='bbox 365 11635 442 11679; x_wconf 88' lang='eng'>(((((</span> <span class='ocrx_word' id='word_1_1248' title='bbox 456 11635 468 11679; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1249' title='bbox 484 11634 521 11679; x_wconf 83' lang='eng'>()</span> <span class='ocrx_word' id='word_1_1250' title='bbox 537 11634 683 11678; x_wconf 81' lang='eng'>)()(())((</span> <span class='ocrx_word' id='word_1_1251' title='bbox 698 11634 737 11678; x_wconf 84' lang='eng'>()</span> <span class='ocrx_word' id='word_1_1252' title='bbox 753 11634 766 11678; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1253' title='bbox 781 11634 828 11678; x_wconf 61' lang='eng' dir='ltr'>(H</span> <span class='ocrx_word' id='word_1_1254' title='bbox 842 11634 855 11663; x_wconf 64' lang='eng'></span> <span class='ocrx_word' id='word_1_1255' title='bbox 869 11634 927 11678; x_wconf 55' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1256' title='bbox 1004 11634 1051 11678; x_wconf 56' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1257' title='bbox 1068 11634 1081 11678; x_wconf 80' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1258' title='bbox 1096 11634 1150 11678; x_wconf 70' lang='eng' dir='ltr'>(O</span> <span class='ocrx_word' id='word_1_1259' title='bbox 1189 11634 1217 11678; x_wconf 77' lang='eng'>0</span> <span class='ocrx_word' id='word_1_1260' title='bbox 1255 11634 1316 11679; x_wconf 87' lang='eng'>()))</span> <span class='ocrx_word' id='word_1_1261' title='bbox 1333 11634 1372 11679; x_wconf 95' lang='eng'>((</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_6' title="bbox 1005 11664 1370 11795">
<p class='ocr_par' dir='ltr' id='par_1_28' title="bbox 801 11664 1370 11795">
<span class='ocr_line' id='line_1_198' title="bbox 1005 11664 1370 11795; baseline 0 -58; x_size 80.41758; x_descenders 7.4175825; x_ascenders 28"><span class='ocrx_word' id='word_1_1262' title='bbox 1005 11664 1370 11795; x_wconf 49' lang='eng'>§5&gt;((»&gt;&lt;(&lt;&lt;&gt;&lt;(&gt;&gt;</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_7' title="bbox 364 11518 1371 11796">
<p class='ocr_par' dir='ltr' id='par_1_29' title="bbox 931 11518 943 11562">
<span class='ocr_line' id='line_1_199' title="bbox 931 11518 943 11562; baseline 0 0; x_size 59.826088; x_descenders 14.956522; x_ascenders 14.956522"><span class='ocrx_word' id='word_1_1263' title='bbox 931 11518 943 11562; x_wconf 93' lang='eng'>)</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_30' title="bbox 935 11576 947 11620">
<span class='ocr_line' id='line_1_200' title="bbox 935 11576 947 11620; baseline 0 0; x_size 59.826088; x_descenders 14.956522; x_ascenders 14.956522"><span class='ocrx_word' id='word_1_1264' title='bbox 935 11576 947 11620; x_wconf 95' lang='eng'>(</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_31' title="bbox 933 11633 946 11678">
<span class='ocr_line' id='line_1_201' title="bbox 933 11633 946 11678; baseline 0 0; x_size 59.826088; x_descenders 14.956522; x_ascenders 14.956522"><span class='ocrx_word' id='word_1_1265' title='bbox 933 11633 946 11678; x_wconf 88' lang='eng'>(</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_32' title="bbox 364 11692 1371 11796">
<span class='ocr_line' id='line_1_202' title="bbox 364 11692 948 11738; baseline -0.003 0; x_size 59.826088; x_descenders 14.956522; x_ascenders 14.956522"><span class='ocrx_word' id='word_1_1266' title='bbox 364 11692 948 11738; x_wconf 85' lang='eng'><a href="home/doorway.html">))((())(((())((()))(((((</a>)</span>
</span>
<span class='ocr_line' id='line_1_203' title="bbox 1054 11751 1371 11796; baseline 0 0; x_size 59.826088; x_descenders 14.956522; x_ascenders 14.956522"><span class='ocrx_word' id='word_1_1267' title='bbox 1054 11751 1371 11796; x_wconf 84' lang='eng'>()))(()))((())</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_8' title="bbox 364 11575 1372 12264">
<p class='ocr_par' dir='ltr' id='par_1_33' title="bbox 364 11575 1372 12264">
<span class='ocr_line' id='line_1_204' title="bbox 962 11575 990 11619; baseline 0 0; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1268' title='bbox 962 11575 990 11619; x_wconf 89' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_205' title="bbox 959 11634 990 11678; baseline 0 0; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1269' title='bbox 959 11634 990 11678; x_wconf 85' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_206' title="bbox 908 11692 991 11737; baseline -0.012 0; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1270' title='bbox 908 11693 920 11737; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1271' title='bbox 963 11692 991 11736; x_wconf 89' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_207' title="bbox 365 11750 1004 11796; baseline 0 -1; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1272' title='bbox 365 11750 1004 11796; x_wconf 83' lang='eng'>((((()())()(())((())((())))())(</span>
</span>
<span class='ocr_line' id='line_1_208' title="bbox 365 11809 1371 11855; baseline 0 -1; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1273' title='bbox 365 11809 1371 11855; x_wconf 69' lang='eng' dir='ltr'>(((())((()))(((()(D())(()))(((()(())((((()())</span>
</span>
<span class='ocr_line' id='line_1_209' title="bbox 365 11867 1371 11913; baseline -0.001 0; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1274' title='bbox 365 11867 1210 11913; x_wconf 74' lang='eng'>()(())((())((())))())))((())))0))))((()</span> <span class='ocrx_word' id='word_1_1275' title='bbox 1246 11867 1274 11911; x_wconf 82' lang='eng'>0</span> <span class='ocrx_word' id='word_1_1276' title='bbox 1309 11867 1371 11912; x_wconf 85' lang='eng'>()))</span>
</span>
<span class='ocr_line' id='line_1_210' title="bbox 365 11925 1371 11971; baseline 0 -1; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1277' title='bbox 365 11925 1371 11971; x_wconf 87' lang='eng'>(()))((())(((())((()))(((()())())(()))(((()</span>
</span>
<span class='ocr_line' id='line_1_211' title="bbox 365 11984 1370 12030; baseline 0 -1; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1278' title='bbox 365 11986 393 12030; x_wconf 92' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1279' title='bbox 407 11985 435 12030; x_wconf 85' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1280' title='bbox 452 11985 528 12029; x_wconf 88' lang='eng'>(((((</span> <span class='ocrx_word' id='word_1_1281' title='bbox 542 11985 555 12029; x_wconf 91' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1282' title='bbox 570 11985 582 12030; x_wconf 96' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1283' title='bbox 597 11986 609 12030; x_wconf 89' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1284' title='bbox 624 11985 636 12029; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1285' title='bbox 654 11985 682 12029; x_wconf 88' lang='eng'>()</span> <span class='ocrx_word' id='word_1_1286' title='bbox 699 11985 778 12030; x_wconf 85' lang='eng'>(())(</span> <span class='ocrx_word' id='word_1_1287' title='bbox 794 11985 806 12030; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1288' title='bbox 822 11985 834 12030; x_wconf 96' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1289' title='bbox 850 11984 878 12029; x_wconf 89' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1290' title='bbox 895 11984 941 12030; x_wconf 87' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_1291' title='bbox 956 11986 968 12030; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1292' title='bbox 985 11984 1013 12029; x_wconf 84' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1293' title='bbox 1029 11985 1059 12030; x_wconf 85' lang='eng'>)(</span> <span class='ocrx_word' id='word_1_1294' title='bbox 1074 11985 1102 12029; x_wconf 89' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1295' title='bbox 1119 11984 1147 12029; x_wconf 90' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1296' title='bbox 1164 11985 1210 12030; x_wconf 87' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_1297' title='bbox 1225 11986 1237 12030; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1298' title='bbox 1253 11985 1281 12029; x_wconf 88' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1299' title='bbox 1297 11985 1327 12030; x_wconf 87' lang='eng'>)(</span> <span class='ocrx_word' id='word_1_1300' title='bbox 1342 11985 1370 12029; x_wconf 88' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_212' title="bbox 364 12042 1372 12089; baseline -0.001 0; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1301' title='bbox 364 12043 508 12089; x_wconf 84' lang='eng'>)))((()</span> <span class='ocrx_word' id='word_1_1302' title='bbox 548 12043 575 12088; x_wconf 85' lang='eng'>0</span> <span class='ocrx_word' id='word_1_1303' title='bbox 614 12042 1372 12089; x_wconf 86' lang='eng'>()))(()))((())(((())((()))(((()(</span>
</span>
<span class='ocr_line' id='line_1_213' title="bbox 365 12101 1371 12147; baseline 0 0; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1304' title='bbox 365 12101 1371 12147; x_wconf 66' lang='eng' dir='ltr'>D())(()))(((()(())((((()())()(())((())((())))(</span>
</span>
<span class='ocr_line' id='line_1_214' title="bbox 366 12159 1371 12206; baseline 0 -1; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1305' title='bbox 366 12160 435 12205; x_wconf 86' lang='eng'>))0</span> <span class='ocrx_word' id='word_1_1306' title='bbox 462 12159 1371 12206; x_wconf 76' lang='eng'>()))(0))((())(((())((()))(((()())())((</span>
</span>
<span class='ocr_line' id='line_1_215' title="bbox 366 12218 1214 12264; baseline 0 -1; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1307' title='bbox 366 12218 1214 12264; x_wconf 74' lang='eng'>)))(((()(())((((()())()(())((()))))(0))</span>
</span>
</p>
</div>
</div>
<!-- <script type="text/javascript" src="../scripts/drag.js"></script> -->
<script type="text/javascript">
var l = $('.ocr_line');
l.each( function(x){ this.title = "hypervirus"; });
var p = $('.ocr_par');
p.each( function(x){ this.title = "hypervirus"; });
var c = $('.ocr_carea');
c.each( function(x){ this.title = "hypervirus"; });
var ww = $('.ocrx_word');
ww.each( function(x){
let t = $(this).attr('title').split(" "),
left = parseInt(t[1]),
top = parseInt(t[2]);
console.log('title = ', left , top);
left *= 0.4;
top *= 0.5;
// this.style.left = left + 'px';
// this.style.top = top + 'px';
this.style.color = "blue;"
this.title = "hypervirus";
});
//store all class 'ocr_line' in 'lines'
var lines = document.querySelectorAll(".ocr_line");
//loop through each element in 'lines'
for (var i = 0; i < lines.length; i++){
var line = lines[i];
var words = line.querySelectorAll(".ocrx_word");
for (var e = 0; e < words.length; e++){
var span = words[e];
span.classList.add("draggable");
span.title = "hypervirus";
}
}
window.setInterval( function(){
// console.log('interval', ww);
var ra = Math.floor(ww.size()*Math.random());
var w = ww.get(ra);
// console.log(w);
var col = ["b", "w"];
var fs =["9px","15px"];
$(w).css('visibility', 'visible');
$(w).removeClass('ocrx_word');
$(w).addClass(col[Math.floor(Math.random()*col.length)]);
}, 150);
// ------------ DRAG ------------
$( function() {
$( ".draggable" ).draggable(
//{ containment: [-1300,-750,1800,1250] }
);
});
// // ------------ ZOOM -------------
// function zoom(event) {
// event.preventDefault();
// scale += event.deltaY * -0.01;
// scale = Math.min(Math.max(.125, scale), 4);
// el.style.transform = `scale(${scale})`;
// }
// let scale = 1;
// const el = document.querySelector('body');
// el.onwheel = zoom;
// CURSOR GRAB AND RELEASE
$('.draggable').on("mousedown",function(){
$('.draggable').css('cursor', 'grabbing');
}).on("mouseup mouseleave",function(){
$('.draggable').css('cursor', 'grab');
});
$(document).ready(function(){
$(".ocrx_word").hover(function(){
var n = $("this").css("color");
$(this).animate({color: "white"});
$(this).animate({fontSize: "20px"});
$(this).animate({marginLeft: "-20px"});
$(this).animate({letterSpacing: "20px"});
}, function(){
$(this).animate({color: "black"});
$(this).animate({fontSize: "15px"});
$(this).animate({marginLeft: "0px"});
$(this).animate({letterSpacing: "0px"});
});
});
</script>
</body>
</html>

@ -0,0 +1,673 @@
<!DOCTYPE html>
<html>
<head>
<meta http-equiv="content-type" content="text/html; charset=UTF-8">
<title> @@@ilinχ </title>
<script src="https://code.jquery.com/jquery-1.12.4.js"></script>
<script src="https://code.jquery.com/ui/1.12.1/jquery-ui.js"></script>
<style type="text/css">
body {
background-color: black;
font-family: mono;
overflow: hidden;
}
#page_1{
width: 2000px;
height: 8000px;
cursor: move;
}
.ocrx_word{
cursor: grab;
}
.b {color: red !important;}
.w {color: white !important;}
</style>
</head>
<body>
<div class='ocr_page draggable' id='page_1' title='image "hypervirus2-01.tif"; bbox 0 0 1749 12409; ppageno 0'>
<div class='ocr_carea' id='block_1_1' title="bbox 78 91 352 146">
<p class='ocr_par' dir='ltr' id='par_1_1' title="bbox 78 91 352 146">
<span class='ocr_line' id='line_1_1' title="bbox 78 91 352 146; baseline 0 -12; x_size 55; x_descenders 12; x_ascenders 13"><span class='ocrx_word' id='word_1_1' title='bbox 78 91 352 146; x_wconf 84' lang='eng' dir='ltr' style="font-size: 30px; color: white;"><b>Hypervirus</b></span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_2' title="bbox 348 247 1379 9101">
<p class='ocr_par' dir='ltr' id='par_1_2' title="bbox 349 247 1358 465">
<span class='ocr_line' id='line_1_2' title="bbox 350 247 1358 288; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_2' title='bbox 350 247 529 277; x_wconf 84' lang='eng' dir='ltr'>Whatever</span> <span class='ocrx_word' id='word_1_3' title='bbox 547 247 832 288; x_wconf 97' lang='eng' dir='ltr'>ultramodernity</span> <span class='ocrx_word' id='word_1_4' title='bbox 850 247 963 287; x_wconf 85' lang='eng' dir='ltr'>places</span> <span class='ocrx_word' id='word_1_5' title='bbox 983 247 1090 277; x_wconf 98' lang='eng' dir='ltr'>under</span> <span class='ocrx_word' id='word_1_6' title='bbox 1108 247 1163 277; x_wconf 85' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_7' title='bbox 1182 247 1358 277; x_wconf 87' lang='eng' dir='ltr'>dominion</span>
</span>
<span class='ocr_line' id='line_1_3' title="bbox 350 306 1358 347; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_8' title='bbox 350 306 389 336; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_9' title='bbox 401 306 494 347; x_wconf 85' lang='eng' dir='ltr'>signs</span> <span class='ocrx_word' id='word_1_10' title='bbox 509 306 782 347; x_wconf 97' lang='eng' dir='ltr'>postmodernity</span> <span class='ocrx_word' id='word_1_11' title='bbox 799 306 949 336; x_wconf 85' lang='eng' dir='ltr'>subverts</span> <span class='ocrx_word' id='word_1_12' title='bbox 966 306 1042 336; x_wconf 92' lang='eng' dir='ltr'>with</span> <span class='ocrx_word' id='word_1_13' title='bbox 1059 306 1156 336; x_wconf 89' lang='eng' dir='ltr'>virus.</span> <span class='ocrx_word' id='word_1_14' title='bbox 1171 307 1218 336; x_wconf 93' lang='eng' dir='ltr'>As</span> <span class='ocrx_word' id='word_1_15' title='bbox 1234 306 1358 336; x_wconf 90' lang='eng' dir='ltr'>culture</span>
</span>
<span class='ocr_line' id='line_1_4' title="bbox 350 363 1358 407; baseline 0 -13; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_16' title='bbox 350 364 504 405; x_wconf 84' lang='eng' dir='ltr'>migrates</span> <span class='ocrx_word' id='word_1_17' title='bbox 518 364 590 394; x_wconf 98' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_18' title='bbox 603 364 908 404; x_wconf 88' lang='eng' dir='ltr'>partial-machines</span> <span class='ocrx_word' id='word_1_19' title='bbox 923 363 1068 407; x_wconf 93' lang='eng' dir='ltr'>(lacking</span> <span class='ocrx_word' id='word_1_20' title='bbox 1082 374 1121 394; x_wconf 95' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_21' title='bbox 1136 370 1358 394; x_wconf 88' lang='eng' dir='ltr'>autonomous</span>
</span>
<span class='ocr_line' id='line_1_5' title="bbox 349 421 1357 465; baseline 0 -12; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_22' title='bbox 349 423 575 463; x_wconf 91' lang='eng' dir='ltr'>reproductive</span> <span class='ocrx_word' id='word_1_23' title='bbox 586 421 719 465; x_wconf 89' lang='eng' dir='ltr'>system)</span> <span class='ocrx_word' id='word_1_24' title='bbox 731 423 897 453; x_wconf 90' lang='eng' dir='ltr'>semiotics</span> <span class='ocrx_word' id='word_1_25' title='bbox 905 423 1052 453; x_wconf 94' lang='eng' dir='ltr'>subsides</span> <span class='ocrx_word' id='word_1_26' title='bbox 1060 423 1129 453; x_wconf 98' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_27' title='bbox 1139 423 1357 453; x_wconf 93' lang='eng' dir='ltr'>virotechnics.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_3' title="bbox 348 489 1358 813">
<span class='ocr_line' id='line_1_6' title="bbox 414 489 1356 511; baseline 0.001 -1; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_28' title='bbox 414 489 1356 511; x_wconf 96' lang='eng'>0010101011011100101101010101001100100010001010</span>
</span>
<span class='ocr_line' id='line_1_7' title="bbox 350 547 1357 569; baseline 0.001 -1; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_29' title='bbox 350 547 1357 569; x_wconf 96' lang='eng'>1011101000010101100101001010001100100111001000100</span>
</span>
<span class='ocr_line' id='line_1_8' title="bbox 350 606 1355 628; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_30' title='bbox 350 606 1355 628; x_wconf 94' lang='eng'>000000010011111100010010010101010100001000010101</span>
</span>
<span class='ocr_line' id='line_1_9' title="bbox 350 665 1354 687; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_31' title='bbox 350 665 1354 687; x_wconf 96' lang='eng'>00111111001001000100011010010001010010101111000101</span>
</span>
<span class='ocr_line' id='line_1_10' title="bbox 350 715 1358 756; baseline 0 -11; x_size 40; x_descenders 11; x_ascenders 9"><span class='ocrx_word' id='word_1_32' title='bbox 350 723 735 745; x_wconf 96' lang='eng'>001000010001110100</span> <span class='ocrx_word' id='word_1_33' title='bbox 748 716 807 745; x_wconf 94' lang='eng' dir='ltr'>Yes</span> <span class='ocrx_word' id='word_1_34' title='bbox 822 716 878 745; x_wconf 95' lang='eng' dir='ltr'>No</span> <span class='ocrx_word' id='word_1_35' title='bbox 891 716 950 745; x_wconf 94' lang='eng' dir='ltr'>Yes</span> <span class='ocrx_word' id='word_1_36' title='bbox 965 716 1018 745; x_wconf 96' lang='eng' dir='ltr'>No</span> <span class='ocrx_word' id='word_1_37' title='bbox 1031 716 1090 745; x_wconf 94' lang='eng' dir='ltr'>Yes</span> <span class='ocrx_word' id='word_1_38' title='bbox 1103 716 1162 745; x_wconf 98' lang='eng' dir='ltr'>Yes</span> <span class='ocrx_word' id='word_1_39' title='bbox 1175 716 1230 745; x_wconf 95' lang='eng' dir='ltr'>No</span> <span class='ocrx_word' id='word_1_40' title='bbox 1244 715 1358 756; x_wconf 85' lang='eng' dir='ltr'>longer</span>
</span>
<span class='ocr_line' id='line_1_11' title="bbox 348 773 1145 813; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_41' title='bbox 348 773 437 803; x_wconf 93' lang='eng' dir='ltr'>what</span> <span class='ocrx_word' id='word_1_42' title='bbox 451 773 531 803; x_wconf 98' lang='eng' dir='ltr'>does</span> <span class='ocrx_word' id='word_1_43' title='bbox 545 773 569 803; x_wconf 98' lang='eng' dir='ltr'>it</span> <span class='ocrx_word' id='word_1_44' title='bbox 582 773 700 803; x_wconf 82' lang='eng' dir='ltr'>mean?</span> <span class='ocrx_word' id='word_1_45' title='bbox 714 773 776 803; x_wconf 98' lang='eng' dir='ltr'>but</span> <span class='ocrx_word' id='word_1_46' title='bbox 789 773 866 803; x_wconf 96' lang='eng' dir='ltr'>how</span> <span class='ocrx_word' id='word_1_47' title='bbox 878 773 959 803; x_wconf 98' lang='eng' dir='ltr'>does</span> <span class='ocrx_word' id='word_1_48' title='bbox 973 773 997 803; x_wconf 98' lang='eng' dir='ltr'>it</span> <span class='ocrx_word' id='word_1_49' title='bbox 1010 773 1145 813; x_wconf 80' lang='eng' dir='ltr'>spread?</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_4' title="bbox 349 832 1356 978">
<span class='ocr_line' id='line_1_12' title="bbox 413 832 1356 873; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_50' title='bbox 413 832 548 873; x_wconf 84' lang='eng' dir='ltr'>Having</span> <span class='ocrx_word' id='word_1_51' title='bbox 557 842 603 862; x_wconf 98' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_52' title='bbox 612 842 738 872; x_wconf 97' lang='eng' dir='ltr'>proper</span> <span class='ocrx_word' id='word_1_53' title='bbox 747 832 935 868; x_wconf 79' lang='eng' dir='ltr'>substance,</span> <span class='ocrx_word' id='word_1_54' title='bbox 944 842 983 862; x_wconf 97' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_55' title='bbox 992 842 1082 862; x_wconf 98' lang='eng' dir='ltr'>sense</span> <span class='ocrx_word' id='word_1_56' title='bbox 1092 832 1225 873; x_wconf 88' lang='eng' dir='ltr'>beyond</span> <span class='ocrx_word' id='word_1_57' title='bbox 1234 832 1273 862; x_wconf 98' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_58' title='bbox 1279 842 1314 862; x_wconf 97' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_59' title='bbox 1322 842 1356 862; x_wconf 98' lang='eng' dir='ltr'>re</span>
</span>
<span class='ocr_line' id='line_1_13' title="bbox 349 890 1355 931; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_60' title='bbox 349 900 382 920; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_61' title='bbox 393 890 598 930; x_wconf 79' lang='eng' dir='ltr'>replication,</span> <span class='ocrx_word' id='word_1_62' title='bbox 608 900 665 931; x_wconf 89' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_63' title='bbox 676 900 723 920; x_wconf 98' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_64' title='bbox 734 900 779 920; x_wconf 98' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_65' title='bbox 790 900 891 931; x_wconf 98' lang='eng' dir='ltr'>usage</span> <span class='ocrx_word' id='word_1_66' title='bbox 902 890 941 920; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_67' title='bbox 945 890 1033 920; x_wconf 96' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_68' title='bbox 1043 890 1068 920; x_wconf 98' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_69' title='bbox 1076 900 1154 920; x_wconf 98' lang='eng' dir='ltr'>ever</span> <span class='ocrx_word' id='word_1_70' title='bbox 1162 890 1355 930; x_wconf 92' lang='eng' dir='ltr'>metaphori-</span>
</span>
<span class='ocr_line' id='line_1_14' title="bbox 350 946 1065 978; baseline 0 0; x_size 42.988487; x_descenders 10.988487; x_ascenders 12"><span class='ocrx_word' id='word_1_71' title='bbox 350 948 408 978; x_wconf 91' lang='eng' dir='ltr'>cal.</span> <span class='ocrx_word' id='word_1_72' title='bbox 423 949 490 978; x_wconf 92' lang='eng' dir='ltr'>The</span> <span class='ocrx_word' id='word_1_73' title='bbox 502 948 596 978; x_wconf 97' lang='eng' dir='ltr'>word</span> <span class='ocrx_word' id='word_1_74' title='bbox 610 946 719 978; x_wconf 73' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_75' title='bbox 734 948 761 978; x_wconf 99' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_76' title='bbox 774 958 866 978; x_wconf 97' lang='eng' dir='ltr'>more</span> <span class='ocrx_word' id='word_1_77' title='bbox 879 958 912 978; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_78' title='bbox 925 958 957 978; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_79' title='bbox 969 948 1065 978; x_wconf 89' lang='eng' dir='ltr'>virus.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_5' title="bbox 348 1006 1355 1281">
<span class='ocr_line' id='line_1_15' title="bbox 414 1006 1355 1036; baseline 0 0; x_size 40.988487; x_descenders 10.988487; x_ascenders 10"><span class='ocrx_word' id='word_1_80' title='bbox 414 1006 631 1036; x_wconf 92' lang='eng' dir='ltr'>Postmodern</span> <span class='ocrx_word' id='word_1_81' title='bbox 641 1006 769 1036; x_wconf 99' lang='eng' dir='ltr'>culture</span> <span class='ocrx_word' id='word_1_82' title='bbox 778 1016 813 1036; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_83' title='bbox 820 1016 855 1036; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_84' title='bbox 864 1006 1074 1036; x_wconf 89' lang='eng' dir='ltr'>chatters-out</span> <span class='ocrx_word' id='word_1_85' title='bbox 1082 1006 1168 1036; x_wconf 89' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_86' title='bbox 1177 1006 1262 1036; x_wconf 94' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_87' title='bbox 1269 1006 1355 1036; x_wconf 94' lang='eng' dir='ltr'>virus</span>
</span>
