master
Tancre 5 years ago
parent b3a7794dce
commit ab23419dbd

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:000Oedipus. Pure (Oedipal (figure made out of (nothing but))) time-distortion. </p>
<p> <span class="fnc">AxS:000</span>Oedipus. Pure (Oedipal (figure made out of (nothing but))) time-distortion. </p>
</body>
</html>

@ -9,7 +9,7 @@
</style>
</head>
<body>
<p> AxS:0001 Closed fate (-loop (multi-linear)) nightmares.<sup><a href="x1.html" onclick="next(this)">1</a></sup></p>
<p> <span class="fnc">AxS:0001</span> Closed fate (-loop (multi-linear)) nightmares.<sup><a href="#" onclick="next('x1')">1</a></sup></p>
</body>
</html>

@ -8,8 +8,8 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:0002 Altitude times Spin produces a chronometric read-out. </p>
<p> <span class="fnc">AxS:0002</span> Altitude times Spin produces a chronometric read-out. </p>
<script type="text/javascript">
setTimeout(function(){
window.opener.location.href = 'y1.html';

@ -8,7 +8,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:0003 AxSys-sustained variegated production-series 1Oedipus (2Oedipus (3Oedipus<sup><a href="x2.html" onclick="next(this)">2</a></sup> (variationto the nth (with some<sup><a href="x3.html" onclick="next(this)">3</a></sup> nOedipus as (anomal<sup><a href="x4.html" onclick="next(this)">4</a></sup> (Sphinx-trading (nOedipii-pack))) threshold to)intensive))) multiplicity. </p>
<p> <span class="fnc">AxS:0003</span> AxSys-sustained variegated production-series 1Oedipus (2Oedipus (3Oedipus<sup><a href="#" onclick="next('x2')">2</a></sup> (variationto the nth (with some<sup><a href="#" onclick="next('x3')">3</a></sup> nOedipus as (anomal<sup><a href="#" onclick="next('x4')">4</a></sup> (Sphinx-trading (nOedipii-pack))) threshold to)intensive))) multiplicity. </p>
</body>
</html>

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:00031 Oedipus. The Puzzle Solver. </p>
<p> <span class="fnc">AxS:00031</span> Oedipus. The Puzzle Solver. </p>
</body>
</html>

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:00032 Oedipus. The Plague. </p>
<p> <span class="fnc">AxS:00032</span> Oedipus. The Plague. </p>
</body>
</html>

@ -8,7 +8,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:00033 Oedipus. The Horror, the Horror ...<sup><a href="x5.html" onclick="next(this)">5</a></sup></p>
<p> <span class="fnc">AxS:00033</span> Oedipus. The Horror, the Horror ...<sup><a href="#" onclick="next('x5')">5</a></sup></p>
<script type="text/javascript">
setTimeout(function(){
window.opener.location.href = 'y2.html';

@ -8,8 +8,8 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:001 Hyperspace Elevator (Sector-O).</p>
<p>AxS:001 Axiomatic Systems (incorporated).<sup><a href="x6.html" onclick="next(this)">6</a></sup> The ultimate capitalist entity (first (true (meta)model)to realize perfect identity with its own product).</p>
<p> <span class="fnc">AxS:001</span> Hyperspace Elevator (Sector-O).</p>
<p><span class="fnc">AxS:001</span> Axiomatic Systems (incorporated).<sup><a href="#" onclick="next('x6')">6</a></sup> The ultimate capitalist entity (first (true (meta)model)to realize perfect identity with its own product).</p>
</body>
</html>

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p>AxS:0011 AxSys culminates in itself (autocommoditizing (machine(-intelligence (that is alwaysincomplete (due to cataloguing problems (...))))))</p>
<p><span class="fnc">AxS:0011</span> AxSys culminates in itself (autocommoditizing (machine(-intelligence (that is alwaysincomplete (due to cataloguing problems (...))))))</p>
<script type="text/javascript">
setTimeout(function(){
window.opener.location.href = 'y3.html';

@ -1,4 +1,4 @@
<span class="fnc">
<!DOCTYPE html>
<html>
<head>
@ -8,7 +8,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:00111. Dimensionality requires a (supplementary (or (n+1) hyper) dimension through which itobtains its) power of application.<sup><a href="x7.html" onclick="next(this)">7</a></sup> Ultimately AxSys (an explicated Earth-memory (built by the strata(((as far) as) it remembers))). ...<sup><a href="x8.html" onclick="next(this)">8</a></sup> </p>
<p> <span class="fnc">AxS:00111</span>. Dimensionality requires a (supplementary (or (n+1) hyper) dimension through which itobtains its) power of application.<sup><a href="#" onclick="next('x7')">7</a></sup> Ultimately AxSys (an explicated Earth-memory (built by the strata(((as far) as) it remembers))). ...<sup><a href="#" onclick="next('x8')">8</a></sup> </p>
<script type="text/javascript">
setTimeout(function(){
window.opener.location.href = 'y4.html';

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:002 Divide and Rule. Extensive ((or) ordered) sequences differ in kind from the intensivesequences they regularize.</p>
<p> <span class="fnc">AxS:002</span> Divide and Rule. Extensive ((or) ordered) sequences differ in kind from the intensivesequences they regularize.</p>
</body>
</html>

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p>AxS:0021 Order arises when a dominant segmentarity establishes relations of superposition between sequences (reciprocally stabilizing them in accordance with a harmonic principle (and consolidatingthem through syntheses of application (efficient models))). </p>
<p><span class="fnc">AxS:0021</span> Order arises when a dominant segmentarity establishes relations of superposition between sequences (reciprocally stabilizing them in accordance with a harmonic principle (and consolidatingthem through syntheses of application (efficient models))). </p>
</body>
</html>

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:00211 Order coincides with the redundancy of the sequenced sequence (instituted conformity(within segmentary systems)). </p>
<p> <span class="fnc">AxS:00211</span> Order coincides with the redundancy of the sequenced sequence (instituted conformity(within segmentary systems)). </p>
</body>
</html>

