diff --git a/main/img/dw.png b/main/img/dw.png new file mode 100644 index 0000000..0dc9b96 Binary files /dev/null and b/main/img/dw.png differ diff --git a/main/world1/0/ilinx_0.html b/main/world1/0/ilinx_0.html new file mode 100644 index 0000000..94daa02 --- /dev/null +++ b/main/world1/0/ilinx_0.html @@ -0,0 +1,18 @@ + + +
+ +ilinx | - | 0 | ||
ilinx | - | 00 | ||
The most merciful thing in the world, I think, is the ability ( + real + or + imaginary + ) of the human mind to correlate all its contents.
+ + + + + + + diff --git a/main/world1/0/ilinx_000.html b/main/world1/0/ilinx_000.html new file mode 100644 index 0000000..53637e8 --- /dev/null +++ b/main/world1/0/ilinx_000.html @@ -0,0 +1,27 @@ + + + + +ilinx | - | 000 | ||
We live on a placid island of ignorance in the midst of the black seas of infinity, and it was not meant that we should voyage so far.
+ + + + + \ No newline at end of file diff --git a/main/world1/0/imaginary.html b/main/world1/0/imaginary.html new file mode 100644 index 0000000..0cd54b0 --- /dev/null +++ b/main/world1/0/imaginary.html @@ -0,0 +1,17 @@ + + + + + + +Think of it as a ship taking of a voyage
+ + + \ No newline at end of file diff --git a/main/world1/0/real.html b/main/world1/0/real.html new file mode 100644 index 0000000..f7554f4 --- /dev/null +++ b/main/world1/0/real.html @@ -0,0 +1,13 @@ + + + + + + + +Think of it as you reading this text
+ + + diff --git a/main/world1/0/style.css b/main/world1/0/style.css new file mode 100644 index 0000000..5d42571 --- /dev/null +++ b/main/world1/0/style.css @@ -0,0 +1,7 @@ +body { font-family: mono; } + +table { float: left; } + +#i0 { float: left; margin: 25px 180px;} + +#black_sea { width:100%; height: 80vh; } \ No newline at end of file diff --git a/main/world1/FS01.html b/main/world1/FS01.html index 8e384f0..31b449c 100644 --- a/main/world1/FS01.html +++ b/main/world1/FS01.html @@ -48,7 +48,7 @@+ Hypervirus + +
++ Whatever ultramodernity places under the dominion + + of signs postmodernity subverts with virus. As culture + + migrates into partial-machines (lacking an autonomous + + reproductive system) semiotics subsides into virotechnics. + +
+ ++ 0010101011011100101101010101001100100010001010 + + 1011101000010101100101001010001100100111001000100 + + 000000010011111100010010010101010100001000010101 + + 00111111001001000100011010010001010010101111000101 + + 001000010001110100 Yes No Yes No Yes Yes No longer + + what does it mean? but how does it spread? + +
+ ++ Having no proper substance, or sense beyond its re re + + re replication, yes no no usage of virus is ever metaphori- + + cal. The word ‘virus’ is more re re virus. + +
+ ++ Postmodern culture re re chatters-out virus virus virus + + virus virus virus virus virus virus virus 0110001001001 + + 011010010010110010010010010010 ‘virus’ (viroductile, + + virogenic, immunosuppressor and and or, meta-, or or + + and or hyper-) virus. + +
+ ++ 10110010010011101100001001001. hypervirus eats the end + + of history + +
+ ++ 00100100100010]1110100001001101010101010101000 + + 10011010100100101001001010010110100100101111010001 + + 0101010101010100101010010101101010010000001000101 + + 1101010010010101001010010010101010010001001001001 + + 00100100101001001010110101001001001010110101010101 + + 0101111010000100]1010101010101000100110110101010100 + + 11001000100010101011101000010101100101001010001100 + + 1001110010001000000000000100111111100010010010101 + +
+ ++ 0101000010000 K-(coding for cyber)p0sitive proc- + + esses auto-intensify by occurring. A cultural example is + + hype: products that AT AT trade on what they will be in + + the future, vir virtual fashion on off, imminent technical + + standards, self-fulfilling prophecies and and or and artifi- + + cial destinies. Anticipating a trend end end end ACC ACC + + accelerates it (which is in itself a re re recursive trend) + +
+ ++ Hyping collapses SF into CATA CATA catalytic tic + + efficiency, re-routing tomorrow through what its prospect + + CT CT CT makes today. + +
+ ++ Virohyping sweeps through the advertising industry. + +
+ ++ Everyone will be doing it. + +
+ ++ Virus is parasitic tic replicator code: an asignifying + + sequence of machinic data ATA ATA flow-break on/off, + + 1/0, yang/yin intrinsically destined for war. In place of + + mess message-content virodata is assembled bled from + + asignifying materials with CATA catalytic (or positively + + disproportionate) efficiency: intruder passcode, locational + + ZIP-code, pseudogenomic substitute instructions, muta- + + tional junk (complex but latent segments), and garbage + + (redundant scrapcrapcrapcrapcrapcrapcrapcrapcrap- + + crapcrapcrapcrap). + +