<span class='ocr_line' id='line_1_16' title="bbox 348 1064 1353 1094; baseline 0 0; x_size 42.087334; x_descenders 12.087336; x_ascenders 8"><span class='ocrx_word' id='word_1_88' title='bbox 348 1064 437 1094; x_wconf 91' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_89' title='bbox 453 1064 543 1094; x_wconf 91' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_90' title='bbox 560 1064 650 1094; x_wconf 92' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_91' title='bbox 668 1064 758 1094; x_wconf 92' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_92' title='bbox 776 1064 866 1094; x_wconf 92' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_93' title='bbox 883 1064 971 1094; x_wconf 92' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_94' title='bbox 987 1064 1075 1094; x_wconf 92' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_95' title='bbox 1092 1072 1353 1094; x_wconf 92' lang='eng'>0110001001001</span>
</span>
<span class='ocr_line' id='line_1_17' title="bbox 349 1120 1354 1165; baseline 0 -13; x_size 44.087334; x_descenders 12.087336; x_ascenders 10"><span class='ocrx_word' id='word_1_96' title='bbox 349 1130 985 1153; x_wconf 97' lang='eng'>011010010010110010010010010010</span> <span class='ocrx_word' id='word_1_97' title='bbox 1005 1120 1113 1152; x_wconf 87' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_98' title='bbox 1134 1121 1354 1165; x_wconf 88' lang='eng' dir='ltr'>(viroductile,</span>
</span>
<span class='ocr_line' id='line_1_18' title="bbox 348 1180 1355 1221; baseline 0 -11; x_size 36; x_descenders 6; x_ascenders 10"><span class='ocrx_word' id='word_1_99' title='bbox 348 1180 526 1221; x_wconf 97' lang='eng' dir='ltr'>virogenic,</span> <span class='ocrx_word' id='word_1_100' title='bbox 544 1180 900 1220; x_wconf 98' lang='eng' dir='ltr'>immunosuppressor</span> <span class='ocrx_word' id='word_1_101' title='bbox 913 1180 983 1210; x_wconf 98' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_102' title='bbox 998 1180 1062 1210; x_wconf 98' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_103' title='bbox 1079 1190 1125 1216; x_wconf 99' lang='eng' dir='ltr'>or,</span> <span class='ocrx_word' id='word_1_104' title='bbox 1143 1186 1248 1216; x_wconf 92' lang='eng' dir='ltr'>meta-,</span> <span class='ocrx_word' id='word_1_105' title='bbox 1264 1190 1300 1210; x_wconf 91' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_106' title='bbox 1316 1190 1355 1210; x_wconf 97' lang='eng' dir='ltr'>or</span>
</span>
<span class='ocr_line' id='line_1_19' title="bbox 349 1237 725 1281; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_107' title='bbox 349 1239 417 1269; x_wconf 98' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_108' title='bbox 429 1249 467 1269; x_wconf 98' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_109' title='bbox 479 1237 611 1281; x_wconf 89' lang='eng' dir='ltr'>hyper-)</span> <span class='ocrx_word' id='word_1_110' title='bbox 625 1239 725 1269; x_wconf 92' lang='eng' dir='ltr'>virus.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_6' title="bbox 353 1304 1364 1403">
<span class='ocr_line' id='line_1_20' title="bbox 353 1304 1364 1345; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 9"><span class='ocrx_word' id='word_1_111' title='bbox 353 1313 943 1334; x_wconf 89' lang='eng'>10110010010011101100001001001.</span> <span class='ocrx_word' id='word_1_112' title='bbox 955 1304 1146 1345; x_wconf 93' lang='eng' dir='ltr'>hypervirus</span> <span class='ocrx_word' id='word_1_113' title='bbox 1156 1310 1224 1334; x_wconf 94' lang='eng' dir='ltr'>eats</span> <span class='ocrx_word' id='word_1_114' title='bbox 1236 1304 1287 1334; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_115' title='bbox 1298 1304 1364 1334; x_wconf 92' lang='eng' dir='ltr'>end</span>
</span>
<span class='ocr_line' id='line_1_21' title="bbox 353 1362 524 1403; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_116' title='bbox 353 1362 391 1392; x_wconf 98' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_117' title='bbox 402 1362 524 1403; x_wconf 94' lang='eng' dir='ltr'>history</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_7' title="bbox 353 1429 1365 1857">
<span class='ocr_line' id='line_1_22' title="bbox 415 1429 1365 1450; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_118' title='bbox 415 1429 1365 1450; x_wconf 78' lang='eng'>00100100100010]1110100001001101010101010101000</span>
</span>
<span class='ocr_line' id='line_1_23' title="bbox 353 1487 1363 1508; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_119' title='bbox 353 1487 1363 1508; x_wconf 89' lang='eng'>10011010100100101001001010010110100100101111010001</span>
</span>
<span class='ocr_line' id='line_1_24' title="bbox 353 1545 1365 1566; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_120' title='bbox 353 1545 1365 1566; x_wconf 89' lang='eng'>0101010101010100101010010101101010010000001000101</span>
</span>
<span class='ocr_line' id='line_1_25' title="bbox 354 1603 1365 1624; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_121' title='bbox 354 1603 1365 1624; x_wconf 89' lang='eng'>1101010010010101001010010010101010010001001001001</span>
</span>
<span class='ocr_line' id='line_1_26' title="bbox 353 1661 1364 1682; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_122' title='bbox 353 1661 1364 1682; x_wconf 89' lang='eng'>00100100101001001010110101001001001010110101010101</span>
</span>
<span class='ocr_line' id='line_1_27' title="bbox 353 1719 1365 1740; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_123' title='bbox 353 1719 1365 1740; x_wconf 78' lang='eng'>0101111010000100]1010101010101000100110110101010100</span>
</span>
<span class='ocr_line' id='line_1_28' title="bbox 355 1776 1364 1798; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_124' title='bbox 355 1776 1364 1798; x_wconf 86' lang='eng'>11001000100010101011101000010101100101001010001100</span>
</span>
<span class='ocr_line' id='line_1_29' title="bbox 354 1836 1363 1857; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_125' title='bbox 354 1836 1363 1857; x_wconf 89' lang='eng'>1001110010001000000000000100111111100010010010101</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_8' title="bbox 354 1883 1365 2276">
<span class='ocr_line' id='line_1_30' title="bbox 416 1883 1365 1927; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 11"><span class='ocrx_word' id='word_1_126' title='bbox 416 1894 700 1915; x_wconf 90' lang='eng'>0101000010000</span> <span class='ocrx_word' id='word_1_127' title='bbox 723 1883 905 1927; x_wconf 87' lang='eng' dir='ltr'>K-(coding</span> <span class='ocrx_word' id='word_1_128' title='bbox 923 1885 976 1915; x_wconf 90' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_129' title='bbox 994 1883 1253 1927; x_wconf 93' lang='eng' dir='ltr'>cyber)p0sitive</span> <span class='ocrx_word' id='word_1_130' title='bbox 1272 1895 1365 1925; x_wconf 94' lang='eng' dir='ltr'>proc-</span>
</span>
<span class='ocr_line' id='line_1_31' title="bbox 354 1942 1365 1983; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_131' title='bbox 354 1952 438 1972; x_wconf 95' lang='eng' dir='ltr'>esses</span> <span class='ocrx_word' id='word_1_132' title='bbox 454 1942 700 1983; x_wconf 91' lang='eng' dir='ltr'>auto-intensify</span> <span class='ocrx_word' id='word_1_133' title='bbox 714 1942 759 1983; x_wconf 98' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_134' title='bbox 772 1942 959 1983; x_wconf 91' lang='eng' dir='ltr'>occurring.</span> <span class='ocrx_word' id='word_1_135' title='bbox 974 1943 1004 1972; x_wconf 93' lang='eng' dir='ltr'><strong>A</strong></span> <span class='ocrx_word' id='word_1_136' title='bbox 1017 1942 1157 1972; x_wconf 96' lang='eng' dir='ltr'>cultural</span> <span class='ocrx_word' id='word_1_137' title='bbox 1172 1942 1324 1982; x_wconf 89' lang='eng' dir='ltr'>example</span> <span class='ocrx_word' id='word_1_138' title='bbox 1339 1942 1365 1972; x_wconf 99' lang='eng' dir='ltr'>is</span>
</span>
<span class='ocr_line' id='line_1_32' title="bbox 355 2001 1365 2042; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_139' title='bbox 355 2001 451 2042; x_wconf 89' lang='eng' dir='ltr'>hype:</span> <span class='ocrx_word' id='word_1_140' title='bbox 464 2001 621 2042; x_wconf 91' lang='eng' dir='ltr'>products</span> <span class='ocrx_word' id='word_1_141' title='bbox 635 2001 704 2031; x_wconf 96' lang='eng' dir='ltr'>that</span> <span class='ocrx_word' id='word_1_142' title='bbox 714 2002 771 2031; x_wconf 89' lang='eng' dir='ltr'>AT</span> <span class='ocrx_word' id='word_1_143' title='bbox 780 2002 837 2031; x_wconf 89' lang='eng' dir='ltr'>AT</span> <span class='ocrx_word' id='word_1_144' title='bbox 849 2001 942 2031; x_wconf 95' lang='eng' dir='ltr'>trade</span> <span class='ocrx_word' id='word_1_145' title='bbox 953 2011 999 2031; x_wconf 98' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_146' title='bbox 1012 2001 1100 2031; x_wconf 92' lang='eng' dir='ltr'>what</span> <span class='ocrx_word' id='word_1_147' title='bbox 1112 2001 1188 2042; x_wconf 97' lang='eng' dir='ltr'>they</span> <span class='ocrx_word' id='word_1_148' title='bbox 1199 2001 1263 2031; x_wconf 98' lang='eng' dir='ltr'>will</span> <span class='ocrx_word' id='word_1_149' title='bbox 1277 2001 1319 2031; x_wconf 98' lang='eng' dir='ltr'>be</span> <span class='ocrx_word' id='word_1_150' title='bbox 1331 2001 1365 2031; x_wconf 98' lang='eng' dir='ltr'>in</span>
</span>
<span class='ocr_line' id='line_1_33' title="bbox 355 2059 1365 2096; baseline 0 -7; x_size 37; x_descenders 7; x_ascenders 10"><span class='ocrx_word' id='word_1_151' title='bbox 355 2059 408 2089; x_wconf 98' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_152' title='bbox 421 2059 538 2096; x_wconf 87' lang='eng' dir='ltr'>future,</span> <span class='ocrx_word' id='word_1_153' title='bbox 550 2059 600 2089; x_wconf 94' lang='eng' dir='ltr'>vir</span> <span class='ocrx_word' id='word_1_154' title='bbox 608 2059 729 2089; x_wconf 93' lang='eng' dir='ltr'>virtual</span> <span class='ocrx_word' id='word_1_155' title='bbox 741 2059 875 2089; x_wconf 90' lang='eng' dir='ltr'>fashion</span> <span class='ocrx_word' id='word_1_156' title='bbox 888 2069 933 2089; x_wconf 98' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_157' title='bbox 945 2059 1002 2096; x_wconf 84' lang='eng' dir='ltr'>off,</span> <span class='ocrx_word' id='word_1_158' title='bbox 1016 2059 1190 2089; x_wconf 92' lang='eng' dir='ltr'>imminent</span> <span class='ocrx_word' id='word_1_159' title='bbox 1204 2059 1365 2090; x_wconf 91' lang='eng' dir='ltr'>technical</span>
</span>
<span class='ocr_line' id='line_1_34' title="bbox 355 2117 1364 2158; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_160' title='bbox 355 2117 535 2154; x_wconf 89' lang='eng' dir='ltr'>standards,</span> <span class='ocrx_word' id='word_1_161' title='bbox 545 2117 776 2158; x_wconf 92' lang='eng' dir='ltr'>self-fulfilling</span> <span class='ocrx_word' id='word_1_162' title='bbox 784 2117 982 2157; x_wconf 94' lang='eng' dir='ltr'>prophecies</span> <span class='ocrx_word' id='word_1_163' title='bbox 993 2117 1060 2147; x_wconf 95' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_164' title='bbox 1069 2117 1136 2147; x_wconf 93' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_165' title='bbox 1145 2127 1183 2147; x_wconf 98' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_166' title='bbox 1192 2117 1257 2147; x_wconf 95' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_167' title='bbox 1268 2117 1364 2147; x_wconf 92' lang='eng' dir='ltr'>artifi-</span>
</span>
<span class='ocr_line' id='line_1_35' title="bbox 354 2176 1365 2217; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_168' title='bbox 354 2176 413 2207; x_wconf 91' lang='eng' dir='ltr'>cial</span> <span class='ocrx_word' id='word_1_169' title='bbox 422 2176 582 2206; x_wconf 88' lang='eng' dir='ltr'>destinies.</span> <span class='ocrx_word' id='word_1_170' title='bbox 592 2176 818 2217; x_wconf 93' lang='eng' dir='ltr'>Anticipating</span> <span class='ocrx_word' id='word_1_171' title='bbox 826 2186 844 2206; x_wconf 99' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_172' title='bbox 856 2176 949 2206; x_wconf 95' lang='eng' dir='ltr'>trend</span> <span class='ocrx_word' id='word_1_173' title='bbox 958 2176 1024 2206; x_wconf 95' lang='eng' dir='ltr'>end</span> <span class='ocrx_word' id='word_1_174' title='bbox 1034 2176 1099 2206; x_wconf 93' lang='eng' dir='ltr'>end</span> <span class='ocrx_word' id='word_1_175' title='bbox 1107 2176 1173 2206; x_wconf 95' lang='eng' dir='ltr'>end</span> <span class='ocrx_word' id='word_1_176' title='bbox 1179 2176 1270 2206; x_wconf 99' lang='eng' dir='ltr'>ACC</span> <span class='ocrx_word' id='word_1_177' title='bbox 1277 2176 1365 2206; x_wconf 99' lang='eng' dir='ltr'>ACC</span>
</span>
<span class='ocr_line' id='line_1_36' title="bbox 355 2232 1328 2276; baseline 0 -12; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_178' title='bbox 355 2234 544 2265; x_wconf 91' lang='eng' dir='ltr'>accelerates</span> <span class='ocrx_word' id='word_1_179' title='bbox 556 2234 579 2264; x_wconf 91' lang='eng' dir='ltr'>it</span> <span class='ocrx_word' id='word_1_180' title='bbox 595 2233 718 2276; x_wconf 85' lang='eng' dir='ltr'>(which</span> <span class='ocrx_word' id='word_1_181' title='bbox 732 2234 756 2264; x_wconf 98' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_182' title='bbox 770 2234 804 2264; x_wconf 98' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_183' title='bbox 818 2234 910 2264; x_wconf 82' lang='eng' dir='ltr'>itself</span> <span class='ocrx_word' id='word_1_184' title='bbox 918 2244 936 2264; x_wconf 99' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_185' title='bbox 951 2244 983 2264; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_186' title='bbox 997 2244 1030 2264; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_187' title='bbox 1044 2234 1204 2264; x_wconf 89' lang='eng' dir='ltr'>recursive</span> <span class='ocrx_word' id='word_1_188' title='bbox 1218 2232 1328 2276; x_wconf 91' lang='eng' dir='ltr'>trend)</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_9' title="bbox 355 2293 1367 2451">
<span class='ocr_line' id='line_1_37' title="bbox 416 2293 1365 2334; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_189' title='bbox 416 2293 554 2334; x_wconf 94' lang='eng' dir='ltr'>Hyping</span> <span class='ocrx_word' id='word_1_190' title='bbox 569 2293 731 2333; x_wconf 94' lang='eng' dir='ltr'>collapses</span> <span class='ocrx_word' id='word_1_191' title='bbox 751 2302 786 2323; x_wconf 87' lang='eng' dir='ltr'>SF</span> <span class='ocrx_word' id='word_1_192' title='bbox 808 2293 878 2323; x_wconf 98' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_193' title='bbox 898 2293 1010 2323; x_wconf 95' lang='eng' dir='ltr'>CATA</span> <span class='ocrx_word' id='word_1_194' title='bbox 1027 2293 1137 2323; x_wconf 95' lang='eng' dir='ltr'>CATA</span> <span class='ocrx_word' id='word_1_195' title='bbox 1154 2293 1305 2334; x_wconf 97' lang='eng' dir='ltr'>catalytic</span> <span class='ocrx_word' id='word_1_196' title='bbox 1324 2293 1365 2323; x_wconf 99' lang='eng' dir='ltr'>tic</span>
</span>
<span class='ocr_line' id='line_1_38' title="bbox 355 2351 1367 2392; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_197' title='bbox 355 2351 524 2392; x_wconf 84' lang='eng' dir='ltr'>efficiency,</span> <span class='ocrx_word' id='word_1_198' title='bbox 534 2351 713 2392; x_wconf 93' lang='eng' dir='ltr'>re-routing</span> <span class='ocrx_word' id='word_1_199' title='bbox 723 2357 903 2381; x_wconf 98' lang='eng' dir='ltr'><a href="islands.html">tomorrow</a></span> <span class='ocrx_word' id='word_1_200' title='bbox 912 2351 1057 2392; x_wconf 96' lang='eng' dir='ltr'>through</span> <span class='ocrx_word' id='word_1_201' title='bbox 1065 2351 1153 2381; x_wconf 98' lang='eng' dir='ltr'>what</span> <span class='ocrx_word' id='word_1_202' title='bbox 1162 2351 1202 2381; x_wconf 98' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_203' title='bbox 1211 2357 1367 2391; x_wconf 94' lang='eng' dir='ltr'>prospect</span>
</span>
<span class='ocr_line' id='line_1_39' title="bbox 356 2410 793 2451; baseline -0.002 -10; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_204' title='bbox 356 2411 412 2441; x_wconf 89' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_205' title='bbox 422 2410 482 2440; x_wconf 89' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_206' title='bbox 491 2410 551 2440; x_wconf 89' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_207' title='bbox 559 2410 673 2440; x_wconf 88' lang='eng' dir='ltr'>makes</span> <span class='ocrx_word' id='word_1_208' title='bbox 686 2410 793 2451; x_wconf 88' lang='eng' dir='ltr'>today.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_10' title="bbox 414 2468 1363 2509">
<span class='ocr_line' id='line_1_40' title="bbox 414 2468 1363 2509; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_209' title='bbox 414 2468 617 2509; x_wconf 93' lang='eng' dir='ltr'>Virohyping</span> <span class='ocrx_word' id='word_1_210' title='bbox 628 2478 754 2508; x_wconf 94' lang='eng' dir='ltr'>sweeps</span> <span class='ocrx_word' id='word_1_211' title='bbox 766 2468 913 2509; x_wconf 96' lang='eng' dir='ltr'>through</span> <span class='ocrx_word' id='word_1_212' title='bbox 927 2468 983 2498; x_wconf 98' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_213' title='bbox 995 2468 1197 2509; x_wconf 94' lang='eng' dir='ltr'>advertising</span> <span class='ocrx_word' id='word_1_214' title='bbox 1208 2468 1363 2509; x_wconf 95' lang='eng' dir='ltr'>industry.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_11' title="bbox 418 2526 883 2567">
<span class='ocr_line' id='line_1_41' title="bbox 418 2526 883 2567; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_215' title='bbox 418 2527 582 2567; x_wconf 90' lang='eng' dir='ltr'>Everyone</span> <span class='ocrx_word' id='word_1_216' title='bbox 596 2526 660 2556; x_wconf 95' lang='eng' dir='ltr'>will</span> <span class='ocrx_word' id='word_1_217' title='bbox 674 2526 716 2556; x_wconf 98' lang='eng' dir='ltr'>be</span> <span class='ocrx_word' id='word_1_218' title='bbox 729 2526 836 2567; x_wconf 95' lang='eng' dir='ltr'>doing</span> <span class='ocrx_word' id='word_1_219' title='bbox 848 2526 883 2556; x_wconf 98' lang='eng' dir='ltr'>it.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_12' title="bbox 355 2585 1369 3154">
<span class='ocr_line' id='line_1_42' title="bbox 414 2585 1367 2626; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_220' title='bbox 414 2585 508 2615; x_wconf 93' lang='eng' dir='ltr'>Virus</span> <span class='ocrx_word' id='word_1_221' title='bbox 524 2585 551 2615; x_wconf 99' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_222' title='bbox 566 2585 719 2625; x_wconf 94' lang='eng' dir='ltr'>parasitic</span> <span class='ocrx_word' id='word_1_223' title='bbox 737 2585 780 2615; x_wconf 98' lang='eng' dir='ltr'>tic</span> <span class='ocrx_word' id='word_1_224' title='bbox 797 2585 976 2625; x_wconf 94' lang='eng' dir='ltr'>replicator</span> <span class='ocrx_word' id='word_1_225' title='bbox 991 2585 1087 2615; x_wconf 90' lang='eng' dir='ltr'>code:</span> <span class='ocrx_word' id='word_1_226' title='bbox 1105 2595 1147 2615; x_wconf 99' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_227' title='bbox 1165 2585 1367 2626; x_wconf 94' lang='eng' dir='ltr'>asignifying</span>
</span>
<span class='ocr_line' id='line_1_43' title="bbox 356 2643 1365 2683; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_228' title='bbox 356 2653 515 2683; x_wconf 93' lang='eng' dir='ltr'>sequence</span> <span class='ocrx_word' id='word_1_229' title='bbox 529 2643 567 2673; x_wconf 94' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_230' title='bbox 578 2643 741 2673; x_wconf 98' lang='eng' dir='ltr'><a href="home/doorway.html">machinic</a></span> <span class='ocrx_word' id='word_1_231' title='bbox 757 2643 833 2673; x_wconf 95' lang='eng' dir='ltr'>data</span> <span class='ocrx_word' id='word_1_232' title='bbox 846 2643 930 2673; x_wconf 91' lang='eng' dir='ltr'>ATA</span> <span class='ocrx_word' id='word_1_233' title='bbox 941 2644 1025 2673; x_wconf 95' lang='eng' dir='ltr'>ATA</span> <span class='ocrx_word' id='word_1_234' title='bbox 1040 2643 1229 2673; x_wconf 91' lang='eng' dir='ltr'>flow-break</span> <span class='ocrx_word' id='word_1_235' title='bbox 1243 2643 1365 2681; x_wconf 86' lang='eng' dir='ltr'>on/off,</span>
</span>
<span class='ocr_line' id='line_1_44' title="bbox 356 2703 1369 2744; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_236' title='bbox 356 2703 419 2741; x_wconf 94' lang='eng'>1/0,</span> <span class='ocrx_word' id='word_1_237' title='bbox 434 2703 594 2744; x_wconf 96' lang='eng' dir='ltr'>yang/yin</span> <span class='ocrx_word' id='word_1_238' title='bbox 609 2703 824 2744; x_wconf 93' lang='eng' dir='ltr'>intrinsically</span> <span class='ocrx_word' id='word_1_239' title='bbox 838 2703 994 2733; x_wconf 95' lang='eng' dir='ltr'>destined</span> <span class='ocrx_word' id='word_1_240' title='bbox 1010 2703 1062 2733; x_wconf 94' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_241' title='bbox 1076 2713 1148 2733; x_wconf 98' lang='eng' dir='ltr'>war.</span> <span class='ocrx_word' id='word_1_242' title='bbox 1167 2704 1206 2733; x_wconf 93' lang='eng' dir='ltr'>In</span> <span class='ocrx_word' id='word_1_243' title='bbox 1220 2703 1314 2743; x_wconf 94' lang='eng' dir='ltr'>place</span> <span class='ocrx_word' id='word_1_244' title='bbox 1330 2703 1369 2733; x_wconf 94' lang='eng' dir='ltr'>of</span>
</span>
<span class='ocr_line' id='line_1_45' title="bbox 355 2761 1365 2802; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_245' title='bbox 355 2771 441 2791; x_wconf 92' lang='eng' dir='ltr'>mess</span> <span class='ocrx_word' id='word_1_246' title='bbox 456 2767 752 2802; x_wconf 94' lang='eng' dir='ltr'>message-content</span> <span class='ocrx_word' id='word_1_247' title='bbox 768 2761 919 2791; x_wconf 93' lang='eng' dir='ltr'>virodata</span> <span class='ocrx_word' id='word_1_248' title='bbox 937 2761 963 2791; x_wconf 99' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_249' title='bbox 981 2761 1167 2791; x_wconf 95' lang='eng' dir='ltr'>assembled</span> <span class='ocrx_word' id='word_1_250' title='bbox 1182 2761 1263 2791; x_wconf 95' lang='eng' dir='ltr'>bled</span> <span class='ocrx_word' id='word_1_251' title='bbox 1279 2761 1365 2791; x_wconf 94' lang='eng' dir='ltr'>from</span>
</span>
<span class='ocr_line' id='line_1_46' title="bbox 357 2818 1366 2862; baseline 0 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_252' title='bbox 357 2818 552 2861; x_wconf 88' lang='eng' dir='ltr'>asignifying</span> <span class='ocrx_word' id='word_1_253' title='bbox 564 2820 727 2850; x_wconf 95' lang='eng' dir='ltr'>materials</span> <span class='ocrx_word' id='word_1_254' title='bbox 743 2820 818 2850; x_wconf 99' lang='eng' dir='ltr'>with</span> <span class='ocrx_word' id='word_1_255' title='bbox 834 2820 947 2851; x_wconf 91' lang='eng' dir='ltr'>CATA</span> <span class='ocrx_word' id='word_1_256' title='bbox 960 2820 1110 2861; x_wconf 91' lang='eng' dir='ltr'>catalytic</span> <span class='ocrx_word' id='word_1_257' title='bbox 1127 2818 1176 2862; x_wconf 93' lang='eng' dir='ltr'>(or</span> <span class='ocrx_word' id='word_1_258' title='bbox 1190 2820 1366 2861; x_wconf 93' lang='eng' dir='ltr'>positively</span>
</span>
<span class='ocr_line' id='line_1_47' title="bbox 358 2876 1368 2920; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_259' title='bbox 358 2876 671 2920; x_wconf 90' lang='eng' dir='ltr'>disproportionate)</span> <span class='ocrx_word' id='word_1_260' title='bbox 682 2878 856 2918; x_wconf 84' lang='eng' dir='ltr'>efficiency:</span> <span class='ocrx_word' id='word_1_261' title='bbox 867 2878 1012 2908; x_wconf 91' lang='eng' dir='ltr'>intruder</span> <span class='ocrx_word' id='word_1_262' title='bbox 1019 2878 1187 2918; x_wconf 93' lang='eng' dir='ltr'>passcode,</span> <span class='ocrx_word' id='word_1_263' title='bbox 1197 2878 1368 2908; x_wconf 92' lang='eng' dir='ltr'>locational</span>
</span>
<span class='ocr_line' id='line_1_48' title="bbox 359 2936 1367 2977; baseline 0 -11; x_size 37; x_descenders 7; x_ascenders 10"><span class='ocrx_word' id='word_1_264' title='bbox 359 2936 520 2973; x_wconf 83' lang='eng' dir='ltr'>ZIP-code,</span> <span class='ocrx_word' id='word_1_265' title='bbox 534 2936 824 2977; x_wconf 91' lang='eng' dir='ltr'>pseudogenomic</span> <span class='ocrx_word' id='word_1_266' title='bbox 838 2936 1016 2966; x_wconf 94' lang='eng' dir='ltr'>substitute</span> <span class='ocrx_word' id='word_1_267' title='bbox 1030 2936 1251 2973; x_wconf 86' lang='eng' dir='ltr'>instructions,</span> <span class='ocrx_word' id='word_1_268' title='bbox 1267 2942 1367 2966; x_wconf 92' lang='eng' dir='ltr'>muta-</span>