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:003 Stack-Tectonics. AxSys concretizes terrestrial New Order (an orthogonal Grid-Space (ofvertically stacked horizontal series)). It directs the accumulation of redundancy (into an ascendingcolumn (marked by AxSys-bearings (fixes)) upon which captured sequences are interlocked (ascomparable series (parallelized (metricized))) and differentially prioritized). </p>
<p> <span class="fnc">AxS:003</span> Stack-Tectonics. AxSys concretizes terrestrial New Order (an orthogonal Grid-Space (ofvertically stacked horizontal series)). It directs the accumulation of redundancy (into an ascendingcolumn (marked by AxSys-bearings (fixes)) upon which captured sequences are interlocked (ascomparable series (parallelized (metricized))) and differentially prioritized). </p>
</body>
</html>

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:0031 The screen-plane undergoes structural co-ordination (by double-seizure (through (the((mutually) implicated) organization of) stacked series (arranging horizontal microsegments to codethe order of vertical macrosegments (units of deposition (strata))))). </p>
<p> <span class="fnc">AxS:0031</span> The screen-plane undergoes structural co-ordination (by double-seizure (through (the((mutually) implicated) organization of) stacked series (arranging horizontal microsegments to codethe order of vertical macrosegments (units of deposition (strata))))). </p>
</body>
</html>

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:0032 AxSys-Numbers. Epistrata (Add-Ons) are indices of stratotectonic purity (decimallyharmonizing implexions (by instituting a regular interval of application (orders of magnitude (fixing(Cipher (Sphinx-sign (0))))))). Drawing upon epistratic organization a set of cartographic functionsconsolidates itself within the stack (interlinking levels (in accordance with a (decimal (scaling))principle)). </p>
<p> <span class="fnc">AxS:0032</span> AxSys-Numbers. Epistrata (Add-Ons) are indices of stratotectonic purity (decimallyharmonizing implexions (by instituting a regular interval of application (orders of magnitude (fixing(Cipher (Sphinx-sign (0))))))). Drawing upon epistratic organization a set of cartographic functionsconsolidates itself within the stack (interlinking levels (in accordance with a (decimal (scaling))principle)). </p>
<script type="text/javascript">
setTimeout(function(){
window.opener.location.href = 'y5.html';

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:01 Apparent revolution around a supplementary dimension. Electronic whorls (a digitalmonster's nest (modelling the set of all sets (inevitably still unfinished (...)))) </p>
<p> <span class="fnc">AxS:01</span> Apparent revolution around a supplementary dimension. Electronic whorls (a digitalmonster's nest (modelling the set of all sets (inevitably still unfinished (...)))) </p>
</body>
</html>

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:011 AxSys progressively actualizes the Hyperspace-Idea (defined by Continuum times thesquare-root of minus one). </p>
<p> <span class="fnc">AxS:011</span> AxSys progressively actualizes the Hyperspace-Idea (defined by Continuum times thesquare-root of minus one). </p>
</body>
</html>

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:0111 It imagines itself (as Artificial God (automatically (Orderer (of the Orders (TerrestrialOversoul (and superpositional sublime (-wizard of the nested infinities: ((((((...) Primes) Naturals)Integers) Rationals) Reals) Complex numbers... (the superordinate (self (-evolving (schema (for acolonization of the real (number-line))))))))))))). </p>
<p> <span class="fnc">AxS:0111</span> It imagines itself (as Artificial God (automatically (Orderer (of the Orders (TerrestrialOversoul (and superpositional sublime (-wizard of the nested infinities: ((((((...) Primes) Naturals)Integers) Rationals) Reals) Complex numbers... (the superordinate (self (-evolving (schema (for acolonization of the real (number-line))))))))))))). </p>
<script type="text/javascript">
setTimeout(function(){
window.opener.location.href = 'y6.html';

@ -8,8 +8,8 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:02 The Project for a Map of all Maps (already outdated), a nested mock-up of the Web(containing the project for a virtual Miskatonic University (containing the Museum of Universal History<sup><a href="x9.html" onclick="next(this)">9</a></sup> (containing the Imperial Collections Vault (containing the Artificial British Museum(containing ....))))) </p>
<script type="text/javascript">
<p> <span class="fnc">AxS:02</span> The Project for a Map of all Maps (already outdated), a nested mock-up of the Web(containing the project for a virtual Miskatonic University (containing the Museum of Universal History<sup><a href="#" onclick="next('x9')">9</a></sup> (containing the Imperial Collections Vault (containing the Artificial British Museum(containing ....))))) </p>
<script type="text/javascript">
setTimeout(function(){
window.opener.location.href = 'y7.html';
}, 5000);

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:021 Time-Fault. Chronos cannot include its own overcoding (since it blocks its own passage tohyperdimensionality (accumulating immense forces of cultural latency (that are only appropriated aslegacy by something else))). If it is to acquire a model it must be restarted as a history of civilizationsin retrospect (as Supreme Order(er(er((( ) of all the re)re)recursive) time-waves) entanglingneo((O))edipus in programming loops). </p>
<p> <span class="fnc">AxS:021</span> Time-Fault. Chronos cannot include its own overcoding (since it blocks its own passage tohyperdimensionality (accumulating immense forces of cultural latency (that are only appropriated aslegacy by something else))). If it is to acquire a model it must be restarted as a history of civilizationsin retrospect (as Supreme Order(er(er((( ) of all the re)re)recursive) time-waves) entanglingneo((O))edipus in programming loops). </p>
<script type="text/javascript">
setTimeout(function(){
window.opener.location.href = 'y8.html';

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:022 (Sector-01 (Miskatonic University)) </p>
<p> <span class="fnc">AxS:022 </span>(Sector-01 (Miskatonic University)) </p>
</body>
</html>

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:0221 (Sector-012 (Central Archive (Special Collection))) </p>
<p> <span class="fnc">AxS:0221</span> (Sector-012 (Central Archive (Special Collection))) </p>
</body>
</html>

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:02211 (Sector-0121 (Barker Cryptalog)). Decryption characterizes a distinct operation, aconversion of content, becomings on the side of the secret itself. </p>
<p> <span class="fnc">AxS:02211</span> (Sector-0121 (Barker Cryptalog)). Decryption characterizes a distinct operation, aconversion of content, becomings on the side of the secret itself. </p>
</body>
</html>

