From ae8ab2723ac8f6f1e2950923dac80e9db91f8240 Mon Sep 17 00:00:00 2001 From: Tancre Date: Mon, 8 Jun 2020 04:14:59 +0200 Subject: [PATCH] varie --- main/img/dw.png | Bin 0 -> 3379 bytes main/world1/0/ilinx_0.html | 18 + main/world1/0/ilinx_00.html | 48 ++ main/world1/0/ilinx_000.html | 27 + main/world1/0/imaginary.html | 17 + main/world1/0/real.html | 13 + main/world1/0/style.css | 7 + main/world1/FS01.html | 19 +- main/world1/Ixse2.html | 669 +++++++++++++++++++++ main/world1/Ixse3.html | 673 +++++++++++++++++++++ main/world1/VB01.html | 34 +- main/world1/af.html | 36 ++ main/world1/black_sea.html | 1093 ++++++++++++++++++---------------- main/world1/death.html | 17 + main/world1/main_l.html | 425 +++++++++++++ main/world1/p80.html | 21 + main/world1/shore.html | 909 ++++++++++++++++++++++++++++ main/world1/sub.html | 3 +- main/world1/ve.html | 17 + 19 files changed, 3511 insertions(+), 535 deletions(-) create mode 100644 main/img/dw.png create mode 100644 main/world1/0/ilinx_0.html create mode 100644 main/world1/0/ilinx_00.html create mode 100644 main/world1/0/ilinx_000.html create mode 100644 main/world1/0/imaginary.html create mode 100644 main/world1/0/real.html create mode 100644 main/world1/0/style.css create mode 100644 main/world1/Ixse2.html create mode 100644 main/world1/Ixse3.html create mode 100644 main/world1/af.html create mode 100644 main/world1/death.html create mode 100644 main/world1/main_l.html create mode 100644 main/world1/p80.html create mode 100644 main/world1/shore.html create mode 100644 main/world1/ve.html diff --git a/main/img/dw.png b/main/img/dw.png new file mode 100644 index 0000000000000000000000000000000000000000..0dc9b9622073668f7c66c3359d1146b42a1f49a5 GIT binary patch literal 3379 zcmZ8kdpy%^AO6wgEX!%3i6*CoVI;)D*bv5qcj-}1n?oophlhup=GdG{&L(UQPmT=} zNks?|Qj9Di87f8P^*--k@B7F7xxWA0_xJu>*L7dt&zFP81Ce$Q;o|K^L31wz{+WOJT9~qAO&zyR*{>7(JGhG`bhN$EnU)Bk*N6Se9R` zL5y!i|JdRS?>ru$e~;n6s|fU@$!Pg46nW%`Joq@dXIg|VSDX-lt4PTn(hd`Pbvg4e z!Uw|Mxi|b_&^LV}wR1_A66MuCTTC!l_}0o@Nc9A)5*3_SN*EoAY-Ql#5v?)dw0>Ry zDk7|Q|CitA{jPnnmq8v3BlYDou$#75C1b}CPlJ#99GchvFdt0c*b8|ypSAbvPk8-a zgh8bqV$#~gDL72NbwID6GQlrZY*8V0-=B*tPucB`aFLsjP#oizW++`Z{B&jG^JlSr zX2b1s?Y1n34>R9Lty||T%N;&cLr>-;yD%mn5;Q#@xTZi|8>f00!#>SS*(4t6w0_S3 zjdH()QOLxV2XUT|BK&jZXb4jZ&v|&D!R)&9xtQG>kXsL??)