</span>
<span class='ocr_line' id='line_1_49' title="bbox 359 2993 1367 3038; baseline 0.003 -13; x_size 43; x_descenders 11; x_ascenders 12"><span class='ocrx_word' id='word_1_269' title='bbox 359 2995 462 3030; x_wconf 85' lang='eng' dir='ltr'>tional</span> <span class='ocrx_word' id='word_1_270' title='bbox 469 2995 557 3036; x_wconf 86' lang='eng' dir='ltr'>junk</span> <span class='ocrx_word' id='word_1_271' title='bbox 570 2993 743 3038; x_wconf 90' lang='eng' dir='ltr'>(complex</span> <span class='ocrx_word' id='word_1_272' title='bbox 754 2995 815 3025; x_wconf 94' lang='eng' dir='ltr'>but</span> <span class='ocrx_word' id='word_1_273' title='bbox 828 2995 931 3025; x_wconf 92' lang='eng' dir='ltr'>latent</span> <span class='ocrx_word' id='word_1_274' title='bbox 943 2993 1134 3037; x_wconf 86' lang='eng' dir='ltr'>segments),</span> <span class='ocrx_word' id='word_1_275' title='bbox 1148 2995 1214 3025; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_276' title='bbox 1225 2997 1367 3038; x_wconf 91' lang='eng' dir='ltr'>garbage</span>
</span>
<span class='ocr_line' id='line_1_50' title="bbox 359 3051 1367 3096; baseline 0 -13; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_277' title='bbox 359 3051 572 3096; x_wconf 91' lang='eng' dir='ltr'>(redundant</span> <span class='ocrx_word' id='word_1_278' title='bbox 591 3063 1367 3093; x_wconf 89' lang='eng' dir='ltr'>scrapcrapcrapcrapcrapcrapcrapcrapcrap-</span>
</span>
<span class='ocr_line' id='line_1_51' title="bbox 358 3110 708 3154; baseline 0 -12; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_279' title='bbox 358 3110 708 3154; x_wconf 92' lang='eng' dir='ltr'>crapcrapcrapcrap).</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_13' title="bbox 357 3171 1368 3563">
<span class='ocr_line' id='line_1_52' title="bbox 423 3171 1368 3212; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_280' title='bbox 423 3171 572 3201; x_wconf 94' lang='eng' dir='ltr'>Biovirus</span> <span class='ocrx_word' id='word_1_281' title='bbox 586 3171 646 3201; x_wconf 90' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_282' title='bbox 655 3171 716 3201; x_wconf 92' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_283' title='bbox 724 3171 785 3201; x_wconf 92' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_284' title='bbox 799 3177 918 3212; x_wconf 94' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_285' title='bbox 935 3171 1126 3212; x_wconf 86' lang='eng' dir='ltr'>organisms,</span> <span class='ocrx_word' id='word_1_286' title='bbox 1145 3171 1287 3212; x_wconf 85' lang='eng' dir='ltr'>hacking</span> <span class='ocrx_word' id='word_1_287' title='bbox 1299 3171 1368 3201; x_wconf 92' lang='eng' dir='ltr'>and</span>
</span>
<span class='ocr_line' id='line_1_53' title="bbox 358 3229 1368 3270; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_288' title='bbox 358 3229 641 3270; x_wconf 92' lang='eng' dir='ltr'>reprogramming</span> <span class='ocrx_word' id='word_1_289' title='bbox 647 3229 1368 3259; x_wconf 71' lang='eng' dir='ltr'>ATGAC&#39;ITATCCACGGTACATTCAGT</span>
</span>
<span class='ocr_line' id='line_1_54' title="bbox 358 3287 1366 3327; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_290' title='bbox 358 3287 492 3317; x_wconf 94' lang='eng' dir='ltr'>cellular</span> <span class='ocrx_word' id='word_1_291' title='bbox 502 3296 578 3317; x_wconf 89' lang='eng' dir='ltr'>DNA</span> <span class='ocrx_word' id='word_1_292' title='bbox 592 3293 624 3317; x_wconf 99' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_293' title='bbox 634 3287 784 3327; x_wconf 92' lang='eng' dir='ltr'>produce</span> <span class='ocrx_word' id='word_1_294' title='bbox 795 3297 887 3317; x_wconf 94' lang='eng' dir='ltr'>more</span> <span class='ocrx_word' id='word_1_295' title='bbox 896 3287 984 3317; x_wconf 93' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_296' title='bbox 994 3287 1079 3317; x_wconf 94' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_297' title='bbox 1089 3287 1176 3317; x_wconf 94' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_298' title='bbox 1185 3287 1271 3317; x_wconf 95' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_299' title='bbox 1280 3287 1366 3317; x_wconf 94' lang='eng' dir='ltr'>virus</span>
</span>
<span class='ocr_line' id='line_1_55' title="bbox 358 3345 1365 3385; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_300' title='bbox 358 3345 445 3375; x_wconf 93' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_301' title='bbox 459 3345 547 3375; x_wconf 93' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_302' title='bbox 563 3345 660 3375; x_wconf 92' lang='eng' dir='ltr'>virus.</span> <span class='ocrx_word' id='word_1_303' title='bbox 680 3346 726 3375; x_wconf 95' lang='eng' dir='ltr'>Its</span> <span class='ocrx_word' id='word_1_304' title='bbox 740 3345 889 3385; x_wconf 92' lang='eng' dir='ltr'>enzymic</span> <span class='ocrx_word' id='word_1_305' title='bbox 905 3345 1127 3385; x_wconf 91' lang='eng' dir='ltr'>cut-and-past</span> <span class='ocrx_word' id='word_1_306' title='bbox 1141 3345 1365 3375; x_wconf 91' lang='eng' dir='ltr'>recombinant</span>
</span>
<span class='ocr_line' id='line_1_56' title="bbox 357 3404 1365 3445; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_307' title='bbox 357 3404 678 3445; x_wconf 92' lang='eng' dir='ltr'>wetware-splicing</span> <span class='ocrx_word' id='word_1_308' title='bbox 699 3414 829 3434; x_wconf 94' lang='eng' dir='ltr'>crosses</span> <span class='ocrx_word' id='word_1_309' title='bbox 852 3404 1054 3445; x_wconf 91' lang='eng' dir='ltr'>singularity</span> <span class='ocrx_word' id='word_1_310' title='bbox 1074 3404 1173 3434; x_wconf 92' lang='eng' dir='ltr'>when</span> <span class='ocrx_word' id='word_1_311' title='bbox 1195 3404 1365 3434; x_wconf 94' lang='eng' dir='ltr'>retroviral</span>
</span>
<span class='ocr_line' id='line_1_57' title="bbox 358 3460 1364 3505; baseline 0 -13; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_312' title='bbox 358 3462 723 3502; x_wconf 91' lang='eng' dir='ltr'>reverse-transcriptase</span> <span class='ocrx_word' id='word_1_313' title='bbox 733 3462 832 3492; x_wconf 92' lang='eng' dir='ltr'>clicks</span> <span class='ocrx_word' id='word_1_314' title='bbox 841 3462 876 3492; x_wconf 91' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_315' title='bbox 887 3460 1057 3505; x_wconf 91' lang='eng' dir='ltr'>(enabling</span> <span class='ocrx_word' id='word_1_316' title='bbox 1065 3462 1271 3503; x_wconf 91' lang='eng' dir='ltr'>ontogenetic</span> <span class='ocrx_word' id='word_1_317' title='bbox 1281 3471 1364 3492; x_wconf 91' lang='eng' dir='ltr'>DNA-</span>
</span>
<span class='ocr_line' id='line_1_58' title="bbox 360 3519 1187 3563; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_318' title='bbox 360 3530 433 3551; x_wconf 90' lang='eng' dir='ltr'>RNA</span> <span class='ocrx_word' id='word_1_319' title='bbox 446 3521 599 3561; x_wconf 92' lang='eng' dir='ltr'>circuitry</span> <span class='ocrx_word' id='word_1_320' title='bbox 611 3521 680 3551; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_321' title='bbox 692 3521 920 3551; x_wconf 91' lang='eng' dir='ltr'>endocellular</span> <span class='ocrx_word' id='word_1_322' title='bbox 932 3519 1187 3563; x_wconf 91' lang='eng' dir='ltr'>computation).</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_14' title="bbox 357 3579 1364 3901">
<span class='ocr_line' id='line_1_59' title="bbox 419 3579 1364 3609; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_323' title='bbox 419 3579 1364 3609; x_wconf 92' lang='eng' dir='ltr'>ATAGGTCATGAATCTACCGATTGCAGCTGC</span>
</span>
<span class='ocr_line' id='line_1_60' title="bbox 357 3637 1363 3667; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_324' title='bbox 357 3637 1363 3667; x_wconf 90' lang='eng' dir='ltr'>TATTCCTCGATGATCGCATGGGCTGTGATG</span>
</span>
<span class='ocr_line' id='line_1_61' title="bbox 358 3696 1363 3726; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_325' title='bbox 358 3696 1363 3726; x_wconf 77' lang='eng' dir='ltr'><a href="VB01.html">GCATCGTATCCGATCGATTCGAGCGATTGCAGC</a></span>
</span>
<span class='ocr_line' id='line_1_62' title="bbox 357 3754 1362 3784; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_326' title='bbox 357 3754 1362 3784; x_wconf 75' lang='eng' dir='ltr'>TACGCTATTCCTCCGAGGGATTGCAGCTACGTC</span>
</span>
<span class='ocr_line' id='line_1_63' title="bbox 358 3812 1363 3843; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_327' title='bbox 358 3812 1363 3843; x_wconf 91' lang='eng' dir='ltr'>GCATCGGGCTCAGATGTAGGTCATGAATCTACC</span>
</span>
<span class='ocr_line' id='line_1_64' title="bbox 359 3871 1327 3901; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_328' title='bbox 359 3871 747 3901; x_wconf 79' lang='eng' dir='ltr'>GATTGCATGACTT</span> <span class='ocrx_word' id='word_1_329' title='bbox 743 3871 1298 3901; x_wconf 79' lang='eng' dir='ltr'>ATCCACGGTACAITCGACT</span> <span class='ocrx_word' id='word_1_330' title='bbox 1299 3871 1327 3901; x_wconf 96' lang='eng' dir='ltr'>C</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_15' title="bbox 358 3929 1372 4539">
<span class='ocr_line' id='line_1_65' title="bbox 423 3929 1362 3970; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_331' title='bbox 423 3929 623 3959; x_wconf 90' lang='eng' dir='ltr'>Ethnovirus</span> <span class='ocrx_word' id='word_1_332' title='bbox 639 3935 759 3970; x_wconf 93' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_333' title='bbox 774 3929 884 3959; x_wconf 92' lang='eng' dir='ltr'>brains</span> <span class='ocrx_word' id='word_1_334' title='bbox 897 3929 1117 3959; x_wconf 92' lang='eng' dir='ltr'>Technovirus</span> <span class='ocrx_word' id='word_1_335' title='bbox 1132 3935 1248 3970; x_wconf 92' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_336' title='bbox 1262 3929 1362 3959; x_wconf 94' lang='eng' dir='ltr'>socio-</span>
</span>
<span class='ocr_line' id='line_1_66' title="bbox 358 3988 1361 4028; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_337' title='bbox 358 3988 531 4018; x_wconf 92' lang='eng' dir='ltr'>economic</span> <span class='ocrx_word' id='word_1_338' title='bbox 549 3998 611 4028; x_wconf 93' lang='eng' dir='ltr'>pro</span> <span class='ocrx_word' id='word_1_339' title='bbox 628 3998 690 4028; x_wconf 93' lang='eng' dir='ltr'>pro</span> <span class='ocrx_word' id='word_1_340' title='bbox 707 3988 912 4028; x_wconf 91' lang='eng' dir='ltr'>production</span> <span class='ocrx_word' id='word_1_341' title='bbox 929 3998 990 4028; x_wconf 93' lang='eng' dir='ltr'>pro</span> <span class='ocrx_word' id='word_1_342' title='bbox 1007 3998 1182 4028; x_wconf 92' lang='eng' dir='ltr'>processes.</span> <span class='ocrx_word' id='word_1_343' title='bbox 1202 3988 1361 4018; x_wconf 91' lang='eng' dir='ltr'>Infovirus</span>
</span>
<span class='ocr_line' id='line_1_67' title="bbox 360 4046 1361 4087; baseline -0.001 -11; x_size 41; x_descenders 11; x_ascenders 9"><span class='ocrx_word' id='word_1_344' title='bbox 360 4052 474 4087; x_wconf 90' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_345' title='bbox 484 4046 597 4087; x_wconf 91' lang='eng' dir='ltr'>digital</span> <span class='ocrx_word' id='word_1_346' title='bbox 606 4054 1361 4076; x_wconf 94' lang='eng'>010010010001011110100001001101010101010</span>
</span>
<span class='ocr_line' id='line_1_68' title="bbox 360 4111 1360 4145; baseline 0 -10; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_347' title='bbox 360 4111 1360 4145; x_wconf 91' lang='eng' dir='ltr'>10001001101010010010100computers100101001011010010</span>
</span>
<span class='ocr_line' id='line_1_69' title="bbox 360 4171 1360 4192; baseline 0.001 -1; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_348' title='bbox 360 4171 1360 4192; x_wconf 89' lang='eng'>101111010001010101010101010010101001010110101001</span>
</span>
<span class='ocr_line' id='line_1_70' title="bbox 358 4228 1359 4250; baseline -0.001 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_349' title='bbox 358 4228 1359 4250; x_wconf 94' lang='eng'>000000100010111010100100101010010100100101010101</span>
</span>
<span class='ocr_line' id='line_1_71' title="bbox 359 4286 1358 4308; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_350' title='bbox 359 4286 1358 4308; x_wconf 91' lang='eng'>00100010010010010010010010100100101011010100100</span>
</span>
<span class='ocr_line' id='line_1_72' title="bbox 360 4344 1358 4366; baseline 0.001 -1; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_351' title='bbox 360 4344 1358 4366; x_wconf 94' lang='eng'>10010101101010101010111101000010011010101010101000</span>
</span>
<span class='ocr_line' id='line_1_73' title="bbox 361 4403 1359 4425; baseline 0.001 -1; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_352' title='bbox 361 4403 1359 4425; x_wconf 91' lang='eng'>1001101101010101001100100010001010101110100001010</span>
</span>
<span class='ocr_line' id='line_1_74' title="bbox 360 4461 1372 4482; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_353' title='bbox 360 4461 1372 4482; x_wconf 96' lang='eng'>110010100101000110010011100100010000000001001111</span>
</span>
<span class='ocr_line' id='line_1_75' title="bbox 360 4517 680 4539; baseline -0.003 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_354' title='bbox 360 4517 680 4539; x_wconf 94' lang='eng'>1100010010010101</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_16' title="bbox 360 4568 1375 5015">
<span class='ocr_line' id='line_1_76' title="bbox 425 4568 1372 4609; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_355' title='bbox 425 4568 626 4608; x_wconf 92' lang='eng' dir='ltr'>Hypervirus</span> <span class='ocrx_word' id='word_1_356' title='bbox 639 4574 759 4609; x_wconf 94' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_357' title='bbox 770 4568 957 4609; x_wconf 91' lang='eng' dir='ltr'>intelligent</span> <span class='ocrx_word' id='word_1_358' title='bbox 968 4568 1264 4608; x_wconf 91' lang='eng' dir='ltr'>immunosecurity</span> <span class='ocrx_word' id='word_1_359' title='bbox 1274 4574 1372 4598; x_wconf 94' lang='eng' dir='ltr'>struc-</span>
</span>
<span class='ocr_line' id='line_1_77' title="bbox 361 4626 1372 4667; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_360' title='bbox 361 4633 458 4656; x_wconf 89' lang='eng' dir='ltr'>tures:</span> <span class='ocrx_word' id='word_1_361' title='bbox 470 4636 525 4666; x_wconf 91' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_362' title='bbox 535 4636 589 4666; x_wconf 92' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_363' title='bbox 601 4636 646 4656; x_wconf 92' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_364' title='bbox 656 4636 712 4666; x_wconf 91' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_365' title='bbox 724 4636 769 4656; x_wconf 92' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_366' title='bbox 782 4626 1003 4666; x_wconf 91' lang='eng' dir='ltr'>nomadically</span> <span class='ocrx_word' id='word_1_367' title='bbox 1015 4626 1219 4667; x_wconf 91' lang='eng' dir='ltr'>abstracting</span> <span class='ocrx_word' id='word_1_368' title='bbox 1229 4626 1269 4656; x_wconf 94' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_369' title='bbox 1280 4636 1372 4666; x_wconf 93' lang='eng' dir='ltr'>proc-</span>
</span>
<span class='ocr_line' id='line_1_78' title="bbox 362 4682 1372 4726; baseline 0 -12; x_size 37; x_descenders 7; x_ascenders 10"><span class='ocrx_word' id='word_1_370' title='bbox 362 4694 444 4714; x_wconf 94' lang='eng' dir='ltr'>esses</span> <span class='ocrx_word' id='word_1_371' title='bbox 457 4684 540 4714; x_wconf 90' lang='eng' dir='ltr'>from</span> <span class='ocrx_word' id='word_1_372' title='bbox 552 4684 681 4724; x_wconf 88' lang='eng' dir='ltr'>specific</span> <span class='ocrx_word' id='word_1_373' title='bbox 694 4684 803 4714; x_wconf 95' lang='eng' dir='ltr'>media</span> <span class='ocrx_word' id='word_1_374' title='bbox 816 4682 918 4726; x_wconf 88' lang='eng' dir='ltr'>(DNA,</span> <span class='ocrx_word' id='word_1_375' title='bbox 928 4684 1050 4721; x_wconf 94' lang='eng' dir='ltr'>words,</span> <span class='ocrx_word' id='word_1_376' title='bbox 1061 4684 1222 4724; x_wconf 91' lang='eng' dir='ltr'>symbolic</span> <span class='ocrx_word' id='word_1_377' title='bbox 1232 4684 1372 4721; x_wconf 94' lang='eng' dir='ltr'>models,</span>
</span>
<span class='ocr_line' id='line_1_79' title="bbox 361 4741 1373 4784; baseline 0 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_378' title='bbox 361 4741 632 4784; x_wconf 91' lang='eng' dir='ltr'>bit-sequences),</span> <span class='ocrx_word' id='word_1_379' title='bbox 653 4742 722 4772; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_380' title='bbox 739 4742 921 4782; x_wconf 92' lang='eng' dir='ltr'>operantly</span> <span class='ocrx_word' id='word_1_381' title='bbox 938 4742 1207 4783; x_wconf 92' lang='eng' dir='ltr'>re-engineering</span> <span class='ocrx_word' id='word_1_382' title='bbox 1224 4742 1321 4772; x_wconf 82' lang='eng' dir='ltr'>itself.</span> <span class='ocrx_word' id='word_1_383' title='bbox 1345 4743 1373 4772; x_wconf 95' lang='eng' dir='ltr'>It</span>
</span>
<span class='ocr_line' id='line_1_80' title="bbox 361 4800 1375 4841; baseline 0 -11; x_size 37; x_descenders 7; x_ascenders 10"><span class='ocrx_word' id='word_1_384' title='bbox 361 4800 448 4830; x_wconf 82' lang='eng' dir='ltr'>folds</span> <span class='ocrx_word' id='word_1_385' title='bbox 462 4800 532 4830; x_wconf 92' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_386' title='bbox 544 4800 639 4837; x_wconf 82' lang='eng' dir='ltr'>itself,</span> <span class='ocrx_word' id='word_1_387' title='bbox 653 4800 828 4837; x_wconf 92' lang='eng' dir='ltr'>involutes,</span> <span class='ocrx_word' id='word_1_388' title='bbox 843 4810 881 4830; x_wconf 95' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_389' title='bbox 893 4800 1018 4840; x_wconf 90' lang='eng' dir='ltr'>plexes,</span> <span class='ocrx_word' id='word_1_390' title='bbox 1033 4800 1077 4840; x_wconf 93' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_391' title='bbox 1089 4800 1375 4841; x_wconf 91' lang='eng' dir='ltr'>reprogramming</span>
</span>
<span class='ocr_line' id='line_1_81' title="bbox 360 4858 1372 4899; baseline 0 -11; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_392' title='bbox 360 4858 573 4898; x_wconf 89' lang='eng' dir='ltr'>corpuscular</span> <span class='ocrx_word' id='word_1_393' title='bbox 590 4858 674 4888; x_wconf 92' lang='eng' dir='ltr'>code</span> <span class='ocrx_word' id='word_1_394' title='bbox 696 4864 730 4888; x_wconf 97' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_395' title='bbox 749 4868 940 4899; x_wconf 92' lang='eng' dir='ltr'>reprogram</span> <span class='ocrx_word' id='word_1_396' title='bbox 960 4858 1247 4899; x_wconf 91' lang='eng' dir='ltr'>reprogramming</span> <span class='ocrx_word' id='word_1_397' title='bbox 1265 4868 1372 4898; x_wconf 92' lang='eng' dir='ltr'>repro-</span>
</span>
<span class='ocr_line' id='line_1_82' title="bbox 360 4916 1373 4958; baseline -0.001 -11; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_398' title='bbox 360 4917 547 4958; x_wconf 90' lang='eng' dir='ltr'>gramming</span> <span class='ocrx_word' id='word_1_399' title='bbox 556 4916 849 4957; x_wconf 92' lang='eng' dir='ltr'>reprogramming.</span> <span class='ocrx_word' id='word_1_400' title='bbox 865 4925 945 4946; x_wconf 90' lang='eng' dir='ltr'>ROM</span> <span class='ocrx_word' id='word_1_401' title='bbox 959 4916 986 4946; x_wconf 95' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_402' title='bbox 997 4916 1121 4946; x_wconf 95' lang='eng' dir='ltr'>melted</span> <span class='ocrx_word' id='word_1_403' title='bbox 1130 4916 1202 4946; x_wconf 91' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_404' title='bbox 1213 4916 1373 4946; x_wconf 94' lang='eng' dir='ltr'>recursive</span>
</span>
<span class='ocr_line' id='line_1_83' title="bbox 361 4975 666 5015; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_405' title='bbox 361 4975 666 5015; x_wconf 90' lang='eng' dir='ltr'>experimentation.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_17' title="bbox 363 5041 1374 5364">
<span class='ocr_line' id='line_1_84' title="bbox 423 5041 1373 5062; baseline -0.001 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_406' title='bbox 423 5041 1373 5062; x_wconf 96' lang='eng'>001010010010010110000101010101011101010010100</span>
</span>
<span class='ocr_line' id='line_1_85' title="bbox 363 5100 1373 5121; baseline 0.001 -1; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_407' title='bbox 363 5100 1373 5121; x_wconf 96' lang='eng'>10010101000011011001101001011000010001001001000</span>
</span>
<span class='ocr_line' id='line_1_86' title="bbox 363 5149 1374 5190; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_408' title='bbox 363 5149 548 5190; x_wconf 91' lang='eng' dir='ltr'>Recording</span> <span class='ocrx_word' id='word_1_409' title='bbox 556 5149 695 5179; x_wconf 94' lang='eng' dir='ltr'>devices.</span> <span class='ocrx_word' id='word_1_410' title='bbox 707 5149 856 5189; x_wconf 93' lang='eng' dir='ltr'>Copiers.</span> <span class='ocrx_word' id='word_1_411' title='bbox 869 5150 979 5179; x_wconf 90' lang='eng' dir='ltr'>Faxes.</span> <span class='ocrx_word' id='word_1_412' title='bbox 992 5149 1167 5189; x_wconf 92' lang='eng' dir='ltr'>Samplers.</span> <span class='ocrx_word' id='word_1_413' title='bbox 1181 5155 1374 5179; x_wconf 90' lang='eng' dir='ltr'>K-stammer</span>
</span>
<span class='ocr_line' id='line_1_87' title="bbox 363 5207 1372 5252; baseline 0 -14; x_size 43; x_descenders 12; x_ascenders 11"><span class='ocrx_word' id='word_1_414' title='bbox 363 5207 639 5252; x_wconf 90' lang='eng' dir='ltr'>(((re)re)reruns)</span> <span class='ocrx_word' id='word_1_415' title='bbox 656 5214 814 5238; x_wconf 90' lang='eng' dir='ltr'>cross-cut</span> <span class='ocrx_word' id='word_1_416' title='bbox 829 5208 873 5248; x_wconf 92' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_417' title='bbox 886 5208 1016 5248; x_wconf 91' lang='eng' dir='ltr'>orphan</span> <span class='ocrx_word' id='word_1_418' title='bbox 1032 5207 1117 5238; x_wconf 82' lang='eng' dir='ltr'>drift.</span> <span class='ocrx_word' id='word_1_419' title='bbox 1136 5209 1261 5248; x_wconf 90' lang='eng' dir='ltr'>Repeat</span> <span class='ocrx_word' id='word_1_420' title='bbox 1274 5208 1372 5238; x_wconf 91' lang='eng' dir='ltr'>infec-</span>
</span>
<span class='ocr_line' id='line_1_88' title="bbox 363 5266 1372 5306; baseline 0 -10; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_421' title='bbox 363 5266 442 5296; x_wconf 91' lang='eng' dir='ltr'>tion.</span> <span class='ocrx_word' id='word_1_422' title='bbox 462 5266 515 5296; x_wconf 95' lang='eng' dir='ltr'>All</span> <span class='ocrx_word' id='word_1_423' title='bbox 533 5266 619 5306; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_424' title='bbox 638 5266 728 5306; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_425' title='bbox 747 5266 834 5306; x_wconf 91' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_426' title='bbox 854 5266 942 5306; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_427' title='bbox 963 5266 1051 5306; x_wconf 91' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_428' title='bbox 1070 5266 1160 5306; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_429' title='bbox 1179 5266 1266 5306; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_430' title='bbox 1286 5266 1372 5306; x_wconf 92' lang='eng' dir='ltr'>hype</span>
</span>
<span class='ocr_line' id='line_1_89' title="bbox 363 5324 1238 5364; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_431' title='bbox 363 5324 551 5364; x_wconf 92' lang='eng' dir='ltr'>hypervirus</span> <span class='ocrx_word' id='word_1_432' title='bbox 564 5324 682 5354; x_wconf 91' lang='eng' dir='ltr'>strains</span> <span class='ocrx_word' id='word_1_433' title='bbox 696 5334 748 5354; x_wconf 95' lang='eng' dir='ltr'>are</span> <span class='ocrx_word' id='word_1_434' title='bbox 761 5324 879 5364; x_wconf 91' lang='eng' dir='ltr'>plastic</span> <span class='ocrx_word' id='word_1_435' title='bbox 894 5324 959 5354; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_436' title='bbox 973 5324 1238 5364; x_wconf 91' lang='eng' dir='ltr'>interoperative.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_18' title="bbox 361 5382 1376 6063">