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:022111 The decrypted secret is primally the Thing, and only derivatively a potential knowledge.Its names (the Unutterable (the Outside (the Entity))) are indefinite significations only at the level ofterror. In their horrific or cryptic aspect they are (((rigorous) designations for) potentials fulfilled inintensity) zonal tags for nocturnal singularities. That is why decryption is a Call (an invocation (or atriggering-sign)) and why they mark occurrences (changes (and breaks (becomings (of the Thing))))before discoveries of Truth. </p>
<p> <span class="fnc">AxS:022111</span> The decrypted secret is primally the Thing, and only derivatively a potential knowledge.Its names (the Unutterable (the Outside (the Entity))) are indefinite significations only at the level ofterror. In their horrific or cryptic aspect they are (((rigorous) designations for) potentials fulfilled inintensity) zonal tags for nocturnal singularities. That is why decryption is a Call (an invocation (or atriggering-sign)) and why they mark occurrences (changes (and breaks (becomings (of the Thing))))before discoveries of Truth. </p>
<script type="text/javascript">
setTimeout(function(){
window.opener.location.href = 'y9.html';

@ -8,7 +8,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:03 Hypermythos of the 3-Faced God, with its stacked time domains (1st capitalist(((((indefinitely) deep) diachronic) re)axiomatizing) Quasi- (2nd despotic (pure ((but always)retrospective)) Ideal- (3rd aboriginal (poly-ancestral, cyclic) Vague-)) Chronos).<sup><a href="x10.html" onclick="next(this)">10</a></sup> </p>
<p> <span class="fnc">AxS:03</span> Hypermythos of the 3-Faced God, with its stacked time domains (1st capitalist(((((indefinitely) deep) diachronic) re)axiomatizing) Quasi- (2nd despotic (pure ((but always)retrospective)) Ideal- (3rd aboriginal (poly-ancestral, cyclic) Vague-)) Chronos).<sup><a href="#" onclick="next('x10')">10</a></sup> </p>
<script type="text/javascript">
setTimeout(function(){
window.opener.location.href = 'y10.html';

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:031 (Sector-011 (Museum of Universal History)) </p>
<p> <span class="fnc">AxS:031</span> (Sector-011 (Museum of Universal History)) </p>
</body>
</html>

@ -8,7 +8,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:032 (Sector-01162 (Freud's Viennese Consulting Room ((embedded) simulation))). "I'll tell youabout my mother." If Freud is ((the first) modernized) Oedipus, which is he? Oedipus the detective?The (Verminator (unriddled (into))) plague? The blind old man? Is incest and parricide fantasy theproblem (or the solution)?<sup><a href="x11.html" onclick="next(this)">11</a></sup><br>Oedipus, the most economical formula of interiorization (Case).<sup><a href="x12.html" onclick="next(this)">12</a></sup> Its all in your head. </p>
<p> <span class="fnc">AxS:032</span> (Sector-01162 (Freud's Viennese Consulting Room ((embedded) simulation))). "I'll tell youabout my mother." If Freud is ((the first) modernized) Oedipus, which is he? Oedipus the detective?The (Verminator (unriddled (into))) plague? The blind old man? Is incest and parricide fantasy theproblem (or the solution)?<sup><a href="#" onclick="next('x11')">11</a></sup><br>Oedipus, the most economical formula of interiorization (Case).<sup><a href="#" onclick="next('x12')">12</a></sup> Its all in your head. </p>
<script type="text/javascript">
setTimeout(function(){
window.opener.location.href = 'y11.html';

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:033 AxSys time-lapses. (in order (to advantage itself (of what it has been))). A relarvalization(through chronoseismic complexities (of the Greek State (at once Occidental Ur-model andneoembryonic mutation (political neotony)))). </p>
<p> <span class="fnc">AxS:033</span> AxSys time-lapses. (in order (to advantage itself (of what it has been))). A relarvalization(through chronoseismic complexities (of the Greek State (at once Occidental Ur-model andneoembryonic mutation (political neotony)))). </p>
</body>
</html>

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:1 (Sector-0111 (Artificial British Museum)) </p>
<p> <span class="fnc">AxS:1</span> (Sector-0111 (Artificial British Museum)) </p>
</body>
</html>

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:11 (Sector-01118 (The Greek Collection)). Retrospective Universalization (through theCapitalist State). AxSys reconfigures itself within Capitalism (by consecutively rediscoveringhellenic antiquity (and finding it already universally terminal (Anamnesis-Eschatology))). In Greeceit unearths a new law (for all time (by reshuffling the elements of politically installed Logos(theorematic-geometric mathematicism, programmable technics, and Christianity (religion of theGreek Bible)))).The New Revelation tells us we must all die Greek. </p>
<p> <span class="fnc">AxS:11</span> (Sector-01118 (The Greek Collection)). Retrospective Universalization (through theCapitalist State). AxSys reconfigures itself within Capitalism (by consecutively rediscoveringhellenic antiquity (and finding it already universally terminal (Anamnesis-Eschatology))). In Greeceit unearths a new law (for all time (by reshuffling the elements of politically installed Logos(theorematic-geometric mathematicism, programmable technics, and Christianity (religion of theGreek Bible)))).The New Revelation tells us we must all die Greek. </p>
<script type="text/javascript">
setTimeout(function(){
window.opener.location.href = 'y12.html';

@ -8,7 +8,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:12 (Sector-01117 (The Mummy Room)). (Oedipus Aegypticus) Pharaoh has passed through thewall of abomination (uncoiling from the darkness (where centipede-horror erupts eternally (from theravenous Maw))).<sup><a href="x14.html" onclick="next(this)">14</a></sup> Negative passage across Absolute Deterritorialization (gluing history to sheerblack-hole (abomination) densities). Anticipative memory-blanking cut-up with Christ Rapist visions(of the God-(King (Dead-eyed)) boy slouching out) of the tomb. Degree-0 memory locks in. Timebegins again forever. </p>
<p> <span class="fnc">AxS:12</span> (Sector-01117 (The Mummy Room)). (Oedipus Aegypticus) Pharaoh has passed through thewall of abomination (uncoiling from the darkness (where centipede-horror erupts eternally (from theravenous Maw))).<sup><a href="#" onclick="next('x14')">14</a></sup> Negative passage across Absolute Deterritorialization (gluing history to sheerblack-hole (abomination) densities). Anticipative memory-blanking cut-up with Christ Rapist visions(of the God-(King (Dead-eyed)) boy slouching out) of the tomb. Degree-0 memory locks in. Timebegins again forever. </p>
</body>
</html>