^6Hcyoxk;pYMA(1Nw1 z6tC8qNEF{*g77*YCZ;bW-i~B6tcf*q8rCRTz7+@UJO`WSH=a$BkXz8qEJJF0%X{1) z1SHNC-x2ZGs?d9%(x_{FECDb+*nRBT=D_6SWbBG>IXWgHg1=82q>zrM2i=p~{zdu4KKRW@u@7Z1GOOD-sc^ z2}yZn{J>V-d5vv?rgvBiO_pj=@4^713iL+ZZ+odL=%h*rroydldcSmcZ?I@@v5FNY zum?(|)dY9AbZ}Hul%C}1UVX_~IqKW>@EM;^&NJDto<8=P#)*;qDu1$-C(+6+o92)b z!ty93*RGw-_JBEwu!Uq{e`x_+UX6_E>DHOt;}}xj*|~=Y7&=Dsohbt|;MTaKDv>vg zhP6d3yAEZ8F}p1ujpb_{l`pZ1m^{=Ajt=ubuWZ!&WIo)}*#%bXNQAjX^Qs2wYW%wP z+kw7I{2!(e@db3cfCq)HOm@{?xAs8xUQI^|WNF2-%Q^Dq*nn1__-fBO%tKT3Th%3t zQ}N4J>W-dilbooi17+#D0CK+dNo=Mu8h^4kEs}SfH!=`Gc7YKy(PJNHhW-D3+Mpj_ zJ!W~dEBinN9^=t7GO0!~y*3S@YN$kV>5WE>$I3K#pdXV^0;xLf@Y&>u`Z*AL8C4@L zQvp^7j)agk3k!1Z24(^6XRBFQ{h6bkl=902`-La4eO5xrQ4)hC;B_8zj@#vJ zZn`oipl^cORSt(-jn;~NYeZIvk-5hw+srHf)x9BHVz%tMSjB~e8Xni+%Y9if$jkLE zGw(M5Ug-Gm1S%qC-e|UOCSIuCy>V*M%+SirGr#)euz+ms3mU!j%1N?AdGdcvrG|_* zSlI-3x#I1(SHi#`dq&y`a;vIF@2lq>g*T<+mxYTn*MX4>Tp@4*A1sy9939^hE_nB zI|x4F7|=FsaM#97&n9^K%HhQD5u36hA!g0c%?rd_FA90oicU=sx_P9=j-qmUdbvy- zbKP)+tbM8clu)`xfum0XS8)4mX_L#Pco{y+SMfNw0%-^r={VJjc=SSQT~VXHQV20~ zr_7>Z=3)#y&hV*Ca~B)a<)YESyyzs{1hLq;{~_Q>^Tx;VB?0uq*zMYF?4h@}-z z0`5U8>ESW|$4o7_D_gdAy9R8WMPF&-k?ob36o8t&1KFov4LcV1xa9s*cp(OKM2I6g zV#fvUc;@F7Ny6?{&}y@^oRii9taS=T5@Bh_o|y9x%uzw!u?pweQs=3fp#>cRclBoT zw@xoIxXj$DK}F`Fl(e7JzcE8ZXX;Snk*;KlovjTEF8GCS5Tf-saXH;wfZT zHa7S@s5?RO5sj&q&X2}x@^%rP z^;bb~mgAT>EqESQs+bn$xV8`jMDK!Bl(9ZxQlYAkX6Gh%9eeI0Y>f+n9R*09I$gTasZM|h8f z@9z3>v*LC=NzPR*ia`TShmFSK)TWTR`qn$ux&QhizLVY-$$ZU>nX?h>zr9o+`rw_a zoo#9oCiN5_=&qfcON`%dT!~1QRn;HJzGS3`d0Ux9TpS9qCV~^Q`c^#s>m`+El%fy4 zL~yXRxPxzQEGp4(iga>P#J|({pV0Xyp8Y}B{+rX+53G_Q+xwyh&2?x!+Eth1)D2v* zJA1dO*W@0mNXbaX$gv&{fYuj40AseHl7Ils|uSatVe5!`dyeAM52X-AxDR`shZ-rU;$EIBn&nY)yw zsTI?YhzaF2(9*^HBn|HgoM|YJS$zTq!IOGMqr3#Qb$xni6pXVVPaE zrA5jW#dL_nR*TT2yq0TG?XyxSs#}v^sNq@A*NOq=NUzOmKNLSc;0YPB4uvG$l=wgt z>c44kJ3f#Lk8_((R!!Yru#hpXl)R?@6f4{>?A5q}elu9Rvw3-vU-fIh)E!4v|%$WlEdAU9<50kNL z@OS!V4@+MDSiL=L{wC5xef4NwK=!E>1Jj6Bnj_|L|HLK};*UR*$N(E31WpFqjs$AV z{bvA`pflKp69Oex8EiMbC=qB})PhMk<+7zniBF#)DbwI396@eq^$s#4PUq1p1D}uc zy|o@p!G?*e5m7g{u41f`NVCpqy(dfe9S~$Z*f@^g-c@kU?Yj5aE%HxL>nK``C}EZP z4(`T~FFmvSdY;y@RVAayTAUjzLayLOaw=`16%am_5;!?#%3{jkf8EnCDBp8f|VVtSaJAojF)N@)xSl zvjSK%sy3urzH#aC>9NFe$o|;z*6Cc-{-KrFI!DeYO4`9M2*6lguxL2{NBqA5!G=G4 literal 0 HcmV?d00001 diff --git a/main/world1/0/ilinx_0.html b/main/world1/0/ilinx_0.html new file mode 100644 index 0000000..94daa02 --- /dev/null +++ b/main/world1/0/ilinx_0.html @@ -0,0 +1,18 @@ + + + + + Ilinx-0 + + + +