<span class='ocr_line' id='line_1_90' title="bbox 425 5382 1371 5423; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_437' title='bbox 425 5383 587 5412; x_wconf 70' lang='eng' dir='ltr'>INSERT.</span> <span class='ocrx_word' id='word_1_438' title='bbox 602 5382 885 5423; x_wconf 80' lang='eng' dir='ltr'>hyper-prefixing</span> <span class='ocrx_word' id='word_1_439' title='bbox 896 5382 1045 5413; x_wconf 84' lang='eng' dir='ltr'>semiotic</span> <span class='ocrx_word' id='word_1_440' title='bbox 1058 5388 1178 5412; x_wconf 84' lang='eng' dir='ltr'>sectors</span> <span class='ocrx_word' id='word_1_441' title='bbox 1186 5382 1278 5412; x_wconf 86' lang='eng' dir='ltr'>TAG</span> <span class='ocrx_word' id='word_1_442' title='bbox 1285 5382 1371 5412; x_wconf 92' lang='eng' dir='ltr'>TAG</span>
</span>
<span class='ocr_line' id='line_1_91' title="bbox 361 5438 1372 5482; baseline 0 -12; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_443' title='bbox 361 5440 446 5470; x_wconf 90' lang='eng' dir='ltr'>TAG</span> <span class='ocrx_word' id='word_1_444' title='bbox 455 5446 521 5481; x_wconf 89' lang='eng' dir='ltr'>tags</span> <span class='ocrx_word' id='word_1_445' title='bbox 529 5440 616 5470; x_wconf 93' lang='eng' dir='ltr'>them</span> <span class='ocrx_word' id='word_1_446' title='bbox 624 5440 675 5470; x_wconf 95' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_447' title='bbox 683 5440 817 5470; x_wconf 92' lang='eng' dir='ltr'>transfer</span> <span class='ocrx_word' id='word_1_448' title='bbox 824 5440 894 5470; x_wconf 92' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_449' title='bbox 902 5440 1041 5470; x_wconf 94' lang='eng' dir='ltr'>abstract</span> <span class='ocrx_word' id='word_1_450' title='bbox 1048 5440 1134 5470; x_wconf 89' lang='eng' dir='ltr'>ACT</span> <span class='ocrx_word' id='word_1_451' title='bbox 1140 5440 1225 5470; x_wconf 89' lang='eng' dir='ltr'>ACT</span> <span class='ocrx_word' id='word_1_452' title='bbox 1234 5438 1372 5482; x_wconf 91' lang='eng' dir='ltr'>(nonlin-</span>
</span>
<span class='ocr_line' id='line_1_92' title="bbox 363 5497 1375 5540; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_453' title='bbox 363 5508 415 5528; x_wconf 91' lang='eng' dir='ltr'>ear</span> <span class='ocrx_word' id='word_1_454' title='bbox 423 5497 657 5540; x_wconf 91' lang='eng' dir='ltr'>transcodable)</span> <span class='ocrx_word' id='word_1_455' title='bbox 667 5498 829 5528; x_wconf 92' lang='eng' dir='ltr'>machinic</span> <span class='ocrx_word' id='word_1_456' title='bbox 837 5504 980 5538; x_wconf 91' lang='eng' dir='ltr'>systems,</span> <span class='ocrx_word' id='word_1_457' title='bbox 992 5498 1094 5528; x_wconf 92' lang='eng' dir='ltr'>tuned</span> <span class='ocrx_word' id='word_1_458' title='bbox 1103 5504 1136 5528; x_wconf 97' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_459' title='bbox 1144 5498 1329 5528; x_wconf 94' lang='eng' dir='ltr'>virtualities</span> <span class='ocrx_word' id='word_1_460' title='bbox 1338 5508 1375 5528; x_wconf 95' lang='eng' dir='ltr'>or</span>
</span>
<span class='ocr_line' id='line_1_93' title="bbox 364 5556 1371 5600; baseline 0 -13; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_461' title='bbox 364 5557 576 5597; x_wconf 91' lang='eng' dir='ltr'>hyperspeeds</span> <span class='ocrx_word' id='word_1_462' title='bbox 586 5556 720 5600; x_wconf 95' lang='eng' dir='ltr'>(futural</span> <span class='ocrx_word' id='word_1_463' title='bbox 728 5557 906 5587; x_wconf 91' lang='eng' dir='ltr'>currencies</span> <span class='ocrx_word' id='word_1_464' title='bbox 914 5557 1137 5597; x_wconf 91' lang='eng' dir='ltr'>independent</span> <span class='ocrx_word' id='word_1_465' title='bbox 1146 5557 1184 5587; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_466' title='bbox 1189 5557 1246 5587; x_wconf 95' lang='eng' dir='ltr'>def</span> <span class='ocrx_word' id='word_1_467' title='bbox 1248 5557 1371 5587; x_wconf 94' lang='eng' dir='ltr'>uturali-</span>
</span>
<span class='ocr_line' id='line_1_94' title="bbox 365 5614 1373 5657; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_468' title='bbox 365 5614 494 5657; x_wconf 91' lang='eng' dir='ltr'>zation).</span> <span class='ocrx_word' id='word_1_469' title='bbox 507 5615 725 5655; x_wconf 91' lang='eng' dir='ltr'>Hypermedia</span> <span class='ocrx_word' id='word_1_470' title='bbox 734 5615 900 5656; x_wconf 88' lang='eng' dir='ltr'>configure</span> <span class='ocrx_word' id='word_1_471' title='bbox 910 5625 942 5645; x_wconf 95' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_472' title='bbox 952 5625 983 5645; x_wconf 95' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_473' title='bbox 992 5625 1087 5655; x_wconf 92' lang='eng' dir='ltr'>every</span> <span class='ocrx_word' id='word_1_474' title='bbox 1095 5615 1373 5655; x_wconf 92' lang='eng' dir='ltr'>implementation</span>
</span>
<span class='ocr_line' id='line_1_95' title="bbox 362 5674 1376 5714; baseline 0.001 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_475' title='bbox 362 5674 476 5704; x_wconf 91' lang='eng' dir='ltr'>within</span> <span class='ocrx_word' id='word_1_476' title='bbox 487 5684 505 5704; x_wconf 96' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_477' title='bbox 517 5674 647 5714; x_wconf 88' lang='eng' dir='ltr'>specific</span> <span class='ocrx_word' id='word_1_478' title='bbox 661 5674 806 5704; x_wconf 95' lang='eng' dir='ltr'>medium</span> <span class='ocrx_word' id='word_1_479' title='bbox 820 5684 858 5704; x_wconf 95' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_480' title='bbox 870 5674 1022 5714; x_wconf 92' lang='eng' dir='ltr'>territory</span> <span class='ocrx_word' id='word_1_481' title='bbox 1032 5684 1066 5704; x_wconf 94' lang='eng' dir='ltr'>as</span> <span class='ocrx_word' id='word_1_482' title='bbox 1078 5684 1096 5704; x_wconf 96' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_483' title='bbox 1108 5674 1327 5704; x_wconf 91' lang='eng' dir='ltr'>subfunction</span> <span class='ocrx_word' id='word_1_484' title='bbox 1339 5674 1376 5704; x_wconf 98' lang='eng' dir='ltr'>of</span>
</span>
<span class='ocr_line' id='line_1_96' title="bbox 364 5730 1371 5776; baseline -0.001 -13; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_485' title='bbox 364 5732 624 5763; x_wconf 89' lang='eng' dir='ltr'>extraterritorial</span> <span class='ocrx_word' id='word_1_486' title='bbox 635 5742 815 5772; x_wconf 87' lang='eng' dir='ltr'>processes.</span> <span class='ocrx_word' id='word_1_487' title='bbox 830 5732 946 5773; x_wconf 92' lang='eng' dir='ltr'>Going</span> <span class='ocrx_word' id='word_1_488' title='bbox 959 5730 987 5775; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_489' title='bbox 1002 5730 1014 5774; x_wconf 96' lang='eng'>(</span> <span class='ocrx_word' id='word_1_490' title='bbox 1028 5730 1074 5775; x_wconf 92' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_491' title='bbox 1089 5730 1101 5774; x_wconf 96' lang='eng'>(</span> <span class='ocrx_word' id='word_1_492' title='bbox 1115 5730 1127 5774; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_493' title='bbox 1143 5730 1154 5774; x_wconf 91' lang='eng'>(</span> <span class='ocrx_word' id='word_1_494' title='bbox 1167 5730 1179 5774; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_495' title='bbox 1195 5731 1223 5775; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_496' title='bbox 1236 5730 1248 5774; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_497' title='bbox 1273 5730 1285 5774; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_498' title='bbox 1300 5731 1328 5776; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_499' title='bbox 1342 5731 1371 5776; x_wconf 89' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_97' title="bbox 367 5790 1373 5834; baseline 0 -13; x_size 42; x_descenders 11; x_ascenders 11"><span class='ocrx_word' id='word_1_500' title='bbox 367 5790 378 5834; x_wconf 91' lang='eng'>(</span> <span class='ocrx_word' id='word_1_501' title='bbox 392 5790 404 5834; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_502' title='bbox 419 5791 519 5831; x_wconf 92' lang='eng' dir='ltr'>hyper</span> <span class='ocrx_word' id='word_1_503' title='bbox 531 5791 690 5821; x_wconf 93' lang='eng' dir='ltr'>dissolves</span> <span class='ocrx_word' id='word_1_504' title='bbox 703 5791 806 5832; x_wconf 91' lang='eng' dir='ltr'>being</span> <span class='ocrx_word' id='word_1_505' title='bbox 818 5791 889 5821; x_wconf 91' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_506' title='bbox 900 5791 990 5821; x_wconf 93' lang='eng' dir='ltr'>ACT</span> <span class='ocrx_word' id='word_1_507' title='bbox 999 5791 1089 5821; x_wconf 93' lang='eng' dir='ltr'>ACT</span> <span class='ocrx_word' id='word_1_508' title='bbox 1099 5791 1187 5821; x_wconf 89' lang='eng' dir='ltr'>ACT</span> <span class='ocrx_word' id='word_1_509' title='bbox 1199 5791 1340 5831; x_wconf 87' lang='eng' dir='ltr'>activity;</span> <span class='ocrx_word' id='word_1_510' title='bbox 1355 5801 1373 5821; x_wconf 96' lang='eng' dir='ltr'>a</span>
</span>
<span class='ocr_line' id='line_1_98' title="bbox 365 5850 1372 5890; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_511' title='bbox 365 5850 508 5880; x_wconf 90' lang='eng' dir='ltr'>material</span> <span class='ocrx_word' id='word_1_512' title='bbox 523 5850 886 5880; x_wconf 91' lang='eng' dir='ltr'>desubstantialisation</span> <span class='ocrx_word' id='word_1_513' title='bbox 902 5860 945 5880; x_wconf 92' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_514' title='bbox 964 5850 1013 5880; x_wconf 83' lang='eng' dir='ltr'>off</span> <span class='ocrx_word' id='word_1_515' title='bbox 1027 5860 1070 5880; x_wconf 92' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_516' title='bbox 1087 5850 1145 5880; x_wconf 82' lang='eng' dir='ltr'>off.</span> <span class='ocrx_word' id='word_1_517' title='bbox 1164 5851 1372 5890; x_wconf 91' lang='eng' dir='ltr'>Hyperproc-</span>
</span>
<span class='ocr_line' id='line_1_99' title="bbox 363 5906 1372 5950; baseline 0 -12; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_518' title='bbox 363 5918 450 5938; x_wconf 93' lang='eng' dir='ltr'>esses</span> <span class='ocrx_word' id='word_1_519' title='bbox 460 5908 575 5948; x_wconf 93' lang='eng' dir='ltr'>spread</span> <span class='ocrx_word' id='word_1_520' title='bbox 585 5908 651 5938; x_wconf 92' lang='eng' dir='ltr'>like</span> <span class='ocrx_word' id='word_1_521' title='bbox 664 5908 878 5938; x_wconf 91' lang='eng' dir='ltr'>Heraklitean</span> <span class='ocrx_word' id='word_1_522' title='bbox 888 5908 947 5938; x_wconf 95' lang='eng' dir='ltr'>fire</span> <span class='ocrx_word' id='word_1_523' title='bbox 956 5918 991 5938; x_wconf 95' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_524' title='bbox 1001 5918 1036 5938; x_wconf 95' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_525' title='bbox 1046 5918 1081 5938; x_wconf 95' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_526' title='bbox 1094 5906 1271 5950; x_wconf 92' lang='eng' dir='ltr'>(although</span> <span class='ocrx_word' id='word_1_527' title='bbox 1284 5908 1372 5938; x_wconf 95' lang='eng' dir='ltr'>there</span>
</span>
<span class='ocr_line' id='line_1_100' title="bbox 361 5962 1370 6003; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_528' title='bbox 361 5972 418 5992; x_wconf 94' lang='eng' dir='ltr'>are</span> <span class='ocrx_word' id='word_1_529' title='bbox 431 5972 476 5992; x_wconf 94' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_530' title='bbox 490 5962 660 6003; x_wconf 89' lang='eng' dir='ltr'>analogies</span> <span class='ocrx_word' id='word_1_531' title='bbox 675 5972 714 5992; x_wconf 94' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_532' title='bbox 728 5962 919 6002; x_wconf 91' lang='eng' dir='ltr'>metaphors</span> <span class='ocrx_word' id='word_1_533' title='bbox 935 5962 970 5992; x_wconf 94' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_534' title='bbox 984 5962 1069 6003; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_535' title='bbox 1085 5962 1171 6003; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_536' title='bbox 1186 5962 1270 6003; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_537' title='bbox 1287 5962 1370 6003; x_wconf 91' lang='eng' dir='ltr'>hype</span>
</span>
<span class='ocr_line' id='line_1_101' title="bbox 364 6019 594 6063; baseline 0.004 -13; x_size 42; x_descenders 10; x_ascenders 12"><span class='ocrx_word' id='word_1_538' title='bbox 364 6019 594 6063; x_wconf 92' lang='eng' dir='ltr'>hyperspace).</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_19' title="bbox 359 6079 1372 6939">
<span class='ocr_line' id='line_1_102' title="bbox 428 6079 1370 6120; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_539' title='bbox 428 6079 530 6120; x_wconf 89' lang='eng' dir='ltr'>Being</span> <span class='ocrx_word' id='word_1_540' title='bbox 538 6079 629 6109; x_wconf 93' lang='eng' dir='ltr'>CAG</span> <span class='ocrx_word' id='word_1_541' title='bbox 637 6079 729 6109; x_wconf 93' lang='eng' dir='ltr'>CAG</span> <span class='ocrx_word' id='word_1_542' title='bbox 738 6089 829 6120; x_wconf 90' lang='eng' dir='ltr'>cages</span> <span class='ocrx_word' id='word_1_543' title='bbox 841 6079 917 6109; x_wconf 96' lang='eng' dir='ltr'>flow</span> <span class='ocrx_word' id='word_1_544' title='bbox 927 6079 1035 6109; x_wconf 94' lang='eng' dir='ltr'>within</span> <span class='ocrx_word' id='word_1_545' title='bbox 1046 6089 1193 6120; x_wconf 90' lang='eng' dir='ltr'>memory.</span> <span class='ocrx_word' id='word_1_546' title='bbox 1206 6079 1370 6109; x_wconf 90' lang='eng' dir='ltr'>Function-</span>
</span>
<span class='ocr_line' id='line_1_103' title="bbox 364 6138 1372 6179; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_547' title='bbox 364 6138 421 6179; x_wconf 89' lang='eng' dir='ltr'>ing</span> <span class='ocrx_word' id='word_1_548' title='bbox 432 6148 466 6168; x_wconf 91' lang='eng' dir='ltr'>as</span> <span class='ocrx_word' id='word_1_549' title='bbox 478 6148 510 6168; x_wconf 94' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_550' title='bbox 522 6148 556 6168; x_wconf 94' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_551' title='bbox 568 6138 634 6168; x_wconf 94' lang='eng' dir='ltr'>real</span> <span class='ocrx_word' id='word_1_552' title='bbox 647 6138 887 6179; x_wconf 90' lang='eng' dir='ltr'>antiontology,</span> <span class='ocrx_word' id='word_1_553' title='bbox 899 6138 980 6168; x_wconf 94' lang='eng' dir='ltr'>viral</span> <span class='ocrx_word' id='word_1_554' title='bbox 993 6138 1133 6168; x_wconf 91' lang='eng' dir='ltr'>amnesia</span> <span class='ocrx_word' id='word_1_555' title='bbox 1146 6138 1372 6179; x_wconf 89' lang='eng' dir='ltr'>machinically</span>
</span>
<span class='ocr_line' id='line_1_104' title="bbox 364 6196 1370 6237; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_556' title='bbox 364 6196 496 6226; x_wconf 91' lang='eng' dir='ltr'>realizes</span> <span class='ocrx_word' id='word_1_557' title='bbox 516 6196 583 6226; x_wconf 94' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_558' title='bbox 602 6196 764 6226; x_wconf 92' lang='eng' dir='ltr'>dissolves</span> <span class='ocrx_word' id='word_1_559' title='bbox 784 6196 965 6237; x_wconf 89' lang='eng' dir='ltr'>biological</span> <span class='ocrx_word' id='word_1_560' title='bbox 982 6196 1370 6226; x_wconf 65' lang='eng' dir='ltr'>TGACTCACI&#39;ITAC-</span>
</span>
<span class='ocr_line' id='line_1_105' title="bbox 364 6254 1369 6290; baseline 0 -6; x_size 36; x_descenders 6; x_ascenders 8"><span class='ocrx_word' id='word_1_561' title='bbox 364 6254 549 6290; x_wconf 76' lang='eng' dir='ltr'>CGA&#39;ITG,</span> <span class='ocrx_word' id='word_1_562' title='bbox 559 6254 707 6290; x_wconf 90' lang='eng' dir='ltr'>cultural,</span> <span class='ocrx_word' id='word_1_563' title='bbox 718 6254 784 6284; x_wconf 91' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_564' title='bbox 794 6254 953 6284; x_wconf 91' lang='eng' dir='ltr'>technical</span> <span class='ocrx_word' id='word_1_565' title='bbox 963 6262 1369 6284; x_wconf 91' lang='eng'>010110100100010110100</span>
</span>
<span class='ocr_line' id='line_1_106' title="bbox 364 6313 1368 6343; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_566' title='bbox 364 6321 1031 6343; x_wconf 93' lang='eng'>101001001011101001010100100100100</span> <span class='ocrx_word' id='word_1_567' title='bbox 1038 6313 1181 6343; x_wconf 92' lang='eng' dir='ltr'>mnemic</span> <span class='ocrx_word' id='word_1_568' title='bbox 1189 6319 1368 6343; x_wconf 89' lang='eng' dir='ltr'>structures:</span>
</span>
<span class='ocr_line' id='line_1_107' title="bbox 363 6371 1369 6412; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_569' title='bbox 363 6371 598 6412; x_wconf 90' lang='eng' dir='ltr'>chopping-up</span> <span class='ocrx_word' id='word_1_570' title='bbox 618 6371 1038 6412; x_wconf 90' lang='eng' dir='ltr'>hierarchic-generational</span> <span class='ocrx_word' id='word_1_571' title='bbox 1056 6371 1288 6412; x_wconf 92' lang='eng' dir='ltr'>descendency,</span> <span class='ocrx_word' id='word_1_572' title='bbox 1307 6371 1369 6402; x_wconf 89' lang='eng' dir='ltr'>col-</span>
</span>
<span class='ocr_line' id='line_1_108' title="bbox 364 6430 1370 6471; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_573' title='bbox 364 6430 495 6471; x_wconf 89' lang='eng' dir='ltr'>lapsing</span> <span class='ocrx_word' id='word_1_574' title='bbox 505 6430 743 6471; x_wconf 89' lang='eng' dir='ltr'>phylogenetic</span> <span class='ocrx_word' id='word_1_575' title='bbox 756 6430 799 6460; x_wconf 97' lang='eng' dir='ltr'>tic</span> <span class='ocrx_word' id='word_1_576' title='bbox 812 6430 1024 6460; x_wconf 89' lang='eng' dir='ltr'>frozen-code</span> <span class='ocrx_word' id='word_1_577' title='bbox 1037 6430 1107 6460; x_wconf 94' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_578' title='bbox 1119 6436 1291 6471; x_wconf 90' lang='eng' dir='ltr'>ontogeny,</span> <span class='ocrx_word' id='word_1_579' title='bbox 1304 6430 1370 6460; x_wconf 94' lang='eng' dir='ltr'>and</span>
</span>
<span class='ocr_line' id='line_1_109' title="bbox 364 6488 1369 6529; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_580' title='bbox 364 6488 639 6529; x_wconf 90' lang='eng' dir='ltr'>immanentizing</span> <span class='ocrx_word' id='word_1_581' title='bbox 659 6488 713 6518; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_582' title='bbox 730 6494 805 6528; x_wconf 92' lang='eng' dir='ltr'>past</span> <span class='ocrx_word' id='word_1_583' title='bbox 825 6494 860 6518; x_wconf 96' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_584' title='bbox 878 6488 1045 6528; x_wconf 91' lang='eng' dir='ltr'>operative</span> <span class='ocrx_word' id='word_1_585' title='bbox 1064 6494 1202 6518; x_wconf 87' lang='eng' dir='ltr'>current.</span> <span class='ocrx_word' id='word_1_586' title='bbox 1223 6489 1265 6518; x_wconf 93' lang='eng' dir='ltr'>Its</span> <span class='ocrx_word' id='word_1_587' title='bbox 1285 6498 1369 6518; x_wconf 90' lang='eng' dir='ltr'>com-</span>
</span>
<span class='ocr_line' id='line_1_110' title="bbox 363 6547 1371 6588; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_588' title='bbox 363 6547 498 6587; x_wconf 94' lang='eng' dir='ltr'>petitive</span> <span class='ocrx_word' id='word_1_589' title='bbox 511 6547 723 6588; x_wconf 86' lang='eng' dir='ltr'>just-in-time</span> <span class='ocrx_word' id='word_1_590' title='bbox 741 6547 955 6577; x_wconf 92' lang='eng' dir='ltr'>innovations</span> <span class='ocrx_word' id='word_1_591' title='bbox 973 6547 1078 6577; x_wconf 96' lang='eng' dir='ltr'>delete</span> <span class='ocrx_word' id='word_1_592' title='bbox 1096 6553 1224 6588; x_wconf 89' lang='eng' dir='ltr'>storage</span> <span class='ocrx_word' id='word_1_593' title='bbox 1240 6547 1298 6577; x_wconf 93' lang='eng' dir='ltr'>CA</span> <span class='ocrx_word' id='word_1_594' title='bbox 1312 6547 1371 6577; x_wconf 95' lang='eng' dir='ltr'>CA</span>
</span>
<span class='ocr_line' id='line_1_111' title="bbox 364 6605 1369 6646; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_595' title='bbox 364 6605 517 6645; x_wconf 92' lang='eng' dir='ltr'>capacity,</span> <span class='ocrx_word' id='word_1_596' title='bbox 529 6605 576 6635; x_wconf 89' lang='eng' dir='ltr'>flu</span> <span class='ocrx_word' id='word_1_597' title='bbox 587 6605 632 6635; x_wconf 90' lang='eng' dir='ltr'>flu</span> <span class='ocrx_word' id='word_1_598' title='bbox 643 6605 689 6635; x_wconf 89' lang='eng' dir='ltr'>flu</span> <span class='ocrx_word' id='word_1_599' title='bbox 700 6605 849 6635; x_wconf 94' lang='eng' dir='ltr'>fluidizin</span> <span class='ocrx_word' id='word_1_600' title='bbox 851 6615 874 6646; x_wconf 90' lang='eng' dir='ltr'>g</span> <span class='ocrx_word' id='word_1_601' title='bbox 882 6605 1045 6646; x_wconf 89' lang='eng' dir='ltr'>energetic</span> <span class='ocrx_word' id='word_1_602' title='bbox 1054 6605 1119 6635; x_wconf 94' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_603' title='bbox 1128 6605 1369 6635; x_wconf 87' lang='eng' dir='ltr'>informational</span>
</span>
<span class='ocr_line' id='line_1_112' title="bbox 364 6663 1369 6703; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_604' title='bbox 364 6663 474 6693; x_wconf 92' lang='eng' dir='ltr'>stocks</span> <span class='ocrx_word' id='word_1_605' title='bbox 488 6663 560 6693; x_wconf 94' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_606' title='bbox 573 6663 642 6693; x_wconf 94' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_607' title='bbox 654 6663 722 6693; x_wconf 94' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_608' title='bbox 734 6673 772 6693; x_wconf 94' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_609' title='bbox 785 6663 854 6693; x_wconf 94' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_610' title='bbox 866 6663 934 6693; x_wconf 94' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_611' title='bbox 946 6673 984 6693; x_wconf 94' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_612' title='bbox 996 6663 1280 6703; x_wconf 92' lang='eng' dir='ltr'>orphan-vampire</span> <span class='ocrx_word' id='word_1_613' title='bbox 1290 6673 1324 6693; x_wconf 94' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_614' title='bbox 1337 6673 1369 6693; x_wconf 94' lang='eng' dir='ltr'>re</span>
</span>
<span class='ocr_line' id='line_1_113' title="bbox 365 6721 1370 6751; baseline 0 0; x_size 42.087334; x_descenders 12.087336; x_ascenders 8"><span class='ocrx_word' id='word_1_615' title='bbox 365 6721 556 6751; x_wconf 91' lang='eng' dir='ltr'>transversal</span> <span class='ocrx_word' id='word_1_616' title='bbox 566 6729 908 6751; x_wconf 91' lang='eng'>110111100010101010</span> <span class='ocrx_word' id='word_1_617' title='bbox 917 6721 963 6751; x_wconf 89' lang='eng' dir='ltr'>vir</span> <span class='ocrx_word' id='word_1_618' title='bbox 972 6721 1020 6751; x_wconf 91' lang='eng' dir='ltr'>vir</span> <span class='ocrx_word' id='word_1_619' title='bbox 1026 6721 1370 6751; x_wconf 85' lang='eng' dir='ltr'>virocommunication</span>
</span>
<span class='ocr_line' id='line_1_114' title="bbox 363 6778 1366 6822; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_620' title='bbox 363 6790 509 6820; x_wconf 92' lang='eng' dir='ltr'>process,</span> <span class='ocrx_word' id='word_1_621' title='bbox 529 6780 726 6821; x_wconf 89' lang='eng' dir='ltr'>expressing</span> <span class='ocrx_word' id='word_1_622' title='bbox 743 6790 761 6810; x_wconf 97' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_623' title='bbox 781 6780 914 6820; x_wconf 93' lang='eng' dir='ltr'>surplus</span> <span class='ocrx_word' id='word_1_624' title='bbox 934 6780 1028 6810; x_wconf 94' lang='eng' dir='ltr'>value</span> <span class='ocrx_word' id='word_1_625' title='bbox 1047 6780 1085 6810; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_626' title='bbox 1099 6780 1184 6810; x_wconf 96' lang='eng' dir='ltr'>code</span> <span class='ocrx_word' id='word_1_627' title='bbox 1203 6778 1366 6822; x_wconf 90' lang='eng' dir='ltr'>(content)</span>
</span>