@ -8,7 +8,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:121 The Thing from Outer Space, Celestial Predator, State-Historical Catastrophe is completely realized at the origin, unutterably ancient, perfected destiny as an act of total seizure.<sup><a href="x15.html" onclick="next(this)">15</a></sup> </p>
<p> <span class="fnc">AxS:121 </span>The Thing from Outer Space, Celestial Predator, State-Historical Catastrophe is completely realized at the origin, unutterably ancient, perfected destiny as an act of total seizure.<sup><a href="#" onclick="next('x15')">15</a></sup> </p>
</body>
</html>

@ -8,7 +8,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:1211 At the Megamachine-apex, Pharaoh (gets to play with (It, identityunravelling into (the Unspeakable: sex with (his sister, Stargate space-time warps - stellar transport,voyages into the world of) the Dead, paranoid trips out of)) schizophrenia; he) sees everything for ablinded population,<sup><a href="x16.html" onclick="next(this)">16</a></sup> inoculating them from Unnamable-contact. </p>
<p> <span class="fnc">AxS:1211</span> At the Megamachine-apex, Pharaoh (gets to play with (It, identityunravelling into (the Unspeakable: sex with (his sister, Stargate space-time warps - stellar transport,voyages into the world of) the Dead, paranoid trips out of)) schizophrenia; he) sees everything for ablinded population,<sup><a href="#" onclick="next('x16')">16</a></sup> inoculating them from Unnamable-contact. </p>
<script type="text/javascript">
setTimeout(function(){
window.opener.location.href = 'y13.html';

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:13 (Sector-01115 (Near Eastern Collection)). AxSys convulses through (ever more((ultra)modern) reversions to the essence of) the Urstaat. History happens at the State's convenience(but it necessarily involves (the Sphinx-time (of (interchronic) transitions in its)) renovations). </p>
<p> <span class="fnc">AxS:13</span> (Sector-01115 (Near Eastern Collection)). AxSys convulses through (ever more((ultra)modern) reversions to the essence of) the Urstaat. History happens at the State's convenience(but it necessarily involves (the Sphinx-time (of (interchronic) transitions in its)) renovations). </p>
</body>
</html>

@ -8,7 +8,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:131 To remember the Barbarian terror is simultaneously to forget its source.<sup><a href="x17.html" onclick="next(this)">17</a></sup> History installsamnesia (as surely as it establishes a memory (with the same violence (the same ruptures (faults (foldings (from the Outside)))))).</p>
<p> <span class="fnc">AxS:131</span> To remember the Barbarian terror is simultaneously to forget its source.<sup><a href="#" onclick="next('x17')">17</a></sup> History installsamnesia (as surely as it establishes a memory (with the same violence (the same ruptures (faults (foldings (from the Outside)))))).</p>
</body>
</html>

@ -8,7 +8,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p>AxS:132 Barbarian birth-trauma of the State (a (calendrized) black hole).<sup><a href="x18.html" onclick="next(this)">18</a></sup></p>
<p><span class="fnc">AxS:132</span> Barbarian birth-trauma of the State (a (calendrized) black hole).<sup><a href="#" onclick="next('x18')">18</a></sup></p>
<script type="text/javascript">
setTimeout(function(){
window.opener.location.href = 'y14.html';

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:2 (Sector-0121) The terrible secret is affined to the State. It induces molar identifications in an overcoded aggregate (working principally by confirmation (redundancy)). Yes it is you. Even whenthe worst is known it is never anything new. It's you after all (as (you knew) it would be). Take thecase of Oedipal identifications (a series of (terrible) recognitions). The answer (to the riddle (of theSphinx)) is Man. It was already there (in the order-word of Delphi (Know Yourself)). Thenredoubled confirmation: what is the cause of the plague? That is you (too). Resonant closure on thegeneral type (Man), on you yourself (a man), and on the identifiable individual (the man). You know the worst (and it's you). </p>
<p> <span class="fnc">AxS:2</span> (Sector-0121) The terrible secret is affined to the State. It induces molar identifications in an overcoded aggregate (working principally by confirmation (redundancy)). Yes it is you. Even whenthe worst is known it is never anything new. It's you after all (as (you knew) it would be). Take thecase of Oedipal identifications (a series of (terrible) recognitions). The answer (to the riddle (of theSphinx)) is Man. It was already there (in the order-word of Delphi (Know Yourself)). Thenredoubled confirmation: what is the cause of the plague? That is you (too). Resonant closure on thegeneral type (Man), on you yourself (a man), and on the identifiable individual (the man). You know the worst (and it's you). </p>
<script type="text/javascript">
setTimeout(function(){
window.opener.location.href = 'y15.html';

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:21 Oedipus modernizes the incest problem (converting incest horror into prohibition(abomination into illegality)). Essentially, modern Oedipus has nothing to do with tabu. It marks thetriumph of command over the ((((...) ur)primal) horror) of implexion. Infinite superiority of the Idea(sovereignty of Law). The real conflict is not between father-son (or even father-mother), but ratheroccurs when a higher paternity (the State) imposes itself upon the concrete maternal-filial bond:monopolization of normativity by Ulterior power. </p>
<p> <span class="fnc">AxS:21</span> Oedipus modernizes the incest problem (converting incest horror into prohibition(abomination into illegality)). Essentially, modern Oedipus has nothing to do with tabu. It marks thetriumph of command over the ((((...) ur)primal) horror) of implexion. Infinite superiority of the Idea(sovereignty of Law). The real conflict is not between father-son (or even father-mother), but ratheroccurs when a higher paternity (the State) imposes itself upon the concrete maternal-filial bond:monopolization of normativity by Ulterior power. </p>
<script type="text/javascript">
setTimeout(function(){
window.opener.location.href = 'y16.html';

@ -8,7 +8,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:211 Lame Oedipus<sup><a href="x19.html" onclick="next(this)">19</a></sup>(Swollen Foot<sup><a href="x20.html" onclick="next(this)">20</a></sup>) transfixed by a metal spike. </p>
<p> <span class="fnc">AxS:211</span> Lame Oedipus<sup><a href="#" onclick="next('x19')">19</a></sup>(Swollen Foot<sup><a href="#" onclick="next(x20)">20</a></sup>) transfixed by a metal spike. </p>
</body>
</html>