+ ++ Biovirus TA TA TA targets organisms, hacking and + + reprogramming ATGAC'ITATCCACGGTACATTCAGT + + cellular DNA to produce more virus virus virus virus virus + + virus virus virus. Its enzymic cut-and-past recombinant + + wetware-splicing crosses singularity when retroviral + + reverse-transcriptase clicks in (enabling ontogenetic DNA- + + RNA circuitry and endocellular computation). + +
+ ++ ATAGGTCATGAATCTACCGATTGCAGCTGC + + TATTCCTCGATGATCGCATGGGCTGTGATG + + GCATCGTATCCGATCGATTCGAGCGATTGCAGC + + TACGCTATTCCTCCGAGGGATTGCAGCTACGTC + + GCATCGGGCTCAGATGTAGGTCATGAATCTACC + + GATTGCATGACTT ATCCACGGTACA’ITCGACT C + +
+ ++ Ethnovirus targets brains Technovirus targets socio- + + economic pro pro production pro processes. Infovirus + + targets digital 010010010001011110100001001101010101010 + + 10001001101010010010100computers100101001011010010 + + 101111010001010101010101010010101001010110101001 + + 000000100010111010100100101010010100100101010101 + + 00100010010010010010010010100100101011010100100 + + 10010101101010101010111101000010011010101010101000 + + 1001101101010101001100100010001010101110100001010 + + 110010100101000110010011100100010000000001001111 + + 1100010010010101 + +
+ ++ Hypervirus targets intelligent immunosecurity struc- + + tures: yes yes no yes no nomadically abstracting its proc- + + esses from specific media (DNA, words, symbolic models, + + bit-sequences), and operantly re-engineering itself. It + + folds into itself, involutes, or plexes, by reprogramming + + corpuscular code to reprogram reprogramming repro- + + gramming reprogramming. ROM is melted into recursive + + experimentation. + +
+ ++ 001010010010010110000101010101011101010010100 + + 10010101000011011001101001011000010001001001000 + + Recording devices. Copiers. Faxes. Samplers. K-stammer + + (((re)re)reruns) cross-cut by orphan drift. Repeat infec- + + tion. All hype hype hype hype hype hype hype hype + + hypervirus strains are plastic and interoperative. + +
+ ++ INSERT. hyper-prefixing semiotic sectors TAG TAG + + TAG tags them for transfer into abstract ACT ACT (nonlin- + + ear transcodable) machinic systems, tuned to virtualities or + + hyperspeeds (futural currencies independent of def uturali- + + zation). Hypermedia configure re re every implementation + + within a specific medium or territory as a subfunction of + + extraterritorial processes. Going (( ( ))) ( ) ( ) (( ) ) (( )) + + ( ) hyper dissolves being into ACT ACT ACT activity; a + + material desubstantialisation on off on off. Hyperproc- + + esses spread like Heraklitean fire re re re (although there + + are no analogies or metaphors in hype hype hype hype + + hyperspace). + +
+ ++ Being CAG CAG cages flow within memory. Function- + + ing as re re real antiontology, viral amnesia machinically + + realizes and dissolves biological TGACTCACI'ITAC- + + CGA'ITG, cultural, and technical 010110100100010110100 + + 101001001011101001010100100100100 mnemic structures: + + chopping-up hierarchic-generational descendency, col- + + lapsing phylogenetic tic frozen-code into ontogeny, and + + immanentizing the past to operative current. Its com- + + petitive just-in-time innovations delete storage CA CA + + capacity, flu flu flu fluidizin g energetic and informational + + stocks into and and or and and or orphan-vampire re re + + transversal 110111100010101010 vir vir virocommunication + + process, expressing a surplus value of code (content) + + as xenoreplication-behaviour (and/0r c0n(nective dis) + + junction). + +
+ ++ As war increases in in in intelligence, it becomes softer. + + By trashing their hosts crude viruses feedback negatively + + upon themselves, autolimiting their range of re regen- + + erative infilitration. Crazy vandals like Ebola CGCGT + + GAGCAATCGGACTCGGCTGCTGTGC'ITG (bodies + + dissolved quickly into slime) aren’t ever going to make it + + big. General principle for viral take-overs in the media: the + + more unsophisticated the contagion, the bigger the splash + + (diversionary tactics excepted). CAGCTACGCTATT + + CTCCGAGGCTAGATTGCAGCTACGTCGCATCG + + GGCTGACCGATGTAGGTCATGAATCTACCGA’IT + + GCACATGACTTATCCACGGTCTATTCCTCGAT + + GATCGCATCGGG CT GACCGATGGCATCGTA COPY. + + CUT. PASTE. Subtle viruses are slow, synergic, flexible + + and elusive. They execute sensitive behavioural con- + + trol that prolongs the life of the biomachinic resources, + + maximizes opportunities for propogation, infiltrates and + + disables hostile security systems, and feeds-back posi- + + tive -+-++-+-++ in in in innovation technoscience. In the + + macroversion, a VR prey animal hid in its enemy’s head. + +