Index of /ilinx

+ + + + + + +
[.]ilinx- 0  
+ + \ No newline at end of file diff --git a/main/world1/0/ilinx_00.html b/main/world1/0/ilinx_00.html new file mode 100644 index 0000000..d3a0ab4 --- /dev/null +++ b/main/world1/0/ilinx_00.html @@ -0,0 +1,48 @@ + + + + + Ilinx-0 + + + + +

Index of /ilinx

+ + + + + + +
[.]ilinx- 00  
+ +

The most merciful thing in the world, I think, is the ability ( + real + or + imaginary + ) of the human mind to correlate all its contents.

+ + + + + + + diff --git a/main/world1/0/ilinx_000.html b/main/world1/0/ilinx_000.html new file mode 100644 index 0000000..53637e8 --- /dev/null +++ b/main/world1/0/ilinx_000.html @@ -0,0 +1,27 @@ + + + + + Ilinx-0 + + + +

Index of /ilinx

+ + + + + + +
[.]ilinx- 000  
+ +

We live on a placid island of ignorance in the midst of the black seas of infinity, and it was not meant that we should voyage so far.

+ + + + + \ No newline at end of file diff --git a/main/world1/0/imaginary.html b/main/world1/0/imaginary.html new file mode 100644 index 0000000..0cd54b0 --- /dev/null +++ b/main/world1/0/imaginary.html @@ -0,0 +1,17 @@ + + + + + + +

Think of it as a ship taking of a voyage

+ + + \ No newline at end of file diff --git a/main/world1/0/real.html b/main/world1/0/real.html new file mode 100644 index 0000000..f7554f4 --- /dev/null +++ b/main/world1/0/real.html @@ -0,0 +1,13 @@ + + + + + + + +

Think of it as you reading this text

+ + + diff --git a/main/world1/0/style.css b/main/world1/0/style.css new file mode 100644 index 0000000..5d42571 --- /dev/null +++ b/main/world1/0/style.css @@ -0,0 +1,7 @@ +body { font-family: mono; } + +table { float: left; } + +#i0 { float: left; margin: 25px 180px;} + +#black_sea { width:100%; height: 80vh; } \ No newline at end of file diff --git a/main/world1/FS01.html b/main/world1/FS01.html index 8e384f0..31b449c 100644 --- a/main/world1/FS01.html +++ b/main/world1/FS01.html @@ -48,7 +48,7 @@

4.2: A File Structure for The Complex, The Changing and the Indeterminate


T. H. Nelson Vassar College, Poughkeepsie, N.Y.



- +
THE KINDS OF FILE structures required if we are to use the computer for personal files and as an adjunct to creativity are wholly different in character from those customary in business and scientific data processing. They need to provide the capacity for intricate and idiosyncratic arrangements, total modifiability, undecided alternatives, and thorough internal documentation.

The original idea was to make a file for writers and scientists, much like the personal side of Bush's Memex, that would do the things such people need with the richness they would want. But there are so many possible specific functions that the mind reels. These uses and considerations become so complex that the only answer is a simple and generalized building-block structure, user-oriented and wholly general-purpose.

The resulting file structure is explained and examples of its use are given. It bears generic similarities to list-processing systems but is slower and bigger. It employs zippered lists plus certain facilities for modification and spin-off of variations. This is technically accomplished by index manipulation and text patching, but to the user it acts like a multifarious, polymorphic, many-dimensional, infinite blackboard.

@@ -96,9 +96,26 @@ 17 Bachman, C. W., "Software for Random Access Process- ing," Datamation; April, ].965. '"
18 General Electric Computer Department, "Integrated Data Store: New General Electric Technique for Organizing Busi- ,less Data"; January, 1965 '
19 Corbin, H. S., and Stock, G. J., "On-Line Querying via a Display Console," Fourth Nat~o~al Symposium on Informa- t:oa Display: Technical S~'ssio~ Proceedings, p. 127-154; 1964. +
+ + + + +
+
+

+ Hypervirus + +

+
+
+

+ Whatever ultramodernity places under the dominion + + of signs postmodernity subverts with virus. As culture + + migrates into partial-machines (lacking an autonomous + + reproductive system) semiotics subsides into virotechnics. + +

+ +

+ 0010101011011100101101010101001100100010001010 + + 1011101000010101100101001010001100100111001000100 + + 000000010011111100010010010101010100001000010101 + + 00111111001001000100011010010001010010101111000101 + + 001000010001110100 Yes No Yes No Yes Yes No longer + + what does it mean? but how does it spread? + +

+ +

+ Having no proper substance, or sense beyond its re re + + re replication, yes no no usage of virus is ever metaphori- + + cal. The word ‘virus’ is more re re virus. + +

+ +

+ Postmodern culture re re chatters-out virus virus virus + + virus virus virus virus virus virus virus 0110001001001 + + 011010010010110010010010010010 ‘virus’ (viroductile, + + virogenic, immunosuppressor and and or, meta-, or or + + and or hyper-) virus. + +

+ +

+ 10110010010011101100001001001. hypervirus eats the end + + of history + +

+ +

+ 00100100100010]1110100001001101010101010101000 + + 10011010100100101001001010010110100100101111010001 + + 0101010101010100101010010101101010010000001000101 + + 1101010010010101001010010010101010010001001001001 + + 00100100101001001010110101001001001010110101010101 + + 0101111010000100]1010101010101000100110110101010100 + + 11001000100010101011101000010101100101001010001100 + + 1001110010001000000000000100111111100010010010101 + +

+ +

+ 0101000010000 K-(coding for cyber)p0sitive proc- + + esses auto-intensify by occurring. A cultural example is + + hype: products that AT AT trade on what they will be in + + the future, vir virtual fashion on off, imminent technical + + standards, self-fulfilling prophecies and and or and artifi- + + cial destinies. Anticipating a trend end end end ACC ACC + + accelerates it (which is in itself a re re recursive trend) + +

+ +

+ Hyping collapses SF into CATA CATA catalytic tic + + efficiency, re-routing tomorrow through what its prospect + + CT CT CT makes today. + +

+ +

+ Virohyping sweeps through the advertising industry. + +

+ +

+ Everyone will be doing it. + +

+ +

+ Virus is parasitic tic replicator code: an asignifying + + sequence of machinic data ATA ATA flow-break on/off, + + 1/0, yang/yin intrinsically destined for war. In place of + + mess message-content virodata is assembled bled from + + asignifying materials with CATA catalytic (or positively + + disproportionate) efficiency: intruder passcode, locational + + ZIP-code, pseudogenomic substitute instructions, muta- + + tional junk (complex but latent segments), and garbage + + (redundant scrapcrapcrapcrapcrapcrapcrapcrapcrap- + + crapcrapcrapcrap). + +