<span class='ocr_line' id='line_1_115' title="bbox 364 6836 1367 6880; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_628' title='bbox 364 6848 398 6868; x_wconf 92' lang='eng' dir='ltr'>as</span> <span class='ocrx_word' id='word_1_629' title='bbox 417 6838 905 6878; x_wconf 94' lang='eng' dir='ltr'>xenoreplication-behaviour</span> <span class='ocrx_word' id='word_1_630' title='bbox 924 6836 1063 6880; x_wconf 94' lang='eng' dir='ltr'>(and/0r</span> <span class='ocrx_word' id='word_1_631' title='bbox 1079 6836 1284 6880; x_wconf 94' lang='eng' dir='ltr'>c0n(nective</span> <span class='ocrx_word' id='word_1_632' title='bbox 1302 6836 1367 6880; x_wconf 91' lang='eng' dir='ltr'>dis)</span>
</span>
<span class='ocr_line' id='line_1_116' title="bbox 359 6895 542 6939; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_633' title='bbox 359 6895 542 6939; x_wconf 86' lang='eng' dir='ltr'>junction).</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_20' title="bbox 362 6955 1377 8107">
<span class='ocr_line' id='line_1_117' title="bbox 425 6955 1366 6996; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_634' title='bbox 425 6956 468 6985; x_wconf 91' lang='eng' dir='ltr'>As</span> <span class='ocrx_word' id='word_1_635' title='bbox 478 6965 543 6985; x_wconf 94' lang='eng' dir='ltr'>war</span> <span class='ocrx_word' id='word_1_636' title='bbox 552 6955 710 6985; x_wconf 92' lang='eng' dir='ltr'>increases</span> <span class='ocrx_word' id='word_1_637' title='bbox 721 6955 753 6985; x_wconf 92' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_638' title='bbox 763 6955 797 6985; x_wconf 94' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_639' title='bbox 807 6955 840 6985; x_wconf 94' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_640' title='bbox 849 6955 1065 6996; x_wconf 90' lang='eng' dir='ltr'>intelligence,</span> <span class='ocrx_word' id='word_1_641' title='bbox 1074 6955 1097 6985; x_wconf 98' lang='eng' dir='ltr'>it</span> <span class='ocrx_word' id='word_1_642' title='bbox 1106 6955 1254 6985; x_wconf 92' lang='eng' dir='ltr'>becomes</span> <span class='ocrx_word' id='word_1_643' title='bbox 1265 6955 1366 6985; x_wconf 87' lang='eng' dir='ltr'>softer.</span>
</span>
<span class='ocr_line' id='line_1_118' title="bbox 367 7014 1369 7055; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_644' title='bbox 367 7015 412 7055; x_wconf 92' lang='eng' dir='ltr'>By</span> <span class='ocrx_word' id='word_1_645' title='bbox 423 7014 571 7055; x_wconf 89' lang='eng' dir='ltr'>trashing</span> <span class='ocrx_word' id='word_1_646' title='bbox 582 7014 666 7044; x_wconf 94' lang='eng' dir='ltr'>their</span> <span class='ocrx_word' id='word_1_647' title='bbox 676 7014 766 7044; x_wconf 92' lang='eng' dir='ltr'>hosts</span> <span class='ocrx_word' id='word_1_648' title='bbox 779 7014 877 7044; x_wconf 94' lang='eng' dir='ltr'>crude</span> <span class='ocrx_word' id='word_1_649' title='bbox 888 7014 1011 7044; x_wconf 93' lang='eng' dir='ltr'>viruses</span> <span class='ocrx_word' id='word_1_650' title='bbox 1023 7014 1181 7044; x_wconf 88' lang='eng' dir='ltr'>feedback</span> <span class='ocrx_word' id='word_1_651' title='bbox 1189 7014 1369 7055; x_wconf 89' lang='eng' dir='ltr'>negatively</span>
</span>
<span class='ocr_line' id='line_1_119' title="bbox 365 7071 1367 7112; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_652' title='bbox 365 7081 459 7111; x_wconf 94' lang='eng' dir='ltr'>upon</span> <span class='ocrx_word' id='word_1_653' title='bbox 477 7071 684 7107; x_wconf 92' lang='eng' dir='ltr'>themselves,</span> <span class='ocrx_word' id='word_1_654' title='bbox 703 7071 930 7112; x_wconf 89' lang='eng' dir='ltr'>autolimiting</span> <span class='ocrx_word' id='word_1_655' title='bbox 949 7071 1028 7101; x_wconf 94' lang='eng' dir='ltr'>their</span> <span class='ocrx_word' id='word_1_656' title='bbox 1045 7081 1143 7112; x_wconf 89' lang='eng' dir='ltr'>range</span> <span class='ocrx_word' id='word_1_657' title='bbox 1160 7071 1198 7101; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_658' title='bbox 1211 7081 1243 7101; x_wconf 94' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_659' title='bbox 1259 7081 1367 7112; x_wconf 91' lang='eng' dir='ltr'>regen-</span>
</span>
<span class='ocr_line' id='line_1_120' title="bbox 364 7130 1368 7170; baseline -0.001 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_660' title='bbox 364 7130 484 7160; x_wconf 94' lang='eng' dir='ltr'>erative</span> <span class='ocrx_word' id='word_1_661' title='bbox 501 7130 719 7160; x_wconf 90' lang='eng' dir='ltr'>infilitration.</span> <span class='ocrx_word' id='word_1_662' title='bbox 739 7130 847 7170; x_wconf 92' lang='eng' dir='ltr'>Crazy</span> <span class='ocrx_word' id='word_1_663' title='bbox 861 7130 999 7160; x_wconf 92' lang='eng' dir='ltr'>vandals</span> <span class='ocrx_word' id='word_1_664' title='bbox 1017 7130 1079 7160; x_wconf 93' lang='eng' dir='ltr'>like</span> <span class='ocrx_word' id='word_1_665' title='bbox 1097 7130 1201 7160; x_wconf 90' lang='eng' dir='ltr'>Ebola</span> <span class='ocrx_word' id='word_1_666' title='bbox 1217 7130 1368 7161; x_wconf 90' lang='eng' dir='ltr'>CGCGT</span>
</span>
<span class='ocr_line' id='line_1_121' title="bbox 364 7187 1366 7231; baseline 0 -12; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_667' title='bbox 364 7189 1222 7219; x_wconf 78' lang='eng' dir='ltr'>GAGCAATCGGACTCGGCTGCTGTGC&#39;ITG</span> <span class='ocrx_word' id='word_1_668' title='bbox 1238 7187 1366 7231; x_wconf 92' lang='eng' dir='ltr'>(bodies</span>
</span>
<span class='ocr_line' id='line_1_122' title="bbox 364 7245 1367 7289; baseline 0 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_669' title='bbox 364 7247 533 7277; x_wconf 92' lang='eng' dir='ltr'>dissolved</span> <span class='ocrx_word' id='word_1_670' title='bbox 543 7247 679 7287; x_wconf 92' lang='eng' dir='ltr'>quickly</span> <span class='ocrx_word' id='word_1_671' title='bbox 688 7247 760 7277; x_wconf 94' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_672' title='bbox 772 7245 879 7289; x_wconf 92' lang='eng' dir='ltr'>slime)</span> <span class='ocrx_word' id='word_1_673' title='bbox 891 7245 992 7277; x_wconf 78' lang='eng' dir='ltr'>arent</span> <span class='ocrx_word' id='word_1_674' title='bbox 1000 7257 1077 7277; x_wconf 94' lang='eng' dir='ltr'>ever</span> <span class='ocrx_word' id='word_1_675' title='bbox 1083 7247 1186 7288; x_wconf 89' lang='eng' dir='ltr'>going</span> <span class='ocrx_word' id='word_1_676' title='bbox 1197 7253 1229 7277; x_wconf 96' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_677' title='bbox 1239 7247 1333 7277; x_wconf 85' lang='eng' dir='ltr'>make</span> <span class='ocrx_word' id='word_1_678' title='bbox 1342 7247 1367 7277; x_wconf 98' lang='eng' dir='ltr'>it</span>
</span>
<span class='ocr_line' id='line_1_123' title="bbox 364 7304 1367 7345; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_679' title='bbox 364 7304 428 7345; x_wconf 90' lang='eng' dir='ltr'>big.</span> <span class='ocrx_word' id='word_1_680' title='bbox 439 7304 581 7334; x_wconf 93' lang='eng' dir='ltr'>General</span> <span class='ocrx_word' id='word_1_681' title='bbox 589 7304 748 7344; x_wconf 94' lang='eng' dir='ltr'>principle</span> <span class='ocrx_word' id='word_1_682' title='bbox 758 7304 810 7334; x_wconf 89' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_683' title='bbox 816 7304 895 7334; x_wconf 94' lang='eng' dir='ltr'>viral</span> <span class='ocrx_word' id='word_1_684' title='bbox 906 7304 1079 7334; x_wconf 89' lang='eng' dir='ltr'>take-overs</span> <span class='ocrx_word' id='word_1_685' title='bbox 1088 7304 1121 7334; x_wconf 94' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_686' title='bbox 1129 7304 1184 7334; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_687' title='bbox 1191 7304 1301 7334; x_wconf 86' lang='eng' dir='ltr'>media:</span> <span class='ocrx_word' id='word_1_688' title='bbox 1312 7304 1367 7334; x_wconf 96' lang='eng' dir='ltr'>the</span>
</span>
<span class='ocr_line' id='line_1_124' title="bbox 362 7363 1366 7404; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_689' title='bbox 362 7373 455 7393; x_wconf 92' lang='eng' dir='ltr'>more</span> <span class='ocrx_word' id='word_1_690' title='bbox 464 7363 746 7403; x_wconf 92' lang='eng' dir='ltr'>unsophisticated</span> <span class='ocrx_word' id='word_1_691' title='bbox 755 7363 810 7393; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_692' title='bbox 819 7363 1007 7404; x_wconf 89' lang='eng' dir='ltr'>contagion,</span> <span class='ocrx_word' id='word_1_693' title='bbox 1016 7363 1071 7393; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_694' title='bbox 1079 7363 1190 7404; x_wconf 90' lang='eng' dir='ltr'>bigger</span> <span class='ocrx_word' id='word_1_695' title='bbox 1200 7363 1250 7393; x_wconf 90' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_696' title='bbox 1259 7363 1366 7403; x_wconf 89' lang='eng' dir='ltr'>splash</span>
</span>
<span class='ocr_line' id='line_1_125' title="bbox 366 7419 1367 7463; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_697' title='bbox 366 7419 614 7463; x_wconf 89' lang='eng' dir='ltr'>(diversionary</span> <span class='ocrx_word' id='word_1_698' title='bbox 634 7421 750 7451; x_wconf 92' lang='eng' dir='ltr'>tactics</span> <span class='ocrx_word' id='word_1_699' title='bbox 770 7419 965 7463; x_wconf 94' lang='eng' dir='ltr'>excepted).</span> <span class='ocrx_word' id='word_1_700' title='bbox 986 7421 1367 7451; x_wconf 82' lang='eng' dir='ltr'>CAGCTACGCTATT</span>
</span>
<span class='ocr_line' id='line_1_126' title="bbox 365 7479 1366 7509; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_701' title='bbox 365 7479 1366 7509; x_wconf 90' lang='eng' dir='ltr'>CTCCGAGGCTAGATTGCAGCTACGTCGCATCG</span>
</span>
<span class='ocr_line' id='line_1_127' title="bbox 364 7543 1377 7573; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_702' title='bbox 364 7543 1377 7573; x_wconf 77' lang='eng' dir='ltr'>GGCTGACCGATGTAGGTCATGAATCTACCGAIT</span>
</span>
<span class='ocr_line' id='line_1_128' title="bbox 364 7601 1377 7632; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_703' title='bbox 364 7601 1377 7632; x_wconf 85' lang='eng' dir='ltr'>GCACATGACTTATCCACGGTCTATTCCTCGAT</span>
</span>
<span class='ocr_line' id='line_1_129' title="bbox 365 7660 1373 7690; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_704' title='bbox 365 7660 717 7690; x_wconf 90' lang='eng' dir='ltr'>GATCGCATCGGG</span> <span class='ocrx_word' id='word_1_705' title='bbox 720 7660 777 7690; x_wconf 92' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_706' title='bbox 777 7660 1248 7690; x_wconf 89' lang='eng' dir='ltr'>GACCGATGGCATCGTA</span> <span class='ocrx_word' id='word_1_707' title='bbox 1253 7660 1373 7690; x_wconf 88' lang='eng' dir='ltr'>COPY.</span>
</span>
<span class='ocr_line' id='line_1_130' title="bbox 365 7717 1375 7759; baseline -0.001 -10; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_708' title='bbox 365 7719 462 7749; x_wconf 89' lang='eng' dir='ltr'>CUT.</span> <span class='ocrx_word' id='word_1_709' title='bbox 478 7718 615 7748; x_wconf 86' lang='eng' dir='ltr'>PASTE.</span> <span class='ocrx_word' id='word_1_710' title='bbox 632 7718 748 7748; x_wconf 92' lang='eng' dir='ltr'>Subtle</span> <span class='ocrx_word' id='word_1_711' title='bbox 761 7718 886 7748; x_wconf 91' lang='eng' dir='ltr'>viruses</span> <span class='ocrx_word' id='word_1_712' title='bbox 900 7728 953 7748; x_wconf 93' lang='eng' dir='ltr'>are</span> <span class='ocrx_word' id='word_1_713' title='bbox 968 7718 1056 7755; x_wconf 92' lang='eng' dir='ltr'>slow,</span> <span class='ocrx_word' id='word_1_714' title='bbox 1071 7718 1228 7759; x_wconf 90' lang='eng' dir='ltr'>synergic,</span> <span class='ocrx_word' id='word_1_715' title='bbox 1245 7717 1375 7748; x_wconf 87' lang='eng' dir='ltr'>flexible</span>
</span>
<span class='ocr_line' id='line_1_131' title="bbox 365 7777 1374 7818; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_716' title='bbox 365 7777 432 7807; x_wconf 89' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_717' title='bbox 452 7777 585 7807; x_wconf 86' lang='eng' dir='ltr'>elusive.</span> <span class='ocrx_word' id='word_1_718' title='bbox 606 7777 697 7818; x_wconf 90' lang='eng' dir='ltr'>They</span> <span class='ocrx_word' id='word_1_719' title='bbox 716 7783 856 7807; x_wconf 90' lang='eng' dir='ltr'>execute</span> <span class='ocrx_word' id='word_1_720' title='bbox 876 7777 1036 7807; x_wconf 92' lang='eng' dir='ltr'>sensitive</span> <span class='ocrx_word' id='word_1_721' title='bbox 1056 7777 1276 7807; x_wconf 89' lang='eng' dir='ltr'>behavioural</span> <span class='ocrx_word' id='word_1_722' title='bbox 1296 7787 1374 7807; x_wconf 90' lang='eng' dir='ltr'>con-</span>
</span>
<span class='ocr_line' id='line_1_132' title="bbox 367 7834 1374 7875; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_723' title='bbox 367 7834 426 7864; x_wconf 94' lang='eng' dir='ltr'>trol</span> <span class='ocrx_word' id='word_1_724' title='bbox 442 7834 513 7864; x_wconf 89' lang='eng' dir='ltr'>that</span> <span class='ocrx_word' id='word_1_725' title='bbox 523 7834 684 7875; x_wconf 92' lang='eng' dir='ltr'>prolongs</span> <span class='ocrx_word' id='word_1_726' title='bbox 700 7834 754 7864; x_wconf 95' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_727' title='bbox 769 7834 824 7864; x_wconf 93' lang='eng' dir='ltr'>life</span> <span class='ocrx_word' id='word_1_728' title='bbox 838 7834 877 7864; x_wconf 93' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_729' title='bbox 889 7834 944 7864; x_wconf 95' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_730' title='bbox 959 7834 1183 7864; x_wconf 91' lang='eng' dir='ltr'>biomachinic</span> <span class='ocrx_word' id='word_1_731' title='bbox 1198 7844 1374 7871; x_wconf 91' lang='eng' dir='ltr'>resources,</span>
</span>
<span class='ocr_line' id='line_1_133' title="bbox 366 7892 1375 7933; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_732' title='bbox 366 7892 553 7922; x_wconf 92' lang='eng' dir='ltr'>maximizes</span> <span class='ocrx_word' id='word_1_733' title='bbox 562 7892 810 7932; x_wconf 92' lang='eng' dir='ltr'>opportunities</span> <span class='ocrx_word' id='word_1_734' title='bbox 820 7892 872 7922; x_wconf 93' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_735' title='bbox 879 7892 1118 7933; x_wconf 92' lang='eng' dir='ltr'>propogation,</span> <span class='ocrx_word' id='word_1_736' title='bbox 1129 7892 1299 7922; x_wconf 91' lang='eng' dir='ltr'>infiltrates</span> <span class='ocrx_word' id='word_1_737' title='bbox 1309 7892 1375 7922; x_wconf 92' lang='eng' dir='ltr'>and</span>
</span>
<span class='ocr_line' id='line_1_134' title="bbox 365 7951 1374 7992; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_738' title='bbox 365 7951 508 7981; x_wconf 93' lang='eng' dir='ltr'>disables</span> <span class='ocrx_word' id='word_1_739' title='bbox 526 7951 643 7981; x_wconf 94' lang='eng' dir='ltr'>hostile</span> <span class='ocrx_word' id='word_1_740' title='bbox 663 7951 806 7992; x_wconf 91' lang='eng' dir='ltr'>security</span> <span class='ocrx_word' id='word_1_741' title='bbox 824 7957 973 7992; x_wconf 94' lang='eng' dir='ltr'>systems,</span> <span class='ocrx_word' id='word_1_742' title='bbox 993 7951 1060 7981; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_743' title='bbox 1080 7951 1271 7981; x_wconf 91' lang='eng' dir='ltr'>feeds-back</span> <span class='ocrx_word' id='word_1_744' title='bbox 1287 7951 1374 7991; x_wconf 88' lang='eng' dir='ltr'>posi-</span>
</span>
<span class='ocr_line' id='line_1_135' title="bbox 367 8009 1376 8039; baseline 0 0; x_size 40.988487; x_descenders 10.988487; x_ascenders 10"><span class='ocrx_word' id='word_1_745' title='bbox 367 8009 428 8039; x_wconf 94' lang='eng' dir='ltr'>tive</span> <span class='ocrx_word' id='word_1_746' title='bbox 446 8020 608 8037; x_wconf 91' lang='eng'>-+-++-+-++</span> <span class='ocrx_word' id='word_1_747' title='bbox 625 8009 659 8039; x_wconf 88' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_748' title='bbox 675 8009 708 8039; x_wconf 92' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_749' title='bbox 724 8009 758 8039; x_wconf 92' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_750' title='bbox 774 8009 971 8039; x_wconf 89' lang='eng' dir='ltr'>innovation</span> <span class='ocrx_word' id='word_1_751' title='bbox 987 8009 1247 8039; x_wconf 91' lang='eng' dir='ltr'>technoscience.</span> <span class='ocrx_word' id='word_1_752' title='bbox 1267 8010 1305 8039; x_wconf 88' lang='eng' dir='ltr'>In</span> <span class='ocrx_word' id='word_1_753' title='bbox 1321 8009 1376 8039; x_wconf 94' lang='eng' dir='ltr'>the</span>
</span>
<span class='ocr_line' id='line_1_136' title="bbox 366 8064 1372 8107; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_754' title='bbox 366 8066 614 8103; x_wconf 91' lang='eng' dir='ltr'>macroversion,</span> <span class='ocrx_word' id='word_1_755' title='bbox 628 8076 646 8096; x_wconf 95' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_756' title='bbox 658 8075 706 8096; x_wconf 83' lang='eng' dir='ltr'>VR</span> <span class='ocrx_word' id='word_1_757' title='bbox 718 8076 800 8107; x_wconf 93' lang='eng' dir='ltr'>prey</span> <span class='ocrx_word' id='word_1_758' title='bbox 812 8066 933 8096; x_wconf 92' lang='eng' dir='ltr'>animal</span> <span class='ocrx_word' id='word_1_759' title='bbox 948 8066 1006 8096; x_wconf 95' lang='eng' dir='ltr'>hid</span> <span class='ocrx_word' id='word_1_760' title='bbox 1020 8066 1054 8096; x_wconf 88' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_761' title='bbox 1068 8066 1108 8096; x_wconf 92' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_762' title='bbox 1121 8064 1263 8107; x_wconf 79' lang='eng' dir='ltr'>enemys</span> <span class='ocrx_word' id='word_1_763' title='bbox 1276 8066 1372 8096; x_wconf 95' lang='eng' dir='ltr'>head.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_21' title="bbox 367 8124 1377 8924">
<span class='ocr_line' id='line_1_137' title="bbox 426 8124 1377 8165; baseline 0.001 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_764' title='bbox 426 8124 532 8154; x_wconf 92' lang='eng' dir='ltr'>When</span> <span class='ocrx_word' id='word_1_765' title='bbox 545 8124 687 8165; x_wconf 89' lang='eng' dir='ltr'>hunting</span> <span class='ocrx_word' id='word_1_766' title='bbox 699 8124 751 8154; x_wconf 93' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_767' title='bbox 761 8124 849 8165; x_wconf 93' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_768' title='bbox 861 8124 1056 8165; x_wconf 93' lang='eng' dir='ltr'>hypervirus</span> <span class='ocrx_word' id='word_1_769' title='bbox 1068 8124 1148 8154; x_wconf 94' lang='eng' dir='ltr'>look</span> <span class='ocrx_word' id='word_1_770' title='bbox 1158 8124 1204 8154; x_wconf 94' lang='eng' dir='ltr'>0k</span> <span class='ocrx_word' id='word_1_771' title='bbox 1215 8124 1258 8154; x_wconf 97' lang='eng' dir='ltr'>0k</span> <span class='ocrx_word' id='word_1_772' title='bbox 1269 8124 1314 8154; x_wconf 94' lang='eng' dir='ltr'>ok</span> <span class='ocrx_word' id='word_1_773' title='bbox 1325 8124 1377 8154; x_wconf 93' lang='eng' dir='ltr'>for</span>
</span>
<span class='ocr_line' id='line_1_138' title="bbox 367 8182 1374 8225; baseline -0.002 -11; x_size 41; x_descenders 11; x_ascenders 9"><span class='ocrx_word' id='word_1_774' title='bbox 367 8184 404 8214; x_wconf 89' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_775' title='bbox 416 8184 559 8225; x_wconf 91' lang='eng' dir='ltr'>primary</span> <span class='ocrx_word' id='word_1_776' title='bbox 569 8184 644 8214; x_wconf 93' lang='eng' dir='ltr'>host</span> <span class='ocrx_word' id='word_1_777' title='bbox 655 8184 793 8224; x_wconf 90' lang='eng' dir='ltr'>species,</span> <span class='ocrx_word' id='word_1_778' title='bbox 804 8184 912 8214; x_wconf 90' lang='eng' dir='ltr'>which</span> <span class='ocrx_word' id='word_1_779' title='bbox 924 8184 990 8214; x_wconf 94' lang='eng' dir='ltr'>will</span> <span class='ocrx_word' id='word_1_780' title='bbox 1004 8184 1043 8214; x_wconf 91' lang='eng' dir='ltr'>be</span> <span class='ocrx_word' id='word_1_781' title='bbox 1057 8182 1268 8224; x_wconf 85' lang='eng' dir='ltr'>undergoing</span> <span class='ocrx_word' id='word_1_782' title='bbox 1280 8183 1374 8224; x_wconf 88' lang='eng' dir='ltr'>logis-</span>
</span>
<span class='ocr_line' id='line_1_139' title="bbox 367 8241 1375 8282; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_783' title='bbox 367 8241 440 8271; x_wconf 90' lang='eng' dir='ltr'>tical</span> <span class='ocrx_word' id='word_1_784' title='bbox 454 8241 644 8271; x_wconf 93' lang='eng' dir='ltr'>behavioral</span> <span class='ocrx_word' id='word_1_785' title='bbox 659 8241 914 8281; x_wconf 90' lang='eng' dir='ltr'>sophistication</span> <span class='ocrx_word' id='word_1_786' title='bbox 932 8241 1073 8271; x_wconf 92' lang='eng' dir='ltr'>indexed</span> <span class='ocrx_word' id='word_1_787' title='bbox 1092 8241 1135 8282; x_wconf 96' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_788' title='bbox 1149 8251 1191 8271; x_wconf 92' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_789' title='bbox 1207 8241 1375 8281; x_wconf 93' lang='eng' dir='ltr'>explosive</span>
</span>
<span class='ocr_line' id='line_1_140' title="bbox 368 8300 1374 8341; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_790' title='bbox 368 8300 505 8330; x_wconf 91' lang='eng' dir='ltr'>increase</span> <span class='ocrx_word' id='word_1_791' title='bbox 518 8300 552 8330; x_wconf 88' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_792' title='bbox 562 8300 839 8330; x_wconf 90' lang='eng' dir='ltr'>communicative</span> <span class='ocrx_word' id='word_1_793' title='bbox 850 8300 1013 8341; x_wconf 92' lang='eng' dir='ltr'>intensity,</span> <span class='ocrx_word' id='word_1_794' title='bbox 1025 8300 1228 8340; x_wconf 92' lang='eng' dir='ltr'>population</span> <span class='ocrx_word' id='word_1_795' title='bbox 1238 8300 1374 8341; x_wconf 92' lang='eng' dir='ltr'>density,</span>
</span>
<span class='ocr_line' id='line_1_141' title="bbox 367 8358 1375 8399; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_796' title='bbox 367 8358 473 8388; x_wconf 92' lang='eng' dir='ltr'>sexual</span> <span class='ocrx_word' id='word_1_797' title='bbox 482 8358 761 8399; x_wconf 92' lang='eng' dir='ltr'>disorganisation,</span> <span class='ocrx_word' id='word_1_798' title='bbox 771 8358 908 8388; x_wconf 90' lang='eng' dir='ltr'>cultural</span> <span class='ocrx_word' id='word_1_799' title='bbox 917 8358 1135 8399; x_wconf 91' lang='eng' dir='ltr'>promiscuity,</span> <span class='ocrx_word' id='word_1_800' title='bbox 1144 8358 1209 8388; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_801' title='bbox 1220 8358 1375 8388; x_wconf 90' lang='eng' dir='ltr'>technical</span>
</span>
<span class='ocr_line' id='line_1_142' title="bbox 367 8415 1376 8459; baseline 0 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_802' title='bbox 367 8417 427 8447; x_wconf 94' lang='eng' dir='ltr'>sub</span> <span class='ocrx_word' id='word_1_803' title='bbox 437 8417 498 8447; x_wconf 93' lang='eng' dir='ltr'>sub</span> <span class='ocrx_word' id='word_1_804' title='bbox 508 8417 732 8447; x_wconf 92' lang='eng' dir='ltr'>subtilization</span> <span class='ocrx_word' id='word_1_805' title='bbox 743 8415 892 8459; x_wconf 92' lang='eng' dir='ltr'>(leading</span> <span class='ocrx_word' id='word_1_806' title='bbox 902 8423 936 8447; x_wconf 94' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_807' title='bbox 945 8417 1205 8458; x_wconf 91' lang='eng' dir='ltr'>neurogenomic</span> <span class='ocrx_word' id='word_1_808' title='bbox 1215 8417 1376 8447; x_wconf 91' lang='eng' dir='ltr'>feedback</span>
</span>
<span class='ocr_line' id='line_1_143' title="bbox 367 8474 1377 8515; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_809' title='bbox 367 8474 431 8504; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_810' title='bbox 450 8474 653 8504; x_wconf 88' lang='eng' dir='ltr'>fluidization</span> <span class='ocrx_word' id='word_1_811' title='bbox 671 8484 717 8504; x_wconf 92' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_812' title='bbox 733 8474 785 8504; x_wconf 82' lang='eng' dir='ltr'>off</span> <span class='ocrx_word' id='word_1_813' title='bbox 798 8484 844 8504; x_wconf 89' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_814' title='bbox 861 8474 912 8504; x_wconf 82' lang='eng' dir='ltr'>off</span> <span class='ocrx_word' id='word_1_815' title='bbox 925 8474 976 8504; x_wconf 82' lang='eng' dir='ltr'>off</span> <span class='ocrx_word' id='word_1_816' title='bbox 989 8484 1035 8504; x_wconf 92' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_817' title='bbox 1052 8474 1091 8504; x_wconf 93' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_818' title='bbox 1104 8474 1147 8504; x_wconf 95' lang='eng' dir='ltr'>all</span> <span class='ocrx_word' id='word_1_819' title='bbox 1165 8474 1377 8515; x_wconf 87' lang='eng' dir='ltr'>hard-wiring</span>