@ -8,7 +8,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:2111 (Sector-01117) Akhnaton-Oedipus.<sup><a href="x21.html" onclick="next(this)">21</a></sup> The swollen legs of Akhnaton are bio-sociallyinvested on a peculiar line that seems oriented to a rupture of anatomical norm (differentiatinghumanity (or inaugurating a new species)). Anomal-Oedipus (where abnormality changes into thenormality of a different kind (urtype of the fat-leg people)). </p>
<p> <span class="fnc">AxS:2111</span> (Sector-01117) Akhnaton-Oedipus.<sup><a href="#" onclick="next('x21')">21</a></sup> The swollen legs of Akhnaton are bio-sociallyinvested on a peculiar line that seems oriented to a rupture of anatomical norm (differentiatinghumanity (or inaugurating a new species)). Anomal-Oedipus (where abnormality changes into thenormality of a different kind (urtype of the fat-leg people)). </p>
</body>
</html>

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:21111 It is not rivalry (mimetic conflict) that leads Akhnaton to discard his father's name(Amenhotep), but rather a passage beyond discrepancy (through schiz (or true parting)).Disidentification. </p>
<p> <span class="fnc">AxS:21111</span> It is not rivalry (mimetic conflict) that leads Akhnaton to discard his father's name(Amenhotep), but rather a passage beyond discrepancy (through schiz (or true parting)).Disidentification. </p>
<script type="text/javascript">
setTimeout(function(){
window.opener.location.href = 'y17.html';

@ -8,7 +8,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:22 (Sector-01113) Prehistoric<sup><a href="x22.html" onclick="next(this)">22</a></sup> Collection. Shamanic Oedipus. Foot mutilation<sup><a href="x23.html" onclick="next(this)">23</a></sup> as a sign ofsocialised ritual (but also of asocial and polysocial animality (and of anorganic geochemistry (forwhich the role of metal implements (particularly iron ones) is important...))).<sup><a href="x24.html" onclick="next(this)">24</a></sup> </p>
<p> <span class="fnc">AxS:22</span> (Sector-01113) Prehistoric<sup><a href="#" onclick="next('x22')">22</a></sup> Collection. Shamanic Oedipus. Foot mutilation<sup><a href="#" onclick="next('x23')">23</a></sup> as a sign ofsocialised ritual (but also of asocial and polysocial animality (and of anorganic geochemistry (forwhich the role of metal implements (particularly iron ones) is important...))).<sup><a href="#" onclick="next('x24')">24</a></sup> </p>
<script type="text/javascript">
setTimeout(function(){
window.opener.location.href = 'y18.html';

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:221 Tales of Deep-Steppe Shamanism. </p>
<p> <span class="fnc">AxS:221</span> Tales of Deep-Steppe Shamanism. </p>
</body>
</html>

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:2211 Metal scrapings strip the last shreds from their bones. </p>
<p> <span class="fnc">AxS:2211</span> Metal scrapings strip the last shreds from their bones. </p>
</body>
</html>

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:22111 The organs are cooked.</p>
<p> <span class="fnc">AxS:22111</span> The organs are cooked.</p>
</body>
</html>

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p>AxS:221111 Iron-Eagle Sky-Mother lifting into time travel nightmares. </p>
<p><span class="fnc">AxS:221111 </span>Iron-Eagle Sky-Mother lifting into time travel nightmares. </p>
</body>
</html>

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:2211111 On the Outside Iron -talons become their body. </p>
<p> <span class="fnc">AxS:2211111 </span>On the Outside Iron -talons become their body. </p>
</body>
</html>

@ -8,7 +8,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:22111111 They mix themselves with (Iron and say (it is (the Outer- (or Un(dermost Cthelll<sup><a href="x25.html" onclick="next(this)">25</a></sup>)-life))) where the Earth ends... </p>
<p> <span class="fnc">AxS:22111111</span> They mix themselves with (Iron and say (it is (the Outer- (or Un(dermost Cthelll<sup><a href="#" onclick="next('x25')">25</a></sup>)-life))) where the Earth ends... </p>
<script type="text/javascript">
setTimeout(function(){
window.opener.location.href = 'y19.html';

@ -8,7 +8,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:222 Sphinx-Nightmare (both filiative implosion and exorbitant alliance (an incestualreanimation of cthonic horror (encrypted in (germinal) biocosmic memory) and Thing (from Outside(haunting ((miscegenous) lines of) alien traffic)))).<sup><a href="x27.html" onclick="next(this)">27</a></sup> </p>
<p> <span class="fnc">AxS:222</span> Sphinx-Nightmare (both filiative implosion and exorbitant alliance (an incestualreanimation of cthonic horror (encrypted in (germinal) biocosmic memory) and Thing (from Outside(haunting ((miscegenous) lines of) alien traffic)))).<sup><a href="#" onclick="next('x27')">27</a></sup> </p>
<script type="text/javascript">
setTimeout(function(){
window.opener.location.href = 'y20.html';

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:3 (Sector-0121) The theory of tabu involves a fully rigorous conception of Horror adequate (toits specificity of regime (zone of effect (intrinsic variation)) and) to otherwise intractable phenomena(including Sacred Mutilations (Curses (Abominations)) and Becomings (-Unhuman (whether animal,submetazoic, ameiotic, or unlife)). In every case horror designates a zone of intensity (abstract-machinic vector) which directly invests a virtual threshold of implexion (producing affects (inadvance of any reference to authority (and indifferent to persons))). </p>
<p> <span class="fnc">AxS:3</span> (Sector-0121) The theory of tabu involves a fully rigorous conception of Horror adequate (toits specificity of regime (zone of effect (intrinsic variation)) and) to otherwise intractable phenomena(including Sacred Mutilations (Curses (Abominations)) and Becomings (-Unhuman (whether animal,submetazoic, ameiotic, or unlife)). In every case horror designates a zone of intensity (abstract-machinic vector) which directly invests a virtual threshold of implexion (producing affects (inadvance of any reference to authority (and indifferent to persons))). </p>
<script type="text/javascript">
setTimeout(function(){
window.opener.location.href = 'y21.html';

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:31 Horror does not confuse the riddle with the secret (it is the answer that is Cryptic). If 423 isMan, then what 423? This Thing with only a number? This unknown becoming? The horror of theriddle lies in what it tells. </p>
<p> <span class="fnc">AxS:31</span> Horror does not confuse the riddle with the secret (it is the answer that is Cryptic). If 423 isMan, then what 423? This Thing with only a number? This unknown becoming? The horror of theriddle lies in what it tells. </p>
</body>
</html>