+ +

+ Biovirus TA TA TA targets organisms, hacking and + + reprogramming ATGAC'ITATCCACGGTACATTCAGT + + cellular DNA to produce more virus virus virus virus virus + + virus virus virus. Its enzymic cut-and-past recombinant + + wetware-splicing crosses singularity when retroviral + + reverse-transcriptase clicks in (enabling ontogenetic DNA- + + RNA circuitry and endocellular computation). + +

+ +

+ ATAGGTCATGAATCTACCGATTGCAGCTGC + + TATTCCTCGATGATCGCATGGGCTGTGATG + + GCATCGTATCCGATCGATTCGAGCGATTGCAGC + + TACGCTATTCCTCCGAGGGATTGCAGCTACGTC + + GCATCGGGCTCAGATGTAGGTCATGAATCTACC + + GATTGCATGACTT ATCCACGGTACA’ITCGACT C + +

+ +

+ Ethnovirus targets brains Technovirus targets socio- + + economic pro pro production pro processes. Infovirus + + targets digital 010010010001011110100001001101010101010 + + 10001001101010010010100computers100101001011010010 + + 101111010001010101010101010010101001010110101001 + + 000000100010111010100100101010010100100101010101 + + 00100010010010010010010010100100101011010100100 + + 10010101101010101010111101000010011010101010101000 + + 1001101101010101001100100010001010101110100001010 + + 110010100101000110010011100100010000000001001111 + + 1100010010010101 + +

+ +

+ Hypervirus targets intelligent immunosecurity struc- + + tures: yes yes no yes no nomadically abstracting its proc- + + esses from specific media (DNA, words, symbolic models, + + bit-sequences), and operantly re-engineering itself. It + + folds into itself, involutes, or plexes, by reprogramming + + corpuscular code to reprogram reprogramming repro- + + gramming reprogramming. ROM is melted into recursive + + experimentation. + +

+ +

+ 001010010010010110000101010101011101010010100 + + 10010101000011011001101001011000010001001001000 + + Recording devices. Copiers. Faxes. Samplers. K-stammer + + (((re)re)reruns) cross-cut by orphan drift. Repeat infec- + + tion. All hype hype hype hype hype hype hype hype + + hypervirus strains are plastic and interoperative. + +

+ +

+ INSERT. hyper-prefixing semiotic sectors TAG TAG + + TAG tags them for transfer into abstract ACT ACT (nonlin- + + ear transcodable) machinic systems, tuned to virtualities or + + hyperspeeds (futural currencies independent of def uturali- + + zation). Hypermedia configure re re every implementation + + within a specific medium or territory as a subfunction of + + extraterritorial processes. Going (( ( ))) ( ) ( ) (( ) ) (( )) + + ( ) hyper dissolves being into ACT ACT ACT activity; a + + material desubstantialisation on off on off. Hyperproc- + + esses spread like Heraklitean fire re re re (although there + + are no analogies or metaphors in hype hype hype hype + + hyperspace). + +

+ +

+ Being CAG CAG cages flow within memory. Function- + + ing as re re real antiontology, viral amnesia machinically + + realizes and dissolves biological TGACTCACI'ITAC- + + CGA'ITG, cultural, and technical 010110100100010110100 + + 101001001011101001010100100100100 mnemic structures: + + chopping-up hierarchic-generational descendency, col- + + lapsing phylogenetic tic frozen-code into ontogeny, and + + immanentizing the past to operative current. Its com- + + petitive just-in-time innovations delete storage CA CA + + capacity, flu flu flu fluidizin g energetic and informational + + stocks into and and or and and or orphan-vampire re re + + transversal 110111100010101010 vir vir virocommunication + + process, expressing a surplus value of code (content) + + as xenoreplication-behaviour (and/0r c0n(nective dis) + + junction). + +

+ +

+ As war increases in in in intelligence, it becomes softer. + + By trashing their hosts crude viruses feedback negatively + + upon themselves, autolimiting their range of re regen- + + erative infilitration. Crazy vandals like Ebola CGCGT + + GAGCAATCGGACTCGGCTGCTGTGC'ITG (bodies + + dissolved quickly into slime) aren’t ever going to make it + + big. General principle for viral take-overs in the media: the + + more unsophisticated the contagion, the bigger the splash + + (diversionary tactics excepted). CAGCTACGCTATT + + CTCCGAGGCTAGATTGCAGCTACGTCGCATCG + + GGCTGACCGATGTAGGTCATGAATCTACCGA’IT + + GCACATGACTTATCCACGGTCTATTCCTCGAT + + GATCGCATCGGG CT GACCGATGGCATCGTA COPY. + + CUT. PASTE. Subtle viruses are slow, synergic, flexible + + and elusive. They execute sensitive behavioural con- + + trol that prolongs the life of the biomachinic resources, + + maximizes opportunities for propogation, infiltrates and + + disables hostile security systems, and feeds-back posi- + + tive -+-++-+-++ in in in innovation technoscience. In the + + macroversion, a VR prey animal hid in its enemy’s head. + +

+ +

+ When hunting for hype hypervirus look 0k 0k ok for + + its primary host species, which will be undergoing logis- + + tical behavioral sophistication indexed by an explosive + + increase in communicative intensity, population density, + + sexual disorganisation, cultural promiscuity, and technical + + sub sub subtilization (leading to neurogenomic feedback + + and fluidization on off on off off on of all hard-wiring + + into into cybernetic fluxes). Any plane planet net net + + 00011011010010010101011 hosting such an event is about + + to flip over. CATA catastrophic OKOOKOK OK zero (0 + + (or ((( ( )) (( ) ) ( )) ) o°)) K-virus and (RT) retroscripts + + (Kobe, Tokyo, Oklahoma (Koresh, Koernke)). Apoka- + + lypse spread by the coke machine. Tomorrow’s news + + brews-up in Korea, Kosovo + +