</span>
<span class='ocr_line' id='line_1_144' title="bbox 367 8531 1376 8575; baseline 0 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_820' title='bbox 367 8533 437 8563; x_wconf 92' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_821' title='bbox 456 8533 525 8563; x_wconf 92' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_822' title='bbox 543 8533 731 8574; x_wconf 89' lang='eng' dir='ltr'>cybernetic</span> <span class='ocrx_word' id='word_1_823' title='bbox 751 8531 883 8575; x_wconf 91' lang='eng' dir='ltr'>fluxes).</span> <span class='ocrx_word' id='word_1_824' title='bbox 901 8533 976 8574; x_wconf 89' lang='eng' dir='ltr'>Any</span> <span class='ocrx_word' id='word_1_825' title='bbox 994 8533 1094 8573; x_wconf 92' lang='eng' dir='ltr'>plane</span> <span class='ocrx_word' id='word_1_826' title='bbox 1112 8533 1227 8573; x_wconf 89' lang='eng' dir='ltr'>planet</span> <span class='ocrx_word' id='word_1_827' title='bbox 1245 8539 1301 8563; x_wconf 92' lang='eng' dir='ltr'>net</span> <span class='ocrx_word' id='word_1_828' title='bbox 1318 8539 1376 8563; x_wconf 92' lang='eng' dir='ltr'>net</span>
</span>
<span class='ocr_line' id='line_1_145' title="bbox 367 8591 1376 8632; baseline 0.001 -12; x_size 41; x_descenders 11; x_ascenders 8"><span class='ocrx_word' id='word_1_829' title='bbox 367 8599 820 8621; x_wconf 91' lang='eng'>00011011010010010101011</span> <span class='ocrx_word' id='word_1_830' title='bbox 832 8591 968 8632; x_wconf 87' lang='eng' dir='ltr'>hosting</span> <span class='ocrx_word' id='word_1_831' title='bbox 977 8591 1063 8621; x_wconf 90' lang='eng' dir='ltr'>such</span> <span class='ocrx_word' id='word_1_832' title='bbox 1073 8601 1115 8621; x_wconf 90' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_833' title='bbox 1126 8597 1223 8621; x_wconf 92' lang='eng' dir='ltr'>event</span> <span class='ocrx_word' id='word_1_834' title='bbox 1233 8591 1259 8621; x_wconf 92' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_835' title='bbox 1271 8591 1376 8621; x_wconf 90' lang='eng' dir='ltr'>about</span>
</span>
<span class='ocr_line' id='line_1_146' title="bbox 368 8648 1376 8692; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_836' title='bbox 368 8656 401 8680; x_wconf 97' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_837' title='bbox 412 8649 470 8690; x_wconf 88' lang='eng' dir='ltr'>flip</span> <span class='ocrx_word' id='word_1_838' title='bbox 479 8660 561 8680; x_wconf 93' lang='eng' dir='ltr'>over.</span> <span class='ocrx_word' id='word_1_839' title='bbox 573 8650 684 8680; x_wconf 92' lang='eng' dir='ltr'>CATA</span> <span class='ocrx_word' id='word_1_840' title='bbox 693 8650 915 8690; x_wconf 91' lang='eng' dir='ltr'>catastrophic</span> <span class='ocrx_word' id='word_1_841' title='bbox 925 8650 1163 8680; x_wconf 92' lang='eng' dir='ltr'>OKOOKOK</span> <span class='ocrx_word' id='word_1_842' title='bbox 1174 8650 1241 8680; x_wconf 93' lang='eng' dir='ltr'>OK</span> <span class='ocrx_word' id='word_1_843' title='bbox 1251 8660 1326 8680; x_wconf 93' lang='eng' dir='ltr'>zero</span> <span class='ocrx_word' id='word_1_844' title='bbox 1338 8648 1376 8692; x_wconf 93' lang='eng'>(0</span>
</span>
<span class='ocr_line' id='line_1_147' title="bbox 369 8706 1375 8751; baseline 0 -13; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_845' title='bbox 369 8706 431 8750; x_wconf 93' lang='eng' dir='ltr'>(or</span> <span class='ocrx_word' id='word_1_846' title='bbox 443 8706 488 8751; x_wconf 90' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_847' title='bbox 501 8706 514 8750; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_848' title='bbox 527 8706 554 8750; x_wconf 93' lang='eng'>))</span> <span class='ocrx_word' id='word_1_849' title='bbox 570 8706 598 8750; x_wconf 89' lang='eng'>((</span> <span class='ocrx_word' id='word_1_850' title='bbox 612 8706 624 8750; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_851' title='bbox 638 8706 650 8750; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_852' title='bbox 666 8706 679 8750; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_853' title='bbox 694 8706 721 8750; x_wconf 93' lang='eng'>))</span> <span class='ocrx_word' id='word_1_854' title='bbox 737 8706 748 8750; x_wconf 93' lang='eng'>)</span> <span class='ocrx_word' id='word_1_855' title='bbox 762 8706 835 8750; x_wconf 89' lang='eng' dir='ltr'>o°))</span> <span class='ocrx_word' id='word_1_856' title='bbox 848 8708 977 8738; x_wconf 87' lang='eng' dir='ltr'>K-virus</span> <span class='ocrx_word' id='word_1_857' title='bbox 989 8708 1057 8738; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_858' title='bbox 1070 8706 1156 8750; x_wconf 90' lang='eng' dir='ltr'>(RT)</span> <span class='ocrx_word' id='word_1_859' title='bbox 1171 8708 1375 8748; x_wconf 89' lang='eng' dir='ltr'>retroscripts</span>
</span>
<span class='ocr_line' id='line_1_148' title="bbox 369 8764 1374 8809; baseline 0 -13; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_860' title='bbox 369 8765 490 8809; x_wconf 93' lang='eng' dir='ltr'>(Kobe,</span> <span class='ocrx_word' id='word_1_861' title='bbox 504 8766 626 8807; x_wconf 93' lang='eng' dir='ltr'>Tokyo,</span> <span class='ocrx_word' id='word_1_862' title='bbox 643 8766 836 8796; x_wconf 93' lang='eng' dir='ltr'>Oklahoma</span> <span class='ocrx_word' id='word_1_863' title='bbox 854 8764 1010 8808; x_wconf 93' lang='eng' dir='ltr'>(Koresh,</span> <span class='ocrx_word' id='word_1_864' title='bbox 1028 8764 1227 8808; x_wconf 92' lang='eng' dir='ltr'>Koernke)).</span> <span class='ocrx_word' id='word_1_865' title='bbox 1244 8766 1374 8806; x_wconf 93' lang='eng' dir='ltr'>Apoka-</span>
</span>
<span class='ocr_line' id='line_1_149' title="bbox 368 8822 1375 8865; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_866' title='bbox 368 8824 459 8865; x_wconf 92' lang='eng' dir='ltr'>lypse</span> <span class='ocrx_word' id='word_1_867' title='bbox 478 8824 596 8864; x_wconf 92' lang='eng' dir='ltr'>spread</span> <span class='ocrx_word' id='word_1_868' title='bbox 615 8824 660 8865; x_wconf 96' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_869' title='bbox 681 8824 734 8854; x_wconf 94' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_870' title='bbox 756 8824 838 8854; x_wconf 91' lang='eng' dir='ltr'>coke</span> <span class='ocrx_word' id='word_1_871' title='bbox 859 8824 1026 8854; x_wconf 89' lang='eng' dir='ltr'>machine.</span> <span class='ocrx_word' id='word_1_872' title='bbox 1046 8822 1267 8854; x_wconf 83' lang='eng' dir='ltr'>Tomorrows</span> <span class='ocrx_word' id='word_1_873' title='bbox 1286 8834 1375 8854; x_wconf 88' lang='eng' dir='ltr'>news</span>
</span>
<span class='ocr_line' id='line_1_150' title="bbox 367 8884 858 8924; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_874' title='bbox 367 8884 529 8924; x_wconf 93' lang='eng' dir='ltr'>brews-up</span> <span class='ocrx_word' id='word_1_875' title='bbox 541 8884 575 8914; x_wconf 88' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_876' title='bbox 587 8884 706 8921; x_wconf 93' lang='eng' dir='ltr'>Korea,</span> <span class='ocrx_word' id='word_1_877' title='bbox 721 8884 858 8914; x_wconf 92' lang='eng' dir='ltr'>Kosovo</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_22' title="bbox 367 8941 1379 9101">
<span class='ocr_line' id='line_1_151' title="bbox 429 8941 1379 8982; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_878' title='bbox 429 8941 598 8982; x_wconf 92' lang='eng' dir='ltr'>Climbing</span> <span class='ocrx_word' id='word_1_879' title='bbox 615 8947 676 8971; x_wconf 94' lang='eng' dir='ltr'>out</span> <span class='ocrx_word' id='word_1_880' title='bbox 692 8941 734 8971; x_wconf 93' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_881' title='bbox 748 8951 766 8971; x_wconf 95' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_882' title='bbox 785 8941 1053 8971; x_wconf 90' lang='eng' dir='ltr'>recombination</span> <span class='ocrx_word' id='word_1_883' title='bbox 1072 8947 1251 8981; x_wconf 93' lang='eng' dir='ltr'>apparatus</span> <span class='ocrx_word' id='word_1_884' title='bbox 1269 8941 1307 8971; x_wconf 93' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_885' title='bbox 1322 8941 1379 8971; x_wconf 92' lang='eng' dir='ltr'>TA</span>
</span>
<span class='ocr_line' id='line_1_152' title="bbox 367 9001 1375 9042; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_886' title='bbox 367 9001 420 9031; x_wconf 92' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_887' title='bbox 434 9001 488 9031; x_wconf 92' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_888' title='bbox 504 9001 759 9041; x_wconf 91' lang='eng' dir='ltr'>tape-recorders</span> <span class='ocrx_word' id='word_1_889' title='bbox 778 9001 841 9031; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_890' title='bbox 859 9007 1004 9041; x_wconf 90' lang='eng' dir='ltr'>cut-ups,</span> <span class='ocrx_word' id='word_1_891' title='bbox 1021 9001 1215 9042; x_wconf 93' lang='eng' dir='ltr'>hypervirus</span> <span class='ocrx_word' id='word_1_892' title='bbox 1231 9001 1375 9031; x_wconf 91' lang='eng' dir='ltr'>infected</span>
</span>
<span class='ocr_line' id='line_1_153' title="bbox 369 9057 1375 9101; baseline 0 -12; x_size 43; x_descenders 11; x_ascenders 12"><span class='ocrx_word' id='word_1_893' title='bbox 369 9059 556 9100; x_wconf 93' lang='eng' dir='ltr'>Burroughs</span> <span class='ocrx_word' id='word_1_894' title='bbox 571 9059 605 9089; x_wconf 92' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_895' title='bbox 621 9067 706 9100; x_wconf 83' lang='eng'>1972,</span> <span class='ocrx_word' id='word_1_896' title='bbox 723 9065 757 9089; x_wconf 95' lang='eng' dir='ltr'>at</span> <span class='ocrx_word' id='word_1_897' title='bbox 772 9059 828 9089; x_wconf 94' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_898' title='bbox 843 9069 925 9099; x_wconf 91' lang='eng' dir='ltr'>cusp</span> <span class='ocrx_word' id='word_1_899' title='bbox 941 9059 980 9089; x_wconf 93' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_900' title='bbox 993 9057 1340 9101; x_wconf 83' lang='eng' dir='ltr'>K(ondratieff)-wave</span> <span class='ocrx_word' id='word_1_901' title='bbox 1355 9067 1375 9100; x_wconf 85' lang='eng'><em>9</em></span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_3' title="bbox 362 9127 1374 10513">
<p class='ocr_par' dir='ltr' id='par_1_23' title="bbox 362 9127 1374 9803">
<span class='ocr_line' id='line_1_154' title="bbox 365 9127 1374 9172; baseline 0 -13; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_902' title='bbox 365 9127 435 9172; x_wconf 94' lang='eng' dir='ltr'>(the</span> <span class='ocrx_word' id='word_1_903' title='bbox 448 9129 620 9159; x_wconf 93' lang='eng' dir='ltr'>threshold</span> <span class='ocrx_word' id='word_1_904' title='bbox 632 9129 669 9159; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_905' title='bbox 677 9128 974 9172; x_wconf 92' lang='eng' dir='ltr'>postmodernity).</span> <span class='ocrx_word' id='word_1_906' title='bbox 990 9130 1015 9159; x_wconf 95' lang='eng' dir='ltr'>It</span> <span class='ocrx_word' id='word_1_907' title='bbox 1027 9129 1155 9169; x_wconf 92' lang='eng' dir='ltr'>rapidly</span> <span class='ocrx_word' id='word_1_908' title='bbox 1164 9129 1374 9169; x_wconf 89' lang='eng' dir='ltr'>reprocessed</span>
</span>
<span class='ocr_line' id='line_1_155' title="bbox 364 9189 1374 9230; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_909' title='bbox 364 9189 405 9219; x_wconf 94' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_910' title='bbox 420 9195 523 9230; x_wconf 94' lang='eng' dir='ltr'>target</span> <span class='ocrx_word' id='word_1_911' title='bbox 536 9189 610 9219; x_wconf 93' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_912' title='bbox 623 9199 667 9219; x_wconf 93' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_913' title='bbox 681 9189 884 9230; x_wconf 93' lang='eng' dir='ltr'>intelligenic</span> <span class='ocrx_word' id='word_1_914' title='bbox 900 9199 944 9219; x_wconf 93' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_915' title='bbox 955 9199 1013 9229; x_wconf 93' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_916' title='bbox 1024 9199 1079 9229; x_wconf 91' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_917' title='bbox 1094 9199 1138 9219; x_wconf 93' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_918' title='bbox 1153 9199 1197 9219; x_wconf 93' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_919' title='bbox 1212 9199 1374 9219; x_wconf 90' lang='eng' dir='ltr'>nova-war</span>
</span>
<span class='ocr_line' id='line_1_156' title="bbox 365 9246 1372 9287; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_920' title='bbox 365 9246 561 9286; x_wconf 91' lang='eng' dir='ltr'>laboratory,</span> <span class='ocrx_word' id='word_1_921' title='bbox 570 9246 779 9287; x_wconf 93' lang='eng' dir='ltr'>volatilizing</span> <span class='ocrx_word' id='word_1_922' title='bbox 788 9246 842 9276; x_wconf 94' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_923' title='bbox 854 9246 980 9286; x_wconf 92' lang='eng' dir='ltr'>history</span> <span class='ocrx_word' id='word_1_924' title='bbox 988 9246 1026 9276; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_925' title='bbox 1032 9246 1194 9287; x_wconf 93' lang='eng' dir='ltr'>language</span> <span class='ocrx_word' id='word_1_926' title='bbox 1204 9246 1275 9276; x_wconf 93' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_927' title='bbox 1284 9246 1372 9276; x_wconf 92' lang='eng' dir='ltr'>invo-</span>
</span>
<span class='ocr_line' id='line_1_157' title="bbox 364 9305 1370 9346; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_928' title='bbox 364 9305 530 9345; x_wconf 91' lang='eng' dir='ltr'>lutionary</span> <span class='ocrx_word' id='word_1_929' title='bbox 539 9305 745 9335; x_wconf 94' lang='eng' dir='ltr'>word-virus.</span> <span class='ocrx_word' id='word_1_930' title='bbox 759 9305 931 9335; x_wconf 93' lang='eng' dir='ltr'>Mutation</span> <span class='ocrx_word' id='word_1_931' title='bbox 941 9311 990 9335; x_wconf 95' lang='eng' dir='ltr'>rat</span> <span class='ocrx_word' id='word_1_932' title='bbox 1000 9311 1047 9335; x_wconf 95' lang='eng' dir='ltr'>rat</span> <span class='ocrx_word' id='word_1_933' title='bbox 1058 9311 1106 9335; x_wconf 95' lang='eng' dir='ltr'>rat</span> <span class='ocrx_word' id='word_1_934' title='bbox 1116 9311 1164 9335; x_wconf 95' lang='eng' dir='ltr'>rat</span> <span class='ocrx_word' id='word_1_935' title='bbox 1175 9311 1259 9335; x_wconf 94' lang='eng' dir='ltr'>rates</span> <span class='ocrx_word' id='word_1_936' title='bbox 1264 9305 1370 9346; x_wconf 80' lang='eng' dir='ltr'>jump.</span>
</span>
<span class='ocr_line' id='line_1_158' title="bbox 362 9363 1373 9404; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_937' title='bbox 362 9364 479 9393; x_wconf 94' lang='eng' dir='ltr'>Vector</span> <span class='ocrx_word' id='word_1_938' title='bbox 498 9363 650 9393; x_wconf 94' lang='eng' dir='ltr'>switches</span> <span class='ocrx_word' id='word_1_939' title='bbox 670 9363 817 9404; x_wconf 94' lang='eng' dir='ltr'>through</span> <span class='ocrx_word' id='word_1_940' title='bbox 838 9363 958 9400; x_wconf 94' lang='eng' dir='ltr'>Butler,</span> <span class='ocrx_word' id='word_1_941' title='bbox 977 9363 1117 9400; x_wconf 93' lang='eng' dir='ltr'>Gibson,</span> <span class='ocrx_word' id='word_1_942' title='bbox 1136 9363 1206 9393; x_wconf 93' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_943' title='bbox 1222 9363 1373 9404; x_wconf 92' lang='eng' dir='ltr'>Cadigan</span>
</span>
<span class='ocr_line' id='line_1_159' title="bbox 364 9422 1371 9463; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_944' title='bbox 364 9422 523 9452; x_wconf 93' lang='eng' dir='ltr'>fine-tune</span> <span class='ocrx_word' id='word_1_945' title='bbox 540 9422 581 9452; x_wconf 94' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_946' title='bbox 596 9422 750 9463; x_wconf 92' lang='eng' dir='ltr'>synergic</span> <span class='ocrx_word' id='word_1_947' title='bbox 765 9422 1039 9459; x_wconf 90' lang='eng' dir='ltr'>interexcitation,</span> <span class='ocrx_word' id='word_1_948' title='bbox 1057 9422 1169 9462; x_wconf 93' lang='eng' dir='ltr'>silt-up</span> <span class='ocrx_word' id='word_1_949' title='bbox 1185 9422 1371 9462; x_wconf 90' lang='eng' dir='ltr'>cybershift-</span>
</span>
<span class='ocr_line' id='line_1_160' title="bbox 364 9478 1370 9523; baseline 0 -13; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_950' title='bbox 364 9480 527 9521; x_wconf 93' lang='eng' dir='ltr'>inducing</span> <span class='ocrx_word' id='word_1_951' title='bbox 543 9478 887 9523; x_wconf 89' lang='eng' dir='ltr'>K(uang)-potential,</span> <span class='ocrx_word' id='word_1_952' title='bbox 905 9480 972 9510; x_wconf 93' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_953' title='bbox 988 9480 1171 9510; x_wconf 92' lang='eng' dir='ltr'>trend-lock</span> <span class='ocrx_word' id='word_1_954' title='bbox 1184 9486 1267 9510; x_wconf 93' lang='eng' dir='ltr'>onto</span> <span class='ocrx_word' id='word_1_955' title='bbox 1284 9488 1370 9511; x_wconf 85' lang='eng'>11001</span>
</span>
<span class='ocr_line' id='line_1_161' title="bbox 364 9547 1371 9569; baseline 0.001 -1; x_size 41.848484; x_descenders 10.848485; x_ascenders 10.450311"><span class='ocrx_word' id='word_1_956' title='bbox 364 9547 1371 9569; x_wconf 91' lang='eng'>01001001010111101001011101011001000100010100100010</span>
</span>
<span class='ocr_line' id='line_1_162' title="bbox 364 9606 1371 9628; baseline 0 0; x_size 41.848484; x_descenders 10.848485; x_ascenders 10.450311"><span class='ocrx_word' id='word_1_957' title='bbox 364 9606 1371 9628; x_wconf 94' lang='eng'>01001001001001010010110100100100100100100100111010</span>
</span>
<span class='ocr_line' id='line_1_163' title="bbox 364 9656 1371 9696; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 9"><span class='ocrx_word' id='word_1_958' title='bbox 364 9665 1011 9686; x_wconf 97' lang='eng'>0100100100011001000101100101010</span> <span class='ocrx_word' id='word_1_959' title='bbox 1026 9656 1157 9696; x_wconf 88' lang='eng' dir='ltr'>K-punk</span> <span class='ocrx_word' id='word_1_960' title='bbox 1168 9656 1281 9696; x_wconf 91' lang='eng' dir='ltr'>pulses</span> <span class='ocrx_word' id='word_1_961' title='bbox 1291 9656 1371 9686; x_wconf 94' lang='eng' dir='ltr'>with</span>
</span>
<span class='ocr_line' id='line_1_164' title="bbox 365 9714 1372 9755; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_962' title='bbox 365 9714 828 9755; x_wconf 93' lang='eng' dir='ltr'>telematically-accelerating</span> <span class='ocrx_word' id='word_1_963' title='bbox 839 9714 1077 9754; x_wconf 93' lang='eng' dir='ltr'>neoreplicator</span> <span class='ocrx_word' id='word_1_964' title='bbox 1086 9714 1225 9754; x_wconf 93' lang='eng' dir='ltr'>plicator</span> <span class='ocrx_word' id='word_1_965' title='bbox 1234 9714 1372 9754; x_wconf 93' lang='eng' dir='ltr'>plicator</span>
</span>
<span class='ocr_line' id='line_1_165' title="bbox 363 9773 639 9803; baseline 0 0; x_size 40.558296; x_descenders 10.558295; x_ascenders 10"><span class='ocrx_word' id='word_1_966' title='bbox 363 9773 639 9803; x_wconf 93' lang='eng' dir='ltr'>contamination.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_24' title="bbox 362 9828 1370 10095">
<span class='ocr_line' id='line_1_166' title="bbox 428 9828 1370 9872; baseline 0.001 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_967' title='bbox 428 9828 595 9872; x_wconf 78' lang='eng' dir='ltr'>Looking</span> <span class='ocrx_word' id='word_1_968' title='bbox 605 9831 661 9861; x_wconf 95' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_969' title='bbox 672 9841 691 9861; x_wconf 94' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_970' title='bbox 705 9831 753 9861; x_wconf 96' lang='eng' dir='ltr'>hit</span> <span class='ocrx_word' id='word_1_971' title='bbox 766 9831 805 9861; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_972' title='bbox 815 9829 1032 9861; x_wconf 81' lang='eng' dir='ltr'>snowcrash?</span> <span class='ocrx_word' id='word_1_973' title='bbox 1045 9835 1065 9861; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_974' title='bbox 1077 9835 1138 9861; x_wconf 47' lang='eng' dir='ltr'>Wit</span> <span class='ocrx_word' id='word_1_975' title='bbox 1149 9835 1169 9861; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_976' title='bbox 1202 9835 1244 9861; x_wconf 72' lang='eng'>##</span> <span class='ocrx_word' id='word_1_977' title='bbox 1267 9836 1284 9861; x_wconf 74' lang='eng'>#</span> <span class='ocrx_word' id='word_1_978' title='bbox 1306 9836 1326 9862; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_979' title='bbox 1350 9836 1370 9862; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_167' title="bbox 362 9894 1370 9920; baseline 0 0; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_980' title='bbox 362 9894 446 9920; x_wconf 72' lang='eng'>###</span> <span class='ocrx_word' id='word_1_981' title='bbox 478 9894 849 9920; x_wconf 55' lang='eng' dir='ltr'>##W########</span> <span class='ocrx_word' id='word_1_982' title='bbox 882 9894 988 9920; x_wconf 44' lang='eng'>##1##</span> <span class='ocrx_word' id='word_1_983' title='bbox 1040 9894 1204 9920; x_wconf 69' lang='eng'>######</span> <span class='ocrx_word' id='word_1_984' title='bbox 1247 9894 1267 9920; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_985' title='bbox 1296 9894 1317 9920; x_wconf 70' lang='eng'>#</span> <span class='ocrx_word' id='word_1_986' title='bbox 1350 9894 1370 9920; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_168' title="bbox 362 9952 1369 9979; baseline 0 -1; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_987' title='bbox 362 9952 467 9978; x_wconf 70' lang='eng'>####</span> <span class='ocrx_word' id='word_1_988' title='bbox 502 9952 522 9978; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_989' title='bbox 557 9952 663 9978; x_wconf 54' lang='eng'>##1##</span> <span class='ocrx_word' id='word_1_990' title='bbox 697 9952 717 9978; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_991' title='bbox 752 9952 772 9978; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_992' title='bbox 807 9952 827 9978; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_993' title='bbox 861 9952 968 9978; x_wconf 71' lang='eng'>###</span> <span class='ocrx_word' id='word_1_994' title='bbox 1002 9952 1242 9978; x_wconf 71' lang='eng'>#######</span> <span class='ocrx_word' id='word_1_995' title='bbox 1275 9954 1293 9978; x_wconf 73' lang='eng'>#</span> <span class='ocrx_word' id='word_1_996' title='bbox 1349 9953 1369 9979; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_169' title="bbox 363 10011 1370 10037; baseline 0 0; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_997' title='bbox 363 10011 529 10037; x_wconf 71' lang='eng'>#######</span> <span class='ocrx_word' id='word_1_998' title='bbox 585 10011 732 10037; x_wconf 64' lang='eng'>#####=#</span> <span class='ocrx_word' id='word_1_999' title='bbox 798 10011 840 10037; x_wconf 70' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1000' title='bbox 861 10011 1008 10037; x_wconf 69' lang='eng'>#####</span> <span class='ocrx_word' id='word_1_1001' title='bbox 1040 10011 1080 10037; x_wconf 70' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1002' title='bbox 1112 10011 1132 10037; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1003' title='bbox 1185 10011 1205 10037; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1004' title='bbox 1238 10011 1370 10037; x_wconf 68' lang='eng'>#####</span>
</span>
<span class='ocr_line' id='line_1_170' title="bbox 362 10069 1191 10095; baseline 0 0; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_1005' title='bbox 362 10069 446 10095; x_wconf 71' lang='eng'>###</span> <span class='ocrx_word' id='word_1_1006' title='bbox 480 10069 1002 10095; x_wconf 70' lang='eng'>###############</span> <span class='ocrx_word' id='word_1_1007' title='bbox 1044 10069 1084 10095; x_wconf 70' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1008' title='bbox 1117 10069 1137 10095; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1009' title='bbox 1170 10069 1191 10095; x_wconf 70' lang='eng'>#</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_25' title="bbox 362 10123 1370 10513">