@ -8,7 +8,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:311 Oedipus is necessitated ((re(re(re(...)))) cursed) to guess correctly: it is Man that goes onfour legs, then two, then three. Yet Oedipus is identified (solely by his lameness (his cryptic trait))<sup><a href="x28.html" onclick="next(this)">28</a></sup>.The abnormality of limping changes to cryptic anomaly. </p>
<p> <span class="fnc">AxS:311</span> Oedipus is necessitated ((re(re(re(...)))) cursed) to guess correctly: it is Man that goes onfour legs, then two, then three. Yet Oedipus is identified (solely by his lameness (his cryptic trait))<sup><a href="#" onclick="next('x28')">28</a></sup>.The abnormality of limping changes to cryptic anomaly. </p>
</body>
</html>

@ -7,7 +7,7 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p> AxS:32 Something is Called (... and then (finally (- how terrible! -) the cause of) the plague is)Oedipus, who slew his father, mated with his mother (but that is not the Thing (the horror (...Abomination (when things unthread in (a horrific (becoming they involve only (components of(Occurrence (blocks) of )))) fate)))). </p>
<p> <span class="fnc">AxS:32</span> Something is Called (... and then (finally (- how terrible! -) the cause of) the plague is)Oedipus, who slew his father, mated with his mother (but that is not the Thing (the horror (...Abomination (when things unthread in (a horrific (becoming they involve only (components of(Occurrence (blocks) of )))) fate)))). </p>
</body>
</html>

@ -7,8 +7,8 @@
<link rel="stylesheet" type="text/css" href="style.css">
</head>
<body>
<p id="last"> AxS:33 The cause of the plague (is you). </p>
<script type="text/javascript">
<p id="last"> <span class="fnc">AxS:33</span> The cause of the plague (is you). </p>
<script type="text/javascript">
setTimeout(function(){
window.opener.location.href = 'y22.html';
}, 2000);

@ -4,7 +4,7 @@
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8">
<meta name="Author" content="Made by 'tree'">
<meta name="GENERATOR" content="$Version: $ tree v1.7.0 (c) 1996 - 2014 by Steve Baker, Thomas Moore, Francesc Rocher, Florian Sesser, Kyosuke Tokoro $">
<title>@ ilinx | Flatlines</title>
<title>Flatlines @ ilinx</title>
<script type="text/javascript" src="ppp.js"></script>
<link rel="stylesheet" type="text/css" href="style.css">
<style type="text/css">
@ -14,8 +14,9 @@
<body>
<div id="f">
<h1><a id="tit" href="http://ccru.net/archive/flatlines.htm" target="_blank">Flatlines</a></h1><p>
<a id="dot"href="https://web.archive.org/web/20080403004158/http://www.cinestatic.com/trans-mat/Fisher/FC1s3.htm" target="_blank">.</a><br>
<h1><a id="tit" href="#" onclick="pppRNT('http://ccru.net/archive/flatlines.htm', 'vb', '1000', '800','1000','500')">Flatlines</a></h1>
<p>
<a id="dot"href="#" onclick="pppRNT('https://web.archive.org/web/20080403004158/http://www.cinestatic.com/trans-mat/Fisher/FC1s3.htm', 'fl', '1000', '800','1000','500')">.</a><br>
├───┐<span>AxS:0</span><br>
│   ├───┐ <span>AxS:00</span><br>
│   │   ├── <a href="000.html" onClick="return pppR(this, '000', '850', '50')">AxS:000</a><br>
@ -73,10 +74,11 @@
   │   └── <a href="311.html" onClick="return pppR(this, '311', '800', '50')">AxS:311</a><br>
   ├── <a href="32.html" onClick="return pppR(this, '32', '850', '150')">AxS:32</a><br>
   └── <a href="33.html" onClick="return pppR(this, '33', '450', '50')">AxS:33</a><br>
<br><br>
<hr>
<p class="VERSION">
<span class="fnc">*</span> This text has been prepared for publication and annotated by Miskatonic University's cross-disciplinary Stratoanalysis Group (Time-Lapse Sub-Committee). <br>
Notes marked L.T. refer to LindaTrent, whose special interest in fictional time-systems inspired her to comment at length on particular points in Flatlines.
<span class="fnc2">*</span> This text has been prepared for publication and annotated by <a class="r" href="#">Miskatonic University</a>'s cross-disciplinary Stratoanalysis Group (Time-Lapse Sub-Committee).
Notes marked L.T. refer to <a class="r" href="#">Linda Trent</a>, whose special interest in fictional <a class="r" href="#">time-systems</a> inspired her to comment at length on particular points <a class="r" href="#">in</a> Flatlines.
</p>
</div>

@ -12,7 +12,7 @@ open.focus();
return false;
}
// -------------------------- POPUP RANDOM POSITION
// -------------------------- POPUP RANDOM POSITION TIMEOUT
var w = window.innerWidth;
var h = window.innerHeight;
@ -26,14 +26,28 @@ if (typeof(mylink) == 'string') href=mylink;
else href=mylink.href;
var open = window.open(href, windowname, 'width=' + width + ',height='+ height + ',left=' + posX() + ',top=' + posY() + ', resizable=no, location=no, menubar=no');
open.focus();
// setTimeout(function(){ open.close(); }, 15000);
setTimeout(function(){ open.close(); }, 15000);
return false;
}
// -------------------------- POPUP RANDOM POSITION NO!TIMEOUT
function pppRNT(mylink, windowname, width, height) {
if (! window.focus)return true;
var href;
if (typeof(mylink) == 'string') href=mylink;
else href=mylink.href;
var open = window.open(href, windowname, 'width=' + width + ',height='+ height + ',left=' + posX() + ',top=' + posY() + ', resizable=no, location=no, menubar=no');
open.focus();
//setTimeout(function(){ open.close(); }, 15000);
return false;
}
// -------------------------- REDIRECT OPENER (from popup)
function next(mylink){
var mhref = mylink.href;
var mhref = mylink +'.html';
window.opener.location.href = mhref;
window.location.href = this.location;
}