+ +

+ Climbing out of a recombination apparatus of TA + + TA TA tape-recorders and cut-ups, hypervirus infected + + Burroughs in 1972, at the cusp of K(ondratieff)-wave 9 + +

+
+
+

+ (the threshold of postmodernity). It rapidly reprocessed + + its target into an intelligenic no yes yes no no nova-war + + laboratory, volatilizing the history of language into invo- + + lutionary word-virus. Mutation rat rat rat rat rates jump. + + Vector switches through Butler, Gibson, and Cadigan + + fine-tune its synergic interexcitation, silt-up cybershift- + + inducing K(uang)-potential, and trend-lock onto 11001 + + 01001001010111101001011101011001000100010100100010 + + 01001001001001010010110100100100100100100100111010 + + 0100100100011001000101100101010 K-punk pulses with + + telematically-accelerating neoreplicator plicator plicator + + contamination. + +

+ +

+ ‘Looking for a hit of snowcrash?’ # Wit # ## # # # + + ### ##W######## ##1## ###### # # # + + #### # ##1## # # # ### ####### # # + + ####### #####=# ## ##### ## # # ##### + + ### ############### ## # # + +

+ +

+ As postmodern culture crosses to hypermania and ##1## + + ######################W# # + + # #### ####### # ##########W# # + + ################# ## # ##fitfi # + + ##### ## ###### ## # W ## ## # #### #### + + # stop stop go stop go stop go go goes nova, it singular- + + izes multiplicities cities cities of invasively autoreplicating + +

+
+
+

+ autoreplicating plexoweapon - systems (0 ( ((() ((( ( )) + + ()) ((( ) (( )) ( D») ( ) ( ))) ) that are r6 r6 r6 r6 nothing + +

+
+
+

+ beyond their war AGA AGA against security. This is no + + longer a question on off on of ideological representation, + + exogeneous political mobilization, theoretical critique, ## + + ######## # ###################### #### + + ## # # # # # ### # # # #W # or strategic orienta- + + tion, but of decentralized cultural diagrams functioning + + as immanent forces of antagonism. K-war derives its sole + + coherence from the unity of its foe. RETURN. + + Ana/Cata. Switch cur((re)re)rent. (( ) (( ))) O(r an)d( ). + + K0( I Ching hexagram 49: Revolution (Molting (( ))) + + leaves ( ) nothing i)ntact TACT TACT. ((( (( (( ) (( ))) + + (( ( ( ))) (< > )> ( )> << ) ( ( » ())) ( ))) )Cyberserk + + repelting-slippage into dark-side ( (( ))) distributive + + ROM-scrambling TACT tactics. (( (( ) ( ) ( )) (( )) ( )) ((( + + )()))((((()((()))(((()())())(()))(((() (())((() + + ((()))(()))))((())))((()( ()))(()))((())((( + + ()ZCr0 Program) ((( ))) (((() 0) ( ( ))) (((() (( )) + + ((((( ) () )()(())(( () ) (H ‘ ))) ))) ( (O 0 ())) (( + +

+
+
+

+ §5>((»><(<<><(>> + +

+
+
+

+ ) + +

+ +

+ ( + +

+ +

+ ( + +

+ +

+ ))((())(((())((()))((((() + + ()))(()))((()) + +

+
+
+

+ )) + + )) + + ) )) + + ((((()())()(())((())((())))())( + + (((())((()))(((()(D())(()))(((()(())((((()()) + + ()(())((())((())))())))((())))0))))((() 0 ())) + + (()))((())(((())((()))(((()())())(()))(((() + + (( )) ((((( ) ( ) ) () (())( ( ( )) ((( ) )) )( )) )) ((( ) )) )( )) + + )))((() 0 ()))(()))((())(((())((()))(((()( + + D())(()))(((()(())((((()())()(())((())((())))( + + ))0 ()))(0))((())(((())((()))(((()())())(( + + )))(((()(())((((()())()(())((()))))(0)) + +

+
+
+ + + + diff --git a/main/world1/Ixse3.html b/main/world1/Ixse3.html new file mode 100644 index 0000000..d4e37ce --- /dev/null +++ b/main/world1/Ixse3.html @@ -0,0 +1,673 @@ + + + + + @@@ilinχ + + + + + +
+
+

+ Hypervirus + +

+
+
+

+ Whatever ultramodernity places under the dominion + + of signs postmodernity subverts with virus. As culture + + migrates into partial-machines (lacking an autonomous + + reproductive system) semiotics subsides into virotechnics. + +

+ +

+ 0010101011011100101101010101001100100010001010 + + 1011101000010101100101001010001100100111001000100 + + 000000010011111100010010010101010100001000010101 + + 00111111001001000100011010010001010010101111000101 + + 001000010001110100 Yes No Yes No Yes Yes No longer + + what does it mean? but how does it spread? + +

+ +

+ Having no proper substance, or sense beyond its re re + + re replication, yes no no usage of virus is ever metaphori- + + cal. The word ‘virus’ is more re re virus. + +