+ ++ When hunting for hype hypervirus look 0k 0k ok for + + its primary host species, which will be undergoing logis- + + tical behavioral sophistication indexed by an explosive + + increase in communicative intensity, population density, + + sexual disorganisation, cultural promiscuity, and technical + + sub sub subtilization (leading to neurogenomic feedback + + and fluidization on off on off off on of all hard-wiring + + into into cybernetic fluxes). Any plane planet net net + + 00011011010010010101011 hosting such an event is about + + to flip over. CATA catastrophic OKOOKOK OK zero (0 + + (or ((( ( )) (( ) ) ( )) ) o°)) K-virus and (RT) retroscripts + + (Kobe, Tokyo, Oklahoma (Koresh, Koernke)). Apoka- + + lypse spread by the coke machine. Tomorrow’s news + + brews-up in Korea, Kosovo + +
+ ++ Climbing out of a recombination apparatus of TA + + TA TA tape-recorders and cut-ups, hypervirus infected + + Burroughs in 1972, at the cusp of K(ondratieff)-wave 9 + +
++ (the threshold of postmodernity). It rapidly reprocessed + + its target into an intelligenic no yes yes no no nova-war + + laboratory, volatilizing the history of language into invo- + + lutionary word-virus. Mutation rat rat rat rat rates jump. + + Vector switches through Butler, Gibson, and Cadigan + + fine-tune its synergic interexcitation, silt-up cybershift- + + inducing K(uang)-potential, and trend-lock onto 11001 + + 01001001010111101001011101011001000100010100100010 + + 01001001001001010010110100100100100100100100111010 + + 0100100100011001000101100101010 K-punk pulses with + + telematically-accelerating neoreplicator plicator plicator + + contamination. + +
+ ++ ‘Looking for a hit of snowcrash?’ # Wit # ## # # # + + ### ##W######## ##1## ###### # # # + + #### # ##1## # # # ### ####### # # + + ####### #####=# ## ##### ## # # ##### + + ### ############### ## # # + +
+ ++ As postmodern culture crosses to hypermania and ##1## + + ######################W# # + + # #### ####### # ##########W# # + + ################# ## # ##fitfi # + + ##### ## ###### ## # W ## ## # #### #### + + # stop stop go stop go stop go go goes nova, it singular- + + izes multiplicities cities cities of invasively autoreplicating + +
++ autoreplicating plexoweapon - systems (0 ( ((() ((( ( )) + + ()) ((( ) (( )) ( D») ( ) ( ))) ) that are r6 r6 r6 r6 nothing + +
++ beyond their war AGA AGA against security. This is no + + longer a question on off on of ideological representation, + + exogeneous political mobilization, theoretical critique, ## + + ######## # ###################### #### + + ## # # # # # ### # # # #W # or strategic orienta- + + tion, but of decentralized cultural diagrams functioning + + as immanent forces of antagonism. K-war derives its sole + + coherence from the unity of its foe. RETURN. + + Ana/Cata. Switch cur((re)re)rent. (( ) (( ))) O(r an)d( ). + + K0( I Ching hexagram 49: Revolution (Molting (( ))) + + leaves ( ) nothing i)ntact TACT TACT. ((( (( (( ) (( ))) + + (( ( ( ))) (< > )> ( )> << ) ( ( » ())) ( ))) )Cyberserk + + repelting-slippage into dark-side ( (( ))) distributive + + ROM-scrambling TACT tactics. (( (( ) ( ) ( )) (( )) ( )) ((( + + )()))((((()((()))(((()())())(()))(((() (())((() + + ((()))(()))))((())))((()( ()))(()))((())((( + + ()ZCr0 Program) ((( ))) (((() 0) ( ( ))) (((() (( )) + + ((((( ) () )()(())(( () ) (H ‘ ))) ))) ( (O 0 ())) (( + +
++ §5>((»><(<<><(>> + +
++ )) + + )) + + ) )) + + ((((()())()(())((())((())))())( + + (((())((()))(((()(D())(()))(((()(())((((()()) + + ()(())((())((())))())))((())))0))))((() 0 ())) + + (()))((())(((())((()))(((()())())(()))(((() + + (( )) ((((( ) ( ) ) () (())( ( ( )) ((( ) )) )( )) )) ((( ) )) )( )) + + )))((() 0 ()))(()))((())(((())((()))(((()( + + D())(()))(((()(())((((()())()(())((())((())))( + + ))0 ()))(0))((())(((())((()))(((()())())(( + + )))(((()(())((((()())()(())((()))))(0)) + +
+