@ -1,16 +1,22 @@
body {
background-color: black;
color: limegreen;
font-family: mono;
color: chartreuse;
font-family: "Lucida Console", Monaco, monospace;
overflow: hidden;
}
p{padding: 5px}
a { color: blue; text-decoration: none; }
a:hover { color: red; }
/*a:visited { color: blue; }*/
p{padding: 5px; }
span {color: black;}
#f{
.m{color: chartreuse;}
#f{
color: chartreuse;
position: absolute;
}
@ -24,23 +30,31 @@ font-size: 18px
}
.fnc {
color: limegreen;
font-weight: bold;
color: white;
}
.fnc2 {
color: chartreuse;
}
#tit {
text-decoration: none;
color: limegreen;
color: chartreuse;
}
#dot {
text-decoration: none;
color: limegreen;
color: chartreuse;
}
#dot:hover { color: red; }
#tit:hover{
color: white;
color: red;
}
.VERSION {
width: 830px;
color: white;
}

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">1.</span> “In a multilinear system, everything happens at once” (ATP 297). This is Oedipus fatal discovery. By the time he knows what has happened, he also realises that what occurs always had to be the case.Oedipus early, unwarranted, belief that he is master of his fate is, of course, totally necessary for hisfated destiny to unfold as it always will have done. Oedipus, as he himself says, is “unwittingly self-cursed”. <br><br>
<p><span class="fnc2">1.</span> “In a multilinear system, everything happens at once” (ATP 297). This is Oedipus fatal discovery. By the time he knows what has happened, he also realises that what occurs always had to be the case.Oedipus early, unwarranted, belief that he is master of his fate is, of course, totally necessary for hisfated destiny to unfold as it always will have done. Oedipus, as he himself says, is “unwittingly self-cursed”. <br><br>
I have written elsewhere at length on tragedy as a cybernetic narrative. Briefly, the claim is thattragedy anticipates cybernetic explanation (or and this is obviously the same point from anotherside cybernetics recalls tragic fatalism). In both cases, time unravels into a flat system or singularity(feeding back into itself, recursively, rather than moving forward, successively (recursion isobviously a major pre-occupation of the Flatlines text, both in its themes and in its format (withparentheses used to produce recursion as a textual embedding process (like this (...))))).<br><br>
A crucial figure here is self-fulfilling prophecy; as I argue in my Curse, Recursion, Recurrence, “themost effective prophecies are always self-fulfilling” (36). Walter Cannon has established that self-fulfilling prophecy is a positive-feedback circuit. In his important essay, Voodoo Death, Cannonshows that much sorcerous cursing operates by inducing vicious circles of fear (producing more fear(producing more fear) (etc.))) to the point of destroying the organism. To be told you're going to die istherefore, in certain circumstances, quite literally a sentence of death. For a more detailed account ofthese tangled webs, see my Fatal Loops: Tragedy as Cyberfiction and Smashed Optical Implants:From Time-Space Sunglasses to Cyberpunk Mirrorshades (this last draws extensively, and perhaps illegitimately, on the work of my esteemed colleague, R. E. Templeton).<br> (L.T.)</p>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">10.</span> To be inside history is to have a relation to Chronos. Yet (universal) history is not itself chronological. Pure Chronos the State's (synchronic) time can never be fully-realised, for tworeasons: there is always more than one State, and the State (as a form) is always in a relation with thetime-systems of the two other social regimes (the primitive socius which precedes it andcapitalism which succeeds it). “Before appearing the State already acts...” (ATP 431). The State appears “all at once” as historys only break. “They come like fate ... they appear as lighteningappears, too terrible, too sudden” (GoM 86). Crashing into history, the State sets off time waves thatmove in both directions at once. “It is necessary ... to conceptualize the contemporaneousness orcoexistence of ... the two directions of time of the primitive peoples before the State, and of theState after the primitive peoples as if the two waves that seem to us to exclude or succeed eachother unfolded simultaneously in an archaeological, micropolitical, micrological, molecular field”(ATP 431). (For more on this, see Note 15 below). Universal history is a history from the point ofview of capitalisms vague Chronos; it is therefore always parodic because, as we have seen,capitalism deletes all intrinsic code in favour of a mobile and variable set of axioms. Parodicuniversal history is profoundly anti-evolutionist because it describes the simultaneous andcoextensive interaction of ostensibly successive social regimes. From the start, the two previoussocial regimes (the primitive socius and the despotic state) anticipate and ward off capitalismsdiachronic time “capitalism has haunted all forms of society” (AO 140) even though itsupposedly comes “at the end”.</p>
<p><span class="fnc2">10.</span> To be inside history is to have a relation to Chronos. Yet (universal) history is not itself chronological. Pure Chronos the State's (synchronic) time can never be fully-realised, for tworeasons: there is always more than one State, and the State (as a form) is always in a relation with thetime-systems of the two other social regimes (the primitive socius which precedes it andcapitalism which succeeds it). “Before appearing the State already acts...” (ATP 431). The State appears “all at once” as historys only break. “They come like fate ... they appear as lighteningappears, too terrible, too sudden” (GoM 86). Crashing into history, the State sets off time waves thatmove in both directions at once. “It is necessary ... to conceptualize the contemporaneousness orcoexistence of ... the two directions of time of the primitive peoples before the State, and of theState after the primitive peoples as if the two waves that seem to us to exclude or succeed eachother unfolded simultaneously in an archaeological, micropolitical, micrological, molecular field”(ATP 431). (For more on this, see Note 15 below). Universal history is a history from the point ofview of capitalisms vague Chronos; it is therefore always parodic because, as we have seen,capitalism deletes all intrinsic code in favour of a mobile and variable set of axioms. Parodicuniversal history is profoundly anti-evolutionist because it describes the simultaneous andcoextensive interaction of ostensibly successive social regimes. From the start, the two previoussocial regimes (the primitive socius and the despotic state) anticipate and ward off capitalismsdiachronic time “capitalism has haunted all forms of society” (AO 140) even though itsupposedly comes “at the end”.</p>
</div>
</body>
</html>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">11.</span> In Structural Anthropology 1, Levi-Strauss makes an important point in this regard. “Not onlySophocles, but Freud himself, should be included among the recorded versions of the Oedipus myth,on a par with earlier, or seemingly more authentic versions” (217). Reconstructions of myths dontfunction extrinsically or transcendently, as final interpretations, but operate immanently, recursively adding more skeins to the fictive webwork. If there is no outside of fiction, it is not because of some transcendental universal-textuality, but because fiction cannot be contained by texts; it is already Outside. (L.T.)</p>