<span class='ocr_line' id='line_1_171' title="bbox 424 10123 1369 10163; baseline 0.001 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_1010' title='bbox 424 10123 469 10153; x_wconf 90' lang='eng' dir='ltr'>As</span> <span class='ocrx_word' id='word_1_1011' title='bbox 478 10123 699 10163; x_wconf 93' lang='eng' dir='ltr'>postmodern</span> <span class='ocrx_word' id='word_1_1012' title='bbox 708 10123 834 10153; x_wconf 94' lang='eng' dir='ltr'>culture</span> <span class='ocrx_word' id='word_1_1013' title='bbox 844 10133 967 10153; x_wconf 94' lang='eng' dir='ltr'>crosses</span> <span class='ocrx_word' id='word_1_1014' title='bbox 978 10129 1011 10153; x_wconf 97' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_1015' title='bbox 1020 10123 1228 10163; x_wconf 90' lang='eng' dir='ltr'>hypermania</span> <span class='ocrx_word' id='word_1_1016' title='bbox 1239 10123 1297 10153; x_wconf 91' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_1017' title='bbox 1307 10128 1369 10154; x_wconf 51' lang='eng'>##1##</span>
</span>
<span class='ocr_line' id='line_1_172' title="bbox 362 10186 1370 10213; baseline 0 -1; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_1018' title='bbox 362 10186 1288 10212; x_wconf 56' lang='eng' dir='ltr'>######################W#</span> <span class='ocrx_word' id='word_1_1019' title='bbox 1350 10187 1370 10213; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_173' title="bbox 363 10244 1368 10270; baseline 0 0; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_1020' title='bbox 363 10244 384 10270; x_wconf 70' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1021' title='bbox 416 10244 510 10270; x_wconf 71' lang='eng'>####</span> <span class='ocrx_word' id='word_1_1022' title='bbox 544 10244 779 10270; x_wconf 69' lang='eng'>#######</span> <span class='ocrx_word' id='word_1_1023' title='bbox 814 10244 834 10270; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1024' title='bbox 868 10244 1314 10270; x_wconf 56' lang='eng' dir='ltr'>##########W#</span> <span class='ocrx_word' id='word_1_1025' title='bbox 1348 10244 1368 10270; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_174' title="bbox 363 10302 1369 10329; baseline 0 -1; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_1026' title='bbox 363 10302 941 10328; x_wconf 68' lang='eng'>#################</span> <span class='ocrx_word' id='word_1_1027' title='bbox 983 10302 1043 10328; x_wconf 71' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1028' title='bbox 1084 10302 1104 10328; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1029' title='bbox 1146 10302 1305 10328; x_wconf 43' lang='eng' dir='ltr'>##fitfi</span> <span class='ocrx_word' id='word_1_1030' title='bbox 1349 10303 1369 10329; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_175' title="bbox 362 10361 1369 10387; baseline 0 0; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_1031' title='bbox 362 10361 476 10387; x_wconf 72' lang='eng'>#####</span> <span class='ocrx_word' id='word_1_1032' title='bbox 533 10361 574 10387; x_wconf 72' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1033' title='bbox 594 10361 738 10387; x_wconf 56' lang='eng'>######</span> <span class='ocrx_word' id='word_1_1034' title='bbox 777 10361 827 10387; x_wconf 71' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1035' title='bbox 847 10361 868 10387; x_wconf 70' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1036' title='bbox 888 10361 949 10387; x_wconf 51' lang='eng' dir='ltr'><em>W</em></span> <span class='ocrx_word' id='word_1_1037' title='bbox 969 10361 1009 10387; x_wconf 70' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1038' title='bbox 1036 10361 1076 10387; x_wconf 70' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1039' title='bbox 1104 10361 1124 10387; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1040' title='bbox 1143 10361 1251 10387; x_wconf 71' lang='eng'>####</span> <span class='ocrx_word' id='word_1_1041' title='bbox 1270 10361 1369 10387; x_wconf 69' lang='eng'>####</span>
</span>
<span class='ocr_line' id='line_1_176' title="bbox 362 10414 1368 10455; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_1042' title='bbox 362 10418 383 10444; x_wconf 70' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1043' title='bbox 395 10420 472 10454; x_wconf 92' lang='eng' dir='ltr'>stop</span> <span class='ocrx_word' id='word_1_1044' title='bbox 484 10420 561 10454; x_wconf 92' lang='eng' dir='ltr'>stop</span> <span class='ocrx_word' id='word_1_1045' title='bbox 573 10424 618 10455; x_wconf 94' lang='eng' dir='ltr'>go</span> <span class='ocrx_word' id='word_1_1046' title='bbox 631 10420 708 10454; x_wconf 92' lang='eng' dir='ltr'>stop</span> <span class='ocrx_word' id='word_1_1047' title='bbox 720 10424 765 10455; x_wconf 94' lang='eng' dir='ltr'>go</span> <span class='ocrx_word' id='word_1_1048' title='bbox 778 10420 854 10454; x_wconf 92' lang='eng' dir='ltr'>stop</span> <span class='ocrx_word' id='word_1_1049' title='bbox 866 10424 912 10455; x_wconf 94' lang='eng' dir='ltr'>go</span> <span class='ocrx_word' id='word_1_1050' title='bbox 924 10424 968 10455; x_wconf 93' lang='eng' dir='ltr'>go</span> <span class='ocrx_word' id='word_1_1051' title='bbox 980 10424 1059 10455; x_wconf 94' lang='eng' dir='ltr'>goes</span> <span class='ocrx_word' id='word_1_1052' title='bbox 1073 10424 1163 10451; x_wconf 92' lang='eng' dir='ltr'>nova,</span> <span class='ocrx_word' id='word_1_1053' title='bbox 1179 10414 1201 10444; x_wconf 95' lang='eng' dir='ltr'>it</span> <span class='ocrx_word' id='word_1_1054' title='bbox 1214 10414 1368 10455; x_wconf 85' lang='eng' dir='ltr'>singular-</span>
</span>
<span class='ocr_line' id='line_1_177' title="bbox 364 10472 1370 10513; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_1055' title='bbox 364 10472 429 10502; x_wconf 94' lang='eng' dir='ltr'>izes</span> <span class='ocrx_word' id='word_1_1056' title='bbox 437 10472 675 10512; x_wconf 93' lang='eng' dir='ltr'>multiplicities</span> <span class='ocrx_word' id='word_1_1057' title='bbox 682 10472 772 10502; x_wconf 94' lang='eng' dir='ltr'>cities</span> <span class='ocrx_word' id='word_1_1058' title='bbox 782 10472 871 10502; x_wconf 94' lang='eng' dir='ltr'>cities</span> <span class='ocrx_word' id='word_1_1059' title='bbox 881 10472 919 10502; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_1060' title='bbox 926 10472 1095 10512; x_wconf 92' lang='eng' dir='ltr'>invasively</span> <span class='ocrx_word' id='word_1_1061' title='bbox 1103 10472 1370 10513; x_wconf 90' lang='eng' dir='ltr'>autoreplicating</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_4' title="bbox 364 10529 1370 10634">
<p class='ocr_par' dir='ltr' id='par_1_26' title="bbox 364 10529 1370 10634">
<span class='ocr_line' id='line_1_178' title="bbox 364 10529 1365 10575; baseline -0.002 -14; x_size 42; x_descenders 11; x_ascenders 11"><span class='ocrx_word' id='word_1_1062' title='bbox 364 10531 644 10572; x_wconf 93' lang='eng' dir='ltr'>autoreplicating</span> <span class='ocrx_word' id='word_1_1063' title='bbox 652 10531 897 10571; x_wconf 89' lang='eng' dir='ltr'>plexoweapon</span> <span class='ocrx_word' id='word_1_1064' title='bbox 908 10547 930 10551; x_wconf 98' lang='eng'><em>-</em></span> <span class='ocrx_word' id='word_1_1065' title='bbox 941 10537 1074 10571; x_wconf 93' lang='eng' dir='ltr'>systems</span> <span class='ocrx_word' id='word_1_1066' title='bbox 1086 10529 1138 10574; x_wconf 70' lang='eng'>(0</span> <span class='ocrx_word' id='word_1_1067' title='bbox 1152 10530 1163 10574; x_wconf 91' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1068' title='bbox 1175 10530 1244 10575; x_wconf 89' lang='eng'>((()</span> <span class='ocrx_word' id='word_1_1069' title='bbox 1258 10529 1298 10574; x_wconf 91' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_1070' title='bbox 1312 10529 1324 10574; x_wconf 92' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1071' title='bbox 1337 10530 1365 10575; x_wconf 86' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_179' title="bbox 365 10586 1370 10634; baseline -0.006 0; x_size 59.8125; x_descenders 15.8125; x_ascenders 15.8125"><span class='ocrx_word' id='word_1_1072' title='bbox 365 10587 420 10634; x_wconf 86' lang='eng'>())</span> <span class='ocrx_word' id='word_1_1073' title='bbox 435 10589 481 10634; x_wconf 90' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_1074' title='bbox 494 10589 506 10633; x_wconf 91' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1075' title='bbox 521 10587 550 10632; x_wconf 89' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1076' title='bbox 562 10588 601 10632; x_wconf 88' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1077' title='bbox 617 10587 629 10632; x_wconf 91' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1078' title='bbox 643 10586 722 10632; x_wconf 69' lang='eng' dir='ltr'>D»)</span> <span class='ocrx_word' id='word_1_1079' title='bbox 737 10587 749 10632; x_wconf 93' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1080' title='bbox 763 10588 776 10632; x_wconf 90' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1081' title='bbox 790 10587 802 10632; x_wconf 93' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1082' title='bbox 816 10586 862 10630; x_wconf 85' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1083' title='bbox 885 10586 898 10630; x_wconf 88' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1084' title='bbox 914 10587 982 10617; x_wconf 65' lang='eng' dir='ltr'>that</span> <span class='ocrx_word' id='word_1_1085' title='bbox 993 10597 1044 10617; x_wconf 66' lang='eng' dir='ltr'>are</span> <span class='ocrx_word' id='word_1_1086' title='bbox 1056 10597 1087 10617; x_wconf 70' lang='eng' dir='ltr'>r6</span> <span class='ocrx_word' id='word_1_1087' title='bbox 1098 10597 1130 10617; x_wconf 70' lang='eng' dir='ltr'>r6</span> <span class='ocrx_word' id='word_1_1088' title='bbox 1142 10597 1174 10617; x_wconf 70' lang='eng' dir='ltr'>r6</span> <span class='ocrx_word' id='word_1_1089' title='bbox 1185 10597 1216 10617; x_wconf 70' lang='eng' dir='ltr'>r6</span> <span class='ocrx_word' id='word_1_1090' title='bbox 1229 10587 1370 10628; x_wconf 72' lang='eng' dir='ltr'>nothing</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_5' title="bbox 360 10647 1376 11679">
<p class='ocr_par' dir='ltr' id='par_1_27' title="bbox 360 10647 1376 11679">
<span class='ocr_line' id='line_1_180' title="bbox 365 10647 1367 10688; baseline -0.001 -10; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_1091' title='bbox 365 10648 500 10688; x_wconf 92' lang='eng' dir='ltr'>beyond</span> <span class='ocrx_word' id='word_1_1092' title='bbox 516 10647 598 10677; x_wconf 94' lang='eng' dir='ltr'>their</span> <span class='ocrx_word' id='word_1_1093' title='bbox 611 10657 679 10677; x_wconf 94' lang='eng' dir='ltr'>war</span> <span class='ocrx_word' id='word_1_1094' title='bbox 689 10647 786 10677; x_wconf 94' lang='eng' dir='ltr'>AGA</span> <span class='ocrx_word' id='word_1_1095' title='bbox 792 10647 889 10677; x_wconf 94' lang='eng' dir='ltr'>AGA</span> <span class='ocrx_word' id='word_1_1096' title='bbox 900 10647 1027 10688; x_wconf 93' lang='eng' dir='ltr'>against</span> <span class='ocrx_word' id='word_1_1097' title='bbox 1040 10647 1181 10687; x_wconf 92' lang='eng' dir='ltr'>security.</span> <span class='ocrx_word' id='word_1_1098' title='bbox 1195 10647 1269 10677; x_wconf 88' lang='eng' dir='ltr'>This</span> <span class='ocrx_word' id='word_1_1099' title='bbox 1281 10647 1307 10677; x_wconf 95' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_1100' title='bbox 1324 10657 1367 10677; x_wconf 93' lang='eng' dir='ltr'>no</span>
</span>
<span class='ocr_line' id='line_1_181' title="bbox 361 10706 1373 10747; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_1101' title='bbox 361 10706 478 10747; x_wconf 91' lang='eng' dir='ltr'>longer</span> <span class='ocrx_word' id='word_1_1102' title='bbox 487 10716 505 10736; x_wconf 97' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_1103' title='bbox 514 10706 668 10746; x_wconf 90' lang='eng' dir='ltr'>question</span> <span class='ocrx_word' id='word_1_1104' title='bbox 677 10716 723 10736; x_wconf 94' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_1105' title='bbox 733 10706 785 10736; x_wconf 85' lang='eng' dir='ltr'>off</span> <span class='ocrx_word' id='word_1_1106' title='bbox 790 10716 837 10736; x_wconf 94' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_1107' title='bbox 846 10706 885 10736; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_1108' title='bbox 892 10706 1092 10747; x_wconf 91' lang='eng' dir='ltr'>ideological</span> <span class='ocrx_word' id='word_1_1109' title='bbox 1103 10706 1373 10746; x_wconf 92' lang='eng' dir='ltr'>representation,</span>
</span>
<span class='ocr_line' id='line_1_182' title="bbox 361 10762 1375 10803; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_1110' title='bbox 361 10772 567 10803; x_wconf 90' lang='eng' dir='ltr'>exogeneous</span> <span class='ocrx_word' id='word_1_1111' title='bbox 577 10762 723 10802; x_wconf 94' lang='eng' dir='ltr'>political</span> <span class='ocrx_word' id='word_1_1112' title='bbox 733 10762 972 10799; x_wconf 92' lang='eng' dir='ltr'>mobilization,</span> <span class='ocrx_word' id='word_1_1113' title='bbox 984 10762 1170 10792; x_wconf 94' lang='eng' dir='ltr'>theoretical</span> <span class='ocrx_word' id='word_1_1114' title='bbox 1180 10762 1326 10802; x_wconf 94' lang='eng' dir='ltr'>critique,</span> <span class='ocrx_word' id='word_1_1115' title='bbox 1335 10767 1375 10792; x_wconf 75' lang='eng'>##</span>
</span>
<span class='ocr_line' id='line_1_183' title="bbox 360 10826 1374 10851; baseline 0 0; x_size 34.235298; x_descenders 9.2352991; x_ascenders 8.5866337"><span class='ocrx_word' id='word_1_1116' title='bbox 360 10826 555 10851; x_wconf 74' lang='eng'>########</span> <span class='ocrx_word' id='word_1_1117' title='bbox 577 10826 597 10851; x_wconf 76' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1118' title='bbox 618 10826 1227 10851; x_wconf 64' lang='eng'>######################</span> <span class='ocrx_word' id='word_1_1119' title='bbox 1271 10826 1374 10851; x_wconf 73' lang='eng'>####</span>
</span>
<span class='ocr_line' id='line_1_184' title="bbox 361 10880 1373 10921; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_1120' title='bbox 361 10885 402 10911; x_wconf 73' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1121' title='bbox 435 10885 455 10910; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1122' title='bbox 467 10885 487 10910; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1123' title='bbox 499 10885 519 10910; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1124' title='bbox 551 10885 571 10910; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1125' title='bbox 583 10885 603 10910; x_wconf 76' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1126' title='bbox 615 10885 677 10910; x_wconf 76' lang='eng'>###</span> <span class='ocrx_word' id='word_1_1127' title='bbox 734 10885 754 10910; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1128' title='bbox 777 10885 797 10910; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1129' title='bbox 844 10885 864 10910; x_wconf 76' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1130' title='bbox 876 10884 939 10910; x_wconf 54' lang='eng' dir='ltr'>#W</span> <span class='ocrx_word' id='word_1_1131' title='bbox 985 10885 1005 10910; x_wconf 76' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1132' title='bbox 1018 10890 1057 10910; x_wconf 94' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_1133' title='bbox 1070 10880 1222 10921; x_wconf 90' lang='eng' dir='ltr'>strategic</span> <span class='ocrx_word' id='word_1_1134' title='bbox 1235 10880 1373 10910; x_wconf 93' lang='eng' dir='ltr'>orienta-</span>
</span>
<span class='ocr_line' id='line_1_185' title="bbox 364 10938 1376 10979; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_1135' title='bbox 364 10938 443 10974; x_wconf 94' lang='eng' dir='ltr'>tion,</span> <span class='ocrx_word' id='word_1_1136' title='bbox 456 10938 516 10968; x_wconf 94' lang='eng' dir='ltr'>but</span> <span class='ocrx_word' id='word_1_1137' title='bbox 528 10938 564 10968; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_1138' title='bbox 573 10938 818 10968; x_wconf 94' lang='eng' dir='ltr'>decentralized</span> <span class='ocrx_word' id='word_1_1139' title='bbox 829 10938 971 10968; x_wconf 94' lang='eng' dir='ltr'>cultural</span> <span class='ocrx_word' id='word_1_1140' title='bbox 983 10938 1148 10979; x_wconf 90' lang='eng' dir='ltr'>diagrams</span> <span class='ocrx_word' id='word_1_1141' title='bbox 1163 10938 1376 10979; x_wconf 88' lang='eng' dir='ltr'>functioning</span>
</span>
<span class='ocr_line' id='line_1_186' title="bbox 362 10996 1373 11037; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_1142' title='bbox 362 11006 396 11026; x_wconf 92' lang='eng' dir='ltr'>as</span> <span class='ocrx_word' id='word_1_1143' title='bbox 407 10996 588 11026; x_wconf 92' lang='eng' dir='ltr'>immanent</span> <span class='ocrx_word' id='word_1_1144' title='bbox 599 10996 704 11026; x_wconf 89' lang='eng' dir='ltr'>forces</span> <span class='ocrx_word' id='word_1_1145' title='bbox 716 10996 755 11026; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_1146' title='bbox 762 10996 986 11037; x_wconf 90' lang='eng' dir='ltr'>antagonism.</span> <span class='ocrx_word' id='word_1_1147' title='bbox 1000 11005 1105 11026; x_wconf 89' lang='eng' dir='ltr'>K-war</span> <span class='ocrx_word' id='word_1_1148' title='bbox 1113 10996 1242 11026; x_wconf 92' lang='eng' dir='ltr'>derives</span> <span class='ocrx_word' id='word_1_1149' title='bbox 1253 10996 1292 11026; x_wconf 92' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_1150' title='bbox 1305 10996 1373 11026; x_wconf 92' lang='eng' dir='ltr'>sole</span>
</span>
<span class='ocr_line' id='line_1_187' title="bbox 362 11054 1207 11094; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_1151' title='bbox 362 11054 541 11084; x_wconf 94' lang='eng' dir='ltr'>coherence</span> <span class='ocrx_word' id='word_1_1152' title='bbox 555 11054 638 11084; x_wconf 88' lang='eng' dir='ltr'>from</span> <span class='ocrx_word' id='word_1_1153' title='bbox 653 11054 708 11084; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_1154' title='bbox 722 11054 815 11094; x_wconf 93' lang='eng' dir='ltr'>unity</span> <span class='ocrx_word' id='word_1_1155' title='bbox 828 11054 867 11084; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_1156' title='bbox 877 11054 916 11084; x_wconf 92' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_1157' title='bbox 933 11054 996 11084; x_wconf 88' lang='eng' dir='ltr'>foe.</span> <span class='ocrx_word' id='word_1_1158' title='bbox 1013 11055 1207 11084; x_wconf 92' lang='eng' dir='ltr'><a href="0.html"> RETURN.</a></span>
</span>
<span class='ocr_line' id='line_1_188' title="bbox 423 11109 1371 11155; baseline 0 -13; x_size 45; x_descenders 12; x_ascenders 13"><span class='ocrx_word' id='word_1_1159' title='bbox 423 11111 598 11150; x_wconf 92' lang='eng' dir='ltr'>Ana/Cata.</span> <span class='ocrx_word' id='word_1_1160' title='bbox 610 11112 728 11142; x_wconf 97' lang='eng' dir='ltr'>Switch</span> <span class='ocrx_word' id='word_1_1161' title='bbox 735 11110 1004 11155; x_wconf 89' lang='eng' dir='ltr'>cur((re)re)rent.</span> <span class='ocrx_word' id='word_1_1162' title='bbox 1016 11110 1044 11155; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1163' title='bbox 1054 11110 1066 11154; x_wconf 89' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1164' title='bbox 1078 11109 1106 11154; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1165' title='bbox 1116 11109 1159 11154; x_wconf 88' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1166' title='bbox 1170 11110 1235 11155; x_wconf 93' lang='eng' dir='ltr'>O(r</span> <span class='ocrx_word' id='word_1_1167' title='bbox 1241 11110 1338 11155; x_wconf 89' lang='eng' dir='ltr'>an)d(</span> <span class='ocrx_word' id='word_1_1168' title='bbox 1348 11111 1371 11155; x_wconf 89' lang='eng'>).</span>
</span>
<span class='ocr_line' id='line_1_189' title="bbox 365 11167 1372 11213; baseline 0 -13; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_1169' title='bbox 365 11168 430 11213; x_wconf 90' lang='eng' dir='ltr'>K0(</span> <span class='ocrx_word' id='word_1_1170' title='bbox 448 11171 461 11199; x_wconf 95' lang='eng' dir='ltr'>I</span> <span class='ocrx_word' id='word_1_1171' title='bbox 477 11170 588 11211; x_wconf 91' lang='eng' dir='ltr'>Ching</span> <span class='ocrx_word' id='word_1_1172' title='bbox 603 11170 781 11211; x_wconf 91' lang='eng' dir='ltr'>hexagram</span> <span class='ocrx_word' id='word_1_1173' title='bbox 811 11179 862 11211; x_wconf 78' lang='eng'>49:</span> <span class='ocrx_word' id='word_1_1174' title='bbox 882 11170 1085 11200; x_wconf 93' lang='eng' dir='ltr'>Revolution</span> <span class='ocrx_word' id='word_1_1175' title='bbox 1100 11167 1266 11212; x_wconf 91' lang='eng' dir='ltr'>(Molting</span> <span class='ocrx_word' id='word_1_1176' title='bbox 1280 11168 1309 11212; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1177' title='bbox 1326 11168 1372 11213; x_wconf 89' lang='eng'>)))</span>
</span>
<span class='ocr_line' id='line_1_190' title="bbox 363 11225 1372 11271; baseline 0 -13; x_size 45; x_descenders 12; x_ascenders 13"><span class='ocrx_word' id='word_1_1178' title='bbox 363 11228 466 11258; x_wconf 93' lang='eng' dir='ltr'>leaves</span> <span class='ocrx_word' id='word_1_1179' title='bbox 483 11225 495 11270; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1180' title='bbox 512 11226 524 11270; x_wconf 91' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1181' title='bbox 540 11228 684 11269; x_wconf 91' lang='eng' dir='ltr'>nothing</span> <span class='ocrx_word' id='word_1_1182' title='bbox 697 11227 816 11271; x_wconf 89' lang='eng' dir='ltr'>i)ntact</span> <span class='ocrx_word' id='word_1_1183' title='bbox 829 11228 945 11258; x_wconf 93' lang='eng' dir='ltr'>TACT</span> <span class='ocrx_word' id='word_1_1184' title='bbox 957 11228 1078 11258; x_wconf 91' lang='eng' dir='ltr'>TACT.</span> <span class='ocrx_word' id='word_1_1185' title='bbox 1097 11226 1141 11271; x_wconf 92' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_1186' title='bbox 1159 11226 1187 11270; x_wconf 92' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1187' title='bbox 1205 11226 1234 11270; x_wconf 92' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1188' title='bbox 1251 11227 1263 11271; x_wconf 89' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1189' title='bbox 1280 11226 1309 11270; x_wconf 92' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1190' title='bbox 1327 11226 1372 11271; x_wconf 89' lang='eng'>)))</span>
</span>
<span class='ocr_line' id='line_1_191' title="bbox 364 11284 1375 11330; baseline -0.003 0; x_size 80.018547; x_descenders 13; x_ascenders 23.018549"><span class='ocrx_word' id='word_1_1191' title='bbox 364 11286 392 11330; x_wconf 81' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1192' title='bbox 411 11285 423 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1193' title='bbox 440 11285 452 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1194' title='bbox 471 11286 515 11330; x_wconf 79' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1195' title='bbox 534 11284 561 11329; x_wconf 83' lang='eng'>(&lt;</span> <span class='ocrx_word' id='word_1_1196' title='bbox 580 11286 592 11330; x_wconf 79' lang='eng'><em>&gt;</em></span> <span class='ocrx_word' id='word_1_1197' title='bbox 610 11284 637 11329; x_wconf 81' lang='eng'>)&gt;</span> <span class='ocrx_word' id='word_1_1198' title='bbox 658 11285 670 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1199' title='bbox 689 11285 717 11329; x_wconf 83' lang='eng'>)&gt;</span> <span class='ocrx_word' id='word_1_1200' title='bbox 751 11284 780 11329; x_wconf 81' lang='eng'>&lt;&lt;</span> <span class='ocrx_word' id='word_1_1201' title='bbox 798 11286 810 11330; x_wconf 80' lang='eng'><em>)</em></span> <span class='ocrx_word' id='word_1_1202' title='bbox 830 11285 842 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1203' title='bbox 861 11285 873 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1204' title='bbox 892 11285 920 11329; x_wconf 83' lang='eng'>»</span> <span class='ocrx_word' id='word_1_1205' title='bbox 954 11284 1031 11330; x_wconf 79' lang='eng'><strong>()))</strong></span> <span class='ocrx_word' id='word_1_1206' title='bbox 1050 11285 1062 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1207' title='bbox 1081 11284 1126 11330; x_wconf 79' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1208' title='bbox 1158 11285 1375 11329; x_wconf 78' lang='eng' dir='ltr'><a href="cyberSit.html">)Cyberserk</a></span>