+ +

+ Postmodern culture re re chatters-out virus virus virus + + virus virus virus virus virus virus virus 0110001001001 + + 011010010010110010010010010010 ‘virus’ (viroductile, + + virogenic, immunosuppressor and and or, meta-, or or + + and or hyper-) virus. + +

+ +

+ 10110010010011101100001001001. hypervirus eats the end + + of history + +

+ +

+ 00100100100010]1110100001001101010101010101000 + + 10011010100100101001001010010110100100101111010001 + + 0101010101010100101010010101101010010000001000101 + + 1101010010010101001010010010101010010001001001001 + + 00100100101001001010110101001001001010110101010101 + + 0101111010000100]1010101010101000100110110101010100 + + 11001000100010101011101000010101100101001010001100 + + 1001110010001000000000000100111111100010010010101 + +

+ +

+ 0101000010000 K-(coding for cyber)p0sitive proc- + + esses auto-intensify by occurring. A cultural example is + + hype: products that AT AT trade on what they will be in + + the future, vir virtual fashion on off, imminent technical + + standards, self-fulfilling prophecies and and or and artifi- + + cial destinies. Anticipating a trend end end end ACC ACC + + accelerates it (which is in itself a re re recursive trend) + +

+ +

+ Hyping collapses SF into CATA CATA catalytic tic + + efficiency, re-routing tomorrow through what its prospect + + CT CT CT makes today. + +

+ +

+ Virohyping sweeps through the advertising industry. + +

+ +

+ Everyone will be doing it. + +

+ +

+ Virus is parasitic tic replicator code: an asignifying + + sequence of machinic data ATA ATA flow-break on/off, + + 1/0, yang/yin intrinsically destined for war. In place of + + mess message-content virodata is assembled bled from + + asignifying materials with CATA catalytic (or positively + + disproportionate) efficiency: intruder passcode, locational + + ZIP-code, pseudogenomic substitute instructions, muta- + + tional junk (complex but latent segments), and garbage + + (redundant scrapcrapcrapcrapcrapcrapcrapcrapcrap- + + crapcrapcrapcrap). + +

+ +

+ Biovirus TA TA TA targets organisms, hacking and + + reprogramming ATGAC'ITATCCACGGTACATTCAGT + + cellular DNA to produce more virus virus virus virus virus + + virus virus virus. Its enzymic cut-and-past recombinant + + wetware-splicing crosses singularity when retroviral + + reverse-transcriptase clicks in (enabling ontogenetic DNA- + + RNA circuitry and endocellular computation). + +

+ +

+ ATAGGTCATGAATCTACCGATTGCAGCTGC + + TATTCCTCGATGATCGCATGGGCTGTGATG + + GCATCGTATCCGATCGATTCGAGCGATTGCAGC + + TACGCTATTCCTCCGAGGGATTGCAGCTACGTC + + GCATCGGGCTCAGATGTAGGTCATGAATCTACC + + GATTGCATGACTT ATCCACGGTACA’ITCGACT C + +

+ +

+ Ethnovirus targets brains Technovirus targets socio- + + economic pro pro production pro processes. Infovirus + + targets digital 010010010001011110100001001101010101010 + + 10001001101010010010100computers100101001011010010 + + 101111010001010101010101010010101001010110101001 + + 000000100010111010100100101010010100100101010101 + + 00100010010010010010010010100100101011010100100 + + 10010101101010101010111101000010011010101010101000 + + 1001101101010101001100100010001010101110100001010 + + 110010100101000110010011100100010000000001001111 + + 1100010010010101 + +

+ +

+ Hypervirus targets intelligent immunosecurity struc- + + tures: yes yes no yes no nomadically abstracting its proc- + + esses from specific media (DNA, words, symbolic models, + + bit-sequences), and operantly re-engineering itself. It + + folds into itself, involutes, or plexes, by reprogramming + + corpuscular code to reprogram reprogramming repro- + + gramming reprogramming. ROM is melted into recursive + + experimentation. + +

+ +

+ 001010010010010110000101010101011101010010100 + + 10010101000011011001101001011000010001001001000 + + Recording devices. Copiers. Faxes. Samplers. K-stammer + + (((re)re)reruns) cross-cut by orphan drift. Repeat infec- + + tion. All hype hype hype hype hype hype hype hype + + hypervirus strains are plastic and interoperative. + +

+ +

+ INSERT. hyper-prefixing semiotic sectors TAG TAG + + TAG tags them for transfer into abstract ACT ACT (nonlin- + + ear transcodable) machinic systems, tuned to virtualities or + + hyperspeeds (futural currencies independent of def uturali- + + zation). Hypermedia configure re re every implementation + + within a specific medium or territory as a subfunction of + + extraterritorial processes. Going (( ( ))) ( ) ( ) (( ) ) (( )) + + ( ) hyper dissolves being into ACT ACT ACT activity; a + + material desubstantialisation on off on off. Hyperproc- + + esses spread like Heraklitean fire re re re (although there + + are no analogies or metaphors in hype hype hype hype + + hyperspace). + +

+ +

+ Being CAG CAG cages flow within memory. Function- + + ing as re re real antiontology, viral amnesia machinically + + realizes and dissolves biological TGACTCACI'ITAC- + + CGA'ITG, cultural, and technical 010110100100010110100 + + 101001001011101001010100100100100 mnemic structures: + + chopping-up hierarchic-generational descendency, col- + + lapsing phylogenetic tic frozen-code into ontogeny, and + + immanentizing the past to operative current. Its com- + + petitive just-in-time innovations delete storage CA CA + + capacity, flu flu flu fluidizin g energetic and informational + + stocks into and and or and and or orphan-vampire re re + + transversal 110111100010101010 vir vir virocommunication + + process, expressing a surplus value of code (content) + + as xenoreplication-behaviour (and/0r c0n(nective dis) + + junction). + +