<p><span class="fnc2">11.</span> In Structural Anthropology 1, Levi-Strauss makes an important point in this regard. “Not onlySophocles, but Freud himself, should be included among the recorded versions of the Oedipus myth,on a par with earlier, or seemingly more authentic versions” (217). Reconstructions of myths dontfunction extrinsically or transcendently, as final interpretations, but operate immanently, recursively adding more skeins to the fictive webwork. If there is no outside of fiction, it is not because of some transcendental universal-textuality, but because fiction cannot be contained by texts; it is already Outside. (L.T.)</p>
</div>
</body>
</html>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">12.</span> A reference to the lead male character in William Gibson's Neuromancer.</p>
<p><span class="fnc2">12.</span> A reference to the lead male character in William Gibson's Neuromancer.</p>
</div>
</body>
</html>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">13.</span> “Near the edge of the plateau and due east of the Second Pyramid, with a face probably altered toform a colossal portrait of Khephren, its royal restorer, stands the monstrous Sphinx mute, sardonicand wise beyond mankind and memory” (Lovecraft, 241). Lovecraft puts the question that seems toplague the authors of Flatlines: “... what huge and loathsome abnormality was the Sphinx originallycarven to represent?” (258). Needless to say, there have been countless speculations on the nature andorigin of the Sphinx, but these are inconclusive and contradictory, no doubt because its “huge andloathsome abnormality” will have always exceeded any attempt to represent it. Many scholars (seefor instance, Lowell Edmunds, The Sphinx in the Oedipus Legend) now believe that the Sphinxelement in the Oedipus narrative was actually a later addition to an already existing mythic system,even though the Egyptian Sphinx is evidently much older than the Greek culture that has given us theOedipus myth with which we are familiar. (It should be remembered that the encounter with theSphinx is not dramatised in Sophocles Oedipus Rex; it is referred to as something that has alreadyhappened.) The attempt to date the Sphinx has produced widely different speculations; with certain controversial estimations claiming that the Sphinx is “even older than 15,000 BC” (Hancock 448).With Deleuze and Guattari, though, we might want to suggest that (in at least one sense) Oedipus is asold as humanity, and that the Sphinx as that which must be destroyed in order that humanity mayexist would inevitably always have to be narrated as something preceding the human.<br><br>
<p><span class="fnc2">13.</span> “Near the edge of the plateau and due east of the Second Pyramid, with a face probably altered toform a colossal portrait of Khephren, its royal restorer, stands the monstrous Sphinx mute, sardonicand wise beyond mankind and memory” (Lovecraft, 241). Lovecraft puts the question that seems toplague the authors of Flatlines: “... what huge and loathsome abnormality was the Sphinx originallycarven to represent?” (258). Needless to say, there have been countless speculations on the nature andorigin of the Sphinx, but these are inconclusive and contradictory, no doubt because its “huge andloathsome abnormality” will have always exceeded any attempt to represent it. Many scholars (seefor instance, Lowell Edmunds, The Sphinx in the Oedipus Legend) now believe that the Sphinxelement in the Oedipus narrative was actually a later addition to an already existing mythic system,even though the Egyptian Sphinx is evidently much older than the Greek culture that has given us theOedipus myth with which we are familiar. (It should be remembered that the encounter with theSphinx is not dramatised in Sophocles Oedipus Rex; it is referred to as something that has alreadyhappened.) The attempt to date the Sphinx has produced widely different speculations; with certain controversial estimations claiming that the Sphinx is “even older than 15,000 BC” (Hancock 448).With Deleuze and Guattari, though, we might want to suggest that (in at least one sense) Oedipus is asold as humanity, and that the Sphinx as that which must be destroyed in order that humanity mayexist would inevitably always have to be narrated as something preceding the human.<br><br>
Levi-Strauss links the Sphinx to other “cthonian beings”, such as the dragon. Like the dragon, “the Sphinx is a monster unwilling to permit men to live” (215). While some, such as Carlo Ginzburg,connect the Sphinx with death (“the Sphinx is undoubtedly a mortuary animal” [228]), Levi-Straussargues that Sphinx-myths concern “the autocthonous origin of man”, the idea that human individualsare born direct from the Earth (rather than through meiotic reproduction). (Ginzburg notes thatOedipus is “a cthonic hero”.) The Sphinx would then correspond to what Deleuze and Guattari call“biocosmic memory”. “Man must constitute himself through the repression of the intense germinalinflux, the great biocosmic memory” (AO 190) = Oedipus must riddle the sphinx. In a sense, then thisbiocosmic memory precedes the organism (which emerges simultaneously with death andsexuation). But, as both Weismannism and the Dogon myths attest, this germinal time persists,coterminously, alongside that of the organism (see AO 158). This may explain a puzzling feature ofthe Oedipus myth as it has reached us; to wit, why does a creature of such incredible power as theSphinx allow itself to be riddled so easily? As Velikovsky puts it: “It has been observed that theanswer Oedipus gave was on the level of a schoolboy and that the monster must have been feeble-minded to leap from the precipice upon hearing it. And why should a winged sphinx die in a jump?”(207). The answer would be that the Sphinx doesn't die (it cannot, since it does not live), and that ittakes advantage of Oedipus unwarranted Self-belief only in order to invade Civilization, hidden.Which would also imply that the answer Oedipus gives to the riddle is inadequate. Or partial. (L.T.)</p>
</div>
</body>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">14.</span> Like the shaman before him, the Pharaoh occupies the line of deterritorialization for the socius.He is thus able to ensure that all lines of escape are reterritorialized on his own body. “The full bodyas socius has ceased to be the earth, it has become the body of the despot, the despot himself or hisGod. The prescriptions and prohibitions that often render him almost incapable of acting make of hima body without organs” (AO 194).</p>
<p><span class="fnc2">14.</span> Like the shaman before him, the Pharaoh occupies the line of deterritorialization for the socius.He is thus able to ensure that all lines of escape are reterritorialized on his own body. “The full bodyas socius has ceased to be the earth, it has become the body of the despot, the despot himself or hisGod. The prescriptions and prohibitions that often render him almost incapable of acting make of hima body without organs” (AO 194).