</span>
<span class='ocr_line' id='line_1_192' title="bbox 363 11342 1372 11387; baseline 0 -12; x_size 44; x_descenders 11; x_ascenders 13"><span class='ocrx_word' id='word_1_1209' title='bbox 363 11345 697 11386; x_wconf 91' lang='eng' dir='ltr'>repelting-slippage</span> <span class='ocrx_word' id='word_1_1210' title='bbox 719 11345 789 11375; x_wconf 94' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_1211' title='bbox 810 11345 983 11375; x_wconf 93' lang='eng' dir='ltr'>dark-side</span> <span class='ocrx_word' id='word_1_1212' title='bbox 1004 11342 1016 11387; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1213' title='bbox 1039 11342 1068 11387; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1214' title='bbox 1092 11342 1135 11386; x_wconf 89' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1215' title='bbox 1158 11345 1372 11375; x_wconf 92' lang='eng' dir='ltr'>distributive</span>
</span>
<span class='ocr_line' id='line_1_193' title="bbox 365 11400 1372 11446; baseline 0 -14; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_1216' title='bbox 365 11402 659 11443; x_wconf 81' lang='eng' dir='ltr'>ROM-scrambling</span> <span class='ocrx_word' id='word_1_1217' title='bbox 668 11402 783 11432; x_wconf 93' lang='eng' dir='ltr'>TACT</span> <span class='ocrx_word' id='word_1_1218' title='bbox 795 11402 918 11432; x_wconf 93' lang='eng' dir='ltr'>tactics.</span> <span class='ocrx_word' id='word_1_1219' title='bbox 934 11401 963 11445; x_wconf 94' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1220' title='bbox 979 11400 1005 11444; x_wconf 93' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1221' title='bbox 1019 11400 1031 11444; x_wconf 93' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1222' title='bbox 1048 11400 1060 11444; x_wconf 96' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1223' title='bbox 1074 11400 1086 11444; x_wconf 93' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1224' title='bbox 1102 11400 1114 11444; x_wconf 96' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1225' title='bbox 1128 11400 1153 11444; x_wconf 92' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1226' title='bbox 1171 11400 1199 11444; x_wconf 93' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1227' title='bbox 1213 11400 1241 11444; x_wconf 92' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1228' title='bbox 1257 11401 1269 11446; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1229' title='bbox 1283 11401 1311 11446; x_wconf 87' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1230' title='bbox 1326 11401 1372 11445; x_wconf 91' lang='eng'>(((</span>
</span>
<span class='ocr_line' id='line_1_194' title="bbox 364 11458 1372 11505; baseline 0 -1; x_size 60.254128; x_descenders 16.254128; x_ascenders 15.112474"><span class='ocrx_word' id='word_1_1231' title='bbox 364 11458 1195 11505; x_wconf 85' lang='eng'>)()))((((()((()))(((()())())(()))(((()</span> <span class='ocrx_word' id='word_1_1232' title='bbox 1212 11459 1372 11504; x_wconf 85' lang='eng'>(())((()</span>
</span>
<span class='ocr_line' id='line_1_195' title="bbox 364 11517 1372 11563; baseline -0.001 0; x_size 60.254128; x_descenders 16.254128; x_ascenders 15.112474"><span class='ocrx_word' id='word_1_1233' title='bbox 364 11517 927 11563; x_wconf 84' lang='eng'>((()))(()))))((())))((()(</span> <span class='ocrx_word' id='word_1_1234' title='bbox 970 11517 1372 11563; x_wconf 85' lang='eng'>()))(()))((())(((</span>
</span>
<span class='ocr_line' id='line_1_196' title="bbox 364 11574 1370 11622; baseline 0 -1; x_size 60.254128; x_descenders 16.254128; x_ascenders 15.112474"><span class='ocrx_word' id='word_1_1235' title='bbox 364 11577 497 11621; x_wconf 63' lang='eng' dir='ltr'>()ZCr0</span> <span class='ocrx_word' id='word_1_1236' title='bbox 509 11575 689 11619; x_wconf 69' lang='eng' dir='ltr'>Program)</span> <span class='ocrx_word' id='word_1_1237' title='bbox 706 11574 751 11618; x_wconf 85' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_1238' title='bbox 766 11575 812 11620; x_wconf 88' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1239' title='bbox 828 11575 918 11620; x_wconf 85' lang='eng'>(((()</span> <span class='ocrx_word' id='word_1_1240' title='bbox 1006 11576 1062 11621; x_wconf 72' lang='eng'>0)</span> <span class='ocrx_word' id='word_1_1241' title='bbox 1078 11577 1090 11621; x_wconf 93' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1242' title='bbox 1106 11577 1118 11621; x_wconf 93' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1243' title='bbox 1133 11576 1178 11621; x_wconf 85' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1244' title='bbox 1194 11576 1282 11622; x_wconf 86' lang='eng'>(((()</span> <span class='ocrx_word' id='word_1_1245' title='bbox 1299 11576 1328 11621; x_wconf 87' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1246' title='bbox 1343 11577 1370 11621; x_wconf 89' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_197' title="bbox 365 11634 1372 11679; baseline 0 -1; x_size 60.254128; x_descenders 16.254128; x_ascenders 15.112474"><span class='ocrx_word' id='word_1_1247' title='bbox 365 11635 442 11679; x_wconf 88' lang='eng'>(((((</span> <span class='ocrx_word' id='word_1_1248' title='bbox 456 11635 468 11679; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1249' title='bbox 484 11634 521 11679; x_wconf 83' lang='eng'>()</span> <span class='ocrx_word' id='word_1_1250' title='bbox 537 11634 683 11678; x_wconf 81' lang='eng'>)()(())((</span> <span class='ocrx_word' id='word_1_1251' title='bbox 698 11634 737 11678; x_wconf 84' lang='eng'>()</span> <span class='ocrx_word' id='word_1_1252' title='bbox 753 11634 766 11678; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1253' title='bbox 781 11634 828 11678; x_wconf 61' lang='eng' dir='ltr'>(H</span> <span class='ocrx_word' id='word_1_1254' title='bbox 842 11634 855 11663; x_wconf 64' lang='eng'></span> <span class='ocrx_word' id='word_1_1255' title='bbox 869 11634 927 11678; x_wconf 55' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1256' title='bbox 1004 11634 1051 11678; x_wconf 56' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1257' title='bbox 1068 11634 1081 11678; x_wconf 80' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1258' title='bbox 1096 11634 1150 11678; x_wconf 70' lang='eng' dir='ltr'>(O</span> <span class='ocrx_word' id='word_1_1259' title='bbox 1189 11634 1217 11678; x_wconf 77' lang='eng'>0</span> <span class='ocrx_word' id='word_1_1260' title='bbox 1255 11634 1316 11679; x_wconf 87' lang='eng'>()))</span> <span class='ocrx_word' id='word_1_1261' title='bbox 1333 11634 1372 11679; x_wconf 95' lang='eng'>((</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_6' title="bbox 1005 11664 1370 11795">
<p class='ocr_par' dir='ltr' id='par_1_28' title="bbox 801 11664 1370 11795">
<span class='ocr_line' id='line_1_198' title="bbox 1005 11664 1370 11795; baseline 0 -58; x_size 80.41758; x_descenders 7.4175825; x_ascenders 28"><span class='ocrx_word' id='word_1_1262' title='bbox 1005 11664 1370 11795; x_wconf 49' lang='eng'>§5&gt;((»&gt;&lt;(&lt;&lt;&gt;&lt;(&gt;&gt;</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_7' title="bbox 364 11518 1371 11796">
<p class='ocr_par' dir='ltr' id='par_1_29' title="bbox 931 11518 943 11562">
<span class='ocr_line' id='line_1_199' title="bbox 931 11518 943 11562; baseline 0 0; x_size 59.826088; x_descenders 14.956522; x_ascenders 14.956522"><span class='ocrx_word' id='word_1_1263' title='bbox 931 11518 943 11562; x_wconf 93' lang='eng'>)</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_30' title="bbox 935 11576 947 11620">
<span class='ocr_line' id='line_1_200' title="bbox 935 11576 947 11620; baseline 0 0; x_size 59.826088; x_descenders 14.956522; x_ascenders 14.956522"><span class='ocrx_word' id='word_1_1264' title='bbox 935 11576 947 11620; x_wconf 95' lang='eng'>(</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_31' title="bbox 933 11633 946 11678">
<span class='ocr_line' id='line_1_201' title="bbox 933 11633 946 11678; baseline 0 0; x_size 59.826088; x_descenders 14.956522; x_ascenders 14.956522"><span class='ocrx_word' id='word_1_1265' title='bbox 933 11633 946 11678; x_wconf 88' lang='eng'>(</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_32' title="bbox 364 11692 1371 11796">
<span class='ocr_line' id='line_1_202' title="bbox 364 11692 948 11738; baseline -0.003 0; x_size 59.826088; x_descenders 14.956522; x_ascenders 14.956522"><span class='ocrx_word' id='word_1_1266' title='bbox 364 11692 948 11738; x_wconf 85' lang='eng'><a href="home/doorway.html">))((())(((())((()))(((((</a>)</span>
</span>
<span class='ocr_line' id='line_1_203' title="bbox 1054 11751 1371 11796; baseline 0 0; x_size 59.826088; x_descenders 14.956522; x_ascenders 14.956522"><span class='ocrx_word' id='word_1_1267' title='bbox 1054 11751 1371 11796; x_wconf 84' lang='eng'>()))(()))((())</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_8' title="bbox 364 11575 1372 12264">
<p class='ocr_par' dir='ltr' id='par_1_33' title="bbox 364 11575 1372 12264">
<span class='ocr_line' id='line_1_204' title="bbox 962 11575 990 11619; baseline 0 0; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1268' title='bbox 962 11575 990 11619; x_wconf 89' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_205' title="bbox 959 11634 990 11678; baseline 0 0; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1269' title='bbox 959 11634 990 11678; x_wconf 85' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_206' title="bbox 908 11692 991 11737; baseline -0.012 0; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1270' title='bbox 908 11693 920 11737; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1271' title='bbox 963 11692 991 11736; x_wconf 89' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_207' title="bbox 365 11750 1004 11796; baseline 0 -1; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1272' title='bbox 365 11750 1004 11796; x_wconf 83' lang='eng'>((((()())()(())((())((())))())(</span>
</span>
<span class='ocr_line' id='line_1_208' title="bbox 365 11809 1371 11855; baseline 0 -1; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1273' title='bbox 365 11809 1371 11855; x_wconf 69' lang='eng' dir='ltr'>(((())((()))(((()(D())(()))(((()(())((((()())</span>
</span>
<span class='ocr_line' id='line_1_209' title="bbox 365 11867 1371 11913; baseline -0.001 0; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1274' title='bbox 365 11867 1210 11913; x_wconf 74' lang='eng'>()(())((())((())))())))((())))0))))((()</span> <span class='ocrx_word' id='word_1_1275' title='bbox 1246 11867 1274 11911; x_wconf 82' lang='eng'>0</span> <span class='ocrx_word' id='word_1_1276' title='bbox 1309 11867 1371 11912; x_wconf 85' lang='eng'>()))</span>
</span>
<span class='ocr_line' id='line_1_210' title="bbox 365 11925 1371 11971; baseline 0 -1; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1277' title='bbox 365 11925 1371 11971; x_wconf 87' lang='eng'>(()))((())(((())((()))(((()())())(()))(((()</span>
</span>
<span class='ocr_line' id='line_1_211' title="bbox 365 11984 1370 12030; baseline 0 -1; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1278' title='bbox 365 11986 393 12030; x_wconf 92' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1279' title='bbox 407 11985 435 12030; x_wconf 85' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1280' title='bbox 452 11985 528 12029; x_wconf 88' lang='eng'>(((((</span> <span class='ocrx_word' id='word_1_1281' title='bbox 542 11985 555 12029; x_wconf 91' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1282' title='bbox 570 11985 582 12030; x_wconf 96' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1283' title='bbox 597 11986 609 12030; x_wconf 89' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1284' title='bbox 624 11985 636 12029; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1285' title='bbox 654 11985 682 12029; x_wconf 88' lang='eng'>()</span> <span class='ocrx_word' id='word_1_1286' title='bbox 699 11985 778 12030; x_wconf 85' lang='eng'>(())(</span> <span class='ocrx_word' id='word_1_1287' title='bbox 794 11985 806 12030; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1288' title='bbox 822 11985 834 12030; x_wconf 96' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1289' title='bbox 850 11984 878 12029; x_wconf 89' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1290' title='bbox 895 11984 941 12030; x_wconf 87' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_1291' title='bbox 956 11986 968 12030; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1292' title='bbox 985 11984 1013 12029; x_wconf 84' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1293' title='bbox 1029 11985 1059 12030; x_wconf 85' lang='eng'>)(</span> <span class='ocrx_word' id='word_1_1294' title='bbox 1074 11985 1102 12029; x_wconf 89' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1295' title='bbox 1119 11984 1147 12029; x_wconf 90' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1296' title='bbox 1164 11985 1210 12030; x_wconf 87' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_1297' title='bbox 1225 11986 1237 12030; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1298' title='bbox 1253 11985 1281 12029; x_wconf 88' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1299' title='bbox 1297 11985 1327 12030; x_wconf 87' lang='eng'>)(</span> <span class='ocrx_word' id='word_1_1300' title='bbox 1342 11985 1370 12029; x_wconf 88' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_212' title="bbox 364 12042 1372 12089; baseline -0.001 0; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1301' title='bbox 364 12043 508 12089; x_wconf 84' lang='eng'>)))((()</span> <span class='ocrx_word' id='word_1_1302' title='bbox 548 12043 575 12088; x_wconf 85' lang='eng'>0</span> <span class='ocrx_word' id='word_1_1303' title='bbox 614 12042 1372 12089; x_wconf 86' lang='eng'>()))(()))((())(((())((()))(((()(</span>
</span>
<span class='ocr_line' id='line_1_213' title="bbox 365 12101 1371 12147; baseline 0 0; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1304' title='bbox 365 12101 1371 12147; x_wconf 66' lang='eng' dir='ltr'>D())(()))(((()(())((((()())()(())((())((())))(</span>
</span>
<span class='ocr_line' id='line_1_214' title="bbox 366 12159 1371 12206; baseline 0 -1; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1305' title='bbox 366 12160 435 12205; x_wconf 86' lang='eng'>))0</span> <span class='ocrx_word' id='word_1_1306' title='bbox 462 12159 1371 12206; x_wconf 76' lang='eng'>()))(0))((())(((())((()))(((()())())((</span>
</span>
<span class='ocr_line' id='line_1_215' title="bbox 366 12218 1214 12264; baseline 0 -1; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1307' title='bbox 366 12218 1214 12264; x_wconf 74' lang='eng'>)))(((()(())((((()())()(())((()))))(0))</span>
</span>
</p>
</div>
</div>
<!-- <script type="text/javascript" src="../scripts/drag.js"></script> -->
<script type="text/javascript">
var l = $('.ocr_line');
l.each( function(x){ this.title = "hypervirus"; });
var p = $('.ocr_par');
p.each( function(x){ this.title = "hypervirus"; });
var c = $('.ocr_carea');
c.each( function(x){ this.title = "hypervirus"; });
var ww = $('.ocrx_word');
ww.each( function(x){
let t = $(this).attr('title').split(" "),
left = parseInt(t[1]),
top = parseInt(t[2]);
console.log('title = ', left , top);
left *= 0.4;
top *= 0.5;
this.style.left = left + 'px';
this.style.top = top + 'px';
this.style.color = "blue;"
this.title = "hypervirus";
});
//store all class 'ocr_line' in 'lines'
var lines = document.querySelectorAll(".ocr_line");
//loop through each element in 'lines'
for (var i = 0; i < lines.length; i++){
var line = lines[i];
var words = line.querySelectorAll(".ocrx_word");
for (var e = 0; e < words.length; e++){
var span = words[e];
span.classList.add("draggable");
span.title = "hypervirus";
}
}
window.setInterval( function(){
// console.log('interval', ww);
var ra = Math.floor(ww.size()*Math.random());
var w = ww.get(ra);
// console.log(w);
var col = ["b", "w"];
var fs =["9px","15px"];
$(w).css('visibility', 'visible');
$(w).removeClass('ocrx_word');
$(w).addClass(col[Math.floor(Math.random()*col.length)]);
}, 150);
// ------------ DRAG ------------
$( function() {
$( ".draggable" ).draggable(
//{ containment: [-1300,-750,1800,1250] }
);
});
// // ------------ ZOOM -------------
// function zoom(event) {
// event.preventDefault();
// scale += event.deltaY * -0.01;
// scale = Math.min(Math.max(.125, scale), 4);
// el.style.transform = `scale(${scale})`;
// }
// let scale = 1;
// const el = document.querySelector('body');
// el.onwheel = zoom;
// CURSOR GRAB AND RELEASE
$('.draggable').on("mousedown",function(){
$('.draggable').css('cursor', 'grabbing');
}).on("mouseup mouseleave",function(){
$('.draggable').css('cursor', 'grab');
});
function randomInt2(){ return Math.ceil(Math.random() * 20);}
$(document).ready(function(){
$(".ocrx_word").hover(function(){
var n = $("this").css("color");
$(this).animate({color: "white"});
$(this).animate({fontSize: "20px"});
// $(this).animate({top: "50px"});
// $(this).animate({left: "50px"});
$(this).animate({right: randomInt2() + "px"});
$(this).animate({bottom: "50px"});
}, function(){
$(this).animate({color: "black"});
$(this).animate({fontSize: "15px"});
$(this).animate({letterSpacing: "0px"});
});
});
</script>
</body>
</html>

@ -49,9 +49,9 @@
</head> </head>
<body> <body>
<div id="vBush" class="start draggable" onclick="transition()"> <div id="vBush" class="start draggable" onclick="transition()">
<h1><a href="http://worrydream.com/refs/Bush%20-%20As%20We%20May%20Think%20(Life%20Magazine%209-10-1945).pdf" onClick="return popup(this, '000', '1000', '800','1000','500')">AS WE MAY THINK</a></h1><br> <h1><a href="http://worrydream.com/refs/Bush%20-%20As%20We%20May%20Think%20(Life%20Magazine%209-10-1945).pdf" onClick="return popup(this, '000', '1000', '800','1000','500')">AS WE MAY THINK</a></h1>
by VANNEVAR BUSH<br><br> by VANNEVAR BUSH<br><br>
THE ATLANTIC MONTHLY, JULY 1945 <br><br> THE ATLANTIC MONTHLY, JULY 1945 <br><br>
---------------------------------------------------------------------- <br><br> ---------------------------------------------------------------------- <br><br>
@ -78,7 +78,7 @@ knowledge. - The Editor <br><br>
----------------------------------------------------------------------<br><br> ----------------------------------------------------------------------<br><br>
<div id="b">
This has not been a scientist's war; it has been a war in which all This has not been a scientist's war; it has been a war in which all
have had a part. The scientists, burying their old professional have had a part. The scientists, burying their old professional
competition in the demand of a common cause, have shared greatly and competition in the demand of a common cause, have shared greatly and
@ -889,8 +889,30 @@ to wield that record for his true good. Yet, in the application of
science to the needs and desires of man, it would seem to be a science to the needs and desires of man, it would seem to be a
singularly unfortunate stage at which to terminate the process, or to singularly unfortunate stage at which to terminate the process, or to
lose hope as to the outcome. lose hope as to the outcome.
</div>
</div> </div>
<script> <script>
var rooms = ['FS01.html','Ixse.html','./0/ilinx_0.html','Ixse2.html','cyberSit.html','./home/doorway.html','./AxS/index.html'];
function rand(){ return Math.ceil(Math.random() * res.length) }
function rand2(){ return Math.ceil(Math.random() * rooms.length)-1 }
for (var i = 0; i < 200; i++) {
var str = $('#b').html();
var res = str.split(" ");
var word = res[rand()];
console.log(rand());
var newstr = str.replace(word, '<a href="'+ rooms[rand2()] + '">'+ word + '</a>');
console.log(word);
$('#b').html(newstr);
}
var div = document.getElementById("vBush"); var div = document.getElementById("vBush");
div.addEventListener("click", x => { div.addEventListener("click", x => {
@ -1020,9 +1042,13 @@ lose hope as to the outcome.
else href=mylink.href; else href=mylink.href;
var open = window.open(href, windowname, 'width=' + width + ',height='+ height + ',left=' + posX() + ',top=' + posY()); var open = window.open(href, windowname, 'width=' + width + ',height='+ height + ',left=' + posX() + ',top=' + posY());
open.focus(); open.focus();
setTimeout(function(){ open.close(); }, 15000); // setTimeout(function(){ open.close(); }, 15000);
return false; return false;
} }
</script> </script>
</body> </body>
</html> </html>

@ -0,0 +1,36 @@
<!DOCTYPE html>
<html>
<head>
<title>af</title>
<style type="text/css">
body{
font-family: mono;
color: white;
background: black;
}
</style>
</head>
<body>
<p>Professor Fassrol was widely known as a pioneer in the application of cybernetics methodologies to anthropology and mythology. His visionary approach made possible the maturation of what now we call cyber- or <a href="ve.html" onClick="return popup(this, 've', '1000', '200')">virtual ethnology</a>. In the early times of this discipline, however, the research was pursued following a direction opposite to the actual one, the technological value of this method was meant to enlight the rituals of proto-historical cultures as linguistic engines meant to produce meaning over generations.</p><br>
<script type="text/javascript">
var w = window.innerWidth;
var h = window.innerHeight;
function posX(){ return Math.ceil(Math.random() * w)-200 }
function posY(){ return Math.ceil(Math.random() * h) }
function popup(mylink, windowname, width, height) {
if (! window.focus)return true;
var href;
if (typeof(mylink) == 'string') href=mylink;
else href=mylink.href;
var open = window.open(href, windowname, 'width=' + width + ',height='+ height + ',left=' + posX() + ',top=' + posY());
open.focus();
setTimeout(function(){ open.close(); }, 60000);
return false;
}
</script>
</body>
</html>

File diff suppressed because it is too large Load Diff

@ -0,0 +1,17 @@
<!DOCTYPE html>
<html>
<head>
<title>death</title>
<style type="text/css">
body{
font-family: mono;
color: white;
background: black;
}
</style>
</head>
<body>
<p>The professor had been striken whilst returning from Java, in Indonesia; falling suddenly, as witnesses said, after his ship reached the territorial water of U.S. Doctors were unable to find any visible disorder, but concluded after perplexed debate that some obscure lesion of the heart, possibly induced by the overload of <a href="#">radio communications</a> received by the ship in the moment of crossing the free waters, has been responsible for the end of a so elderly man. <br><br>
At the time I saw no reason to dissent from this dictum but latterly I am inclined to wonder <br>- and more than wonder.</p><br>
</body>
</html>

File diff suppressed because one or more lines are too long

@ -0,0 +1,21 @@
<!DOCTYPE html>
<html>
<head>
<title>p80</title>
<style type="text/css">
body{
font-family: mono;
color: red;
background: black;
text-shadow: 2px 2px white;
font-size: 30px;
}
/* p {padding: 0;
margin: 0;}*/
</style>
</head>
<body>
<p>The sky above the port was the color of television, tuned on a dead channel</p><br>
</body>
</html>

File diff suppressed because one or more lines are too long

@ -9,11 +9,12 @@
</style> </style>
</head> </head>
<body> <body>
<a href="islands.html">islands</a> <a href="black_sea.html"> black_sea</a><br> <a href="./0/ilinx_0.html">black_sea</a> <a href="islands.html">islands</a><br>
<a href="Ixse.html">Ixse</a><br> <a href="Ixse.html">Ixse</a><br>
<a href="VB01.html">VB01</a> <a href="FS01.html"> FS01</a><br> <a href="VB01.html">VB01</a> <a href="FS01.html"> FS01</a><br>
<a href="cyberSit.html">cyberSith</a><br> <a href="cyberSit.html">cyberSith</a><br>
<a href="./home">home</a><br> <a href="./home">home</a><br>
<a href="./AxS">AxS</a> <a href="./AxS">AxS</a>
</body> </body>
</html> </html>

@ -0,0 +1,17 @@
<!DOCTYPE html>
<html>
<head>
<title>ve</title>
<style type="text/css">
body{
font-family: mono;
color: white;
background: black;
}
</style>
</head>
<body>
<h2>Virtual Ethnology</h2>
<p>Cannon</p><br>
</body>
</html>
Loading…
Cancel
Save