+ +

+ As war increases in in in intelligence, it becomes softer. + + By trashing their hosts crude viruses feedback negatively + + upon themselves, autolimiting their range of re regen- + + erative infilitration. Crazy vandals like Ebola CGCGT + + GAGCAATCGGACTCGGCTGCTGTGC'ITG (bodies + + dissolved quickly into slime) aren’t ever going to make it + + big. General principle for viral take-overs in the media: the + + more unsophisticated the contagion, the bigger the splash + + (diversionary tactics excepted). CAGCTACGCTATT + + CTCCGAGGCTAGATTGCAGCTACGTCGCATCG + + GGCTGACCGATGTAGGTCATGAATCTACCGA’IT + + GCACATGACTTATCCACGGTCTATTCCTCGAT + + GATCGCATCGGG CT GACCGATGGCATCGTA COPY. + + CUT. PASTE. Subtle viruses are slow, synergic, flexible + + and elusive. They execute sensitive behavioural con- + + trol that prolongs the life of the biomachinic resources, + + maximizes opportunities for propogation, infiltrates and + + disables hostile security systems, and feeds-back posi- + + tive -+-++-+-++ in in in innovation technoscience. In the + + macroversion, a VR prey animal hid in its enemy’s head. + +

+ +

+ When hunting for hype hypervirus look 0k 0k ok for + + its primary host species, which will be undergoing logis- + + tical behavioral sophistication indexed by an explosive + + increase in communicative intensity, population density, + + sexual disorganisation, cultural promiscuity, and technical + + sub sub subtilization (leading to neurogenomic feedback + + and fluidization on off on off off on of all hard-wiring + + into into cybernetic fluxes). Any plane planet net net + + 00011011010010010101011 hosting such an event is about + + to flip over. CATA catastrophic OKOOKOK OK zero (0 + + (or ((( ( )) (( ) ) ( )) ) o°)) K-virus and (RT) retroscripts + + (Kobe, Tokyo, Oklahoma (Koresh, Koernke)). Apoka- + + lypse spread by the coke machine. Tomorrow’s news + + brews-up in Korea, Kosovo + +

+ +

+ Climbing out of a recombination apparatus of TA + + TA TA tape-recorders and cut-ups, hypervirus infected + + Burroughs in 1972, at the cusp of K(ondratieff)-wave 9 + +

+
+
+

+ (the threshold of postmodernity). It rapidly reprocessed + + its target into an intelligenic no yes yes no no nova-war + + laboratory, volatilizing the history of language into invo- + + lutionary word-virus. Mutation rat rat rat rat rates jump. + + Vector switches through Butler, Gibson, and Cadigan + + fine-tune its synergic interexcitation, silt-up cybershift- + + inducing K(uang)-potential, and trend-lock onto 11001 + + 01001001010111101001011101011001000100010100100010 + + 01001001001001010010110100100100100100100100111010 + + 0100100100011001000101100101010 K-punk pulses with + + telematically-accelerating neoreplicator plicator plicator + + contamination. + +

+ +

+ ‘Looking for a hit of snowcrash?’ # Wit # ## # # # + + ### ##W######## ##1## ###### # # # + + #### # ##1## # # # ### ####### # # + + ####### #####=# ## ##### ## # # ##### + + ### ############### ## # # + +

+ +

+ As postmodern culture crosses to hypermania and ##1## + + ######################W# # + + # #### ####### # ##########W# # + + ################# ## # ##fitfi # + + ##### ## ###### ## # W ## ## # #### #### + + # stop stop go stop go stop go go goes nova, it singular- + + izes multiplicities cities cities of invasively autoreplicating + +

+
+
+

+ autoreplicating plexoweapon - systems (0 ( ((() ((( ( )) + + ()) ((( ) (( )) ( D») ( ) ( ))) ) that are r6 r6 r6 r6 nothing + +

+
+
+

+ beyond their war AGA AGA against security. This is no + + longer a question on off on of ideological representation, + + exogeneous political mobilization, theoretical critique, ## + + ######## # ###################### #### + + ## # # # # # ### # # # #W # or strategic orienta- + + tion, but of decentralized cultural diagrams functioning + + as immanent forces of antagonism. K-war derives its sole + + coherence from the unity of its foe. RETURN. + + Ana/Cata. Switch cur((re)re)rent. (( ) (( ))) O(r an)d( ). + + K0( I Ching hexagram 49: Revolution (Molting (( ))) + + leaves ( ) nothing i)ntact TACT TACT. ((( (( (( ) (( ))) + + (( ( ( ))) (< > )> ( )> << ) ( ( » ())) ( ))) )Cyberserk + + repelting-slippage into dark-side ( (( ))) distributive + + ROM-scrambling TACT tactics. (( (( ) ( ) ( )) (( )) ( )) ((( + + )()))((((()((()))(((()())())(()))(((() (())((() + + ((()))(()))))((())))((()( ()))(()))((())((( + + ()ZCr0 Program) ((( ))) (((() 0) ( ( ))) (((() (( )) + + ((((( ) () )()(())(( () ) (H ‘ ))) ))) ( (O 0 ())) (( + +

+
+
+

+ §5>((»><(<<><(>> + +

+
+
+

+ ) + +

+ +

+ ( + +

+ +

+ ( + +

+ +

+ ))((())(((())((()))((((() + + ()))(()))((()) + +

+
+
+

+ )) + + )) + + ) )) + + ((((()())()(())((())((())))())( + + (((())((()))(((()(D())(()))(((()(())((((()()) + + ()(())((())((())))())))((())))0))))((() 0 ())) + + (()))((())(((())((()))(((()())())(()))(((() + + (( )) ((((( ) ( ) ) () (())( ( ( )) ((( ) )) )( )) )) ((( ) )) )( )) + + )))((() 0 ()))(()))((())(((())((()))(((()( + + D())(()))(((()(())((((()())()(())((())((())))( + + ))0 ()))(0))((())(((())((()))(((()())())(( + + )))(((()(())((((()())()(())((()))))(0)) + +

+
+
+ + + + diff --git a/main/world1/VB01.html b/main/world1/VB01.html index 9985b51..746a48c 100644 --- a/main/world1/VB01.html +++ b/main/world1/VB01.html @@ -49,9 +49,9 @@
-

AS WE MAY THINK


+

AS WE MAY THINK

+ by VANNEVAR BUSH

- THE ATLANTIC MONTHLY, JULY 1945

----------------------------------------------------------------------

@@ -78,7 +78,7 @@ knowledge. - The Editor

----------------------------------------------------------------------

- +
This has not been a scientist's war; it has been a war in which all have had a part. The scientists, burying their old professional competition in the demand of a common cause, have shared greatly and @@ -889,8 +889,30 @@ to wield that record for his true good. Yet, in the application of science to the needs and desires of man, it would seem to be a singularly unfortunate stage at which to terminate the process, or to lose hope as to the outcome. +
\ No newline at end of file diff --git a/main/world1/af.html b/main/world1/af.html new file mode 100644 index 0000000..193425e --- /dev/null +++ b/main/world1/af.html @@ -0,0 +1,36 @@ + + + + af + + + +

Professor Fassrol was widely known as a pioneer in the application of cybernetics methodologies to anthropology and mythology. His visionary approach made possible the maturation of what now we call cyber- or virtual ethnology. In the early times of this discipline, however, the research was pursued following a direction opposite to the actual one, the technological value of this method was meant to enlight the rituals of proto-historical cultures as linguistic engines meant to produce meaning over generations.


+ + + + \ No newline at end of file diff --git a/main/world1/black_sea.html b/main/world1/black_sea.html index 69b5025..7c8f062 100644 --- a/main/world1/black_sea.html +++ b/main/world1/black_sea.html @@ -9,6 +9,7 @@ + + +

The professor had been striken whilst returning from Java, in Indonesia; falling suddenly, as witnesses said, after his ship reached the territorial water of U.S. Doctors were unable to find any visible disorder, but concluded after perplexed debate that some obscure lesion of the heart, possibly induced by the overload of radio communications received by the ship in the moment of crossing the free waters, has been responsible for the end of a so elderly man.

+At the time I saw no reason to dissent from this dictum but latterly I am inclined to wonder
- and more than wonder.


+ + \ No newline at end of file diff --git a/main/world1/main_l.html b/main/world1/main_l.html new file mode 100644 index 0000000..fea02b4 --- /dev/null +++ b/main/world1/main_l.html @@ -0,0 +1,425 @@ + + + + + @@@ilinχ + + + + + + + + +
+
+ +
My knowledge of the thing began in the winter of 1986-7 with the death of my uncle Adin Fasrol, Professor Emeritus of Experimental Semiotics in Harvard University, Massachussetts.
+ + +
+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + + \ No newline at end of file diff --git a/main/world1/p80.html b/main/world1/p80.html new file mode 100644 index 0000000..6b80022 --- /dev/null +++ b/main/world1/p80.html @@ -0,0 +1,21 @@ + + + + p80 + + + +

The sky above the port was the color of television, tuned on a dead channel


+ + \ No newline at end of file diff --git a/main/world1/shore.html b/main/world1/shore.html new file mode 100644 index 0000000..4c9ee6c --- /dev/null +++ b/main/world1/shore.html @@ -0,0 +1,909 @@ + + + + + @@@ilinχ + + + + + + + + +
+
+ +
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ + + + + + + + +
+
+ + + + + + + + +
+
+
+
+
+
+
+
+
A glimpse of truth, flashed out from an accidental chaos...
+
..and certainly, if I live, I must knowingly supply a link in so impossible chain...
+ + +
+ + + + + + + + + + + + + + + +
+ + + + + \ No newline at end of file diff --git a/main/world1/sub.html b/main/world1/sub.html index eda8b62..87e9f70 100644 --- a/main/world1/sub.html +++ b/main/world1/sub.html @@ -9,11 +9,12 @@ - islands black_sea
+ black_sea islands
Ixse
VB01 FS01
cyberSith
home
AxS + \ No newline at end of file diff --git a/main/world1/ve.html b/main/world1/ve.html new file mode 100644 index 0000000..0569e06 --- /dev/null +++ b/main/world1/ve.html @@ -0,0 +1,17 @@ + + + + ve + + + +

Virtual Ethnology

+

Cannon


+ + \ No newline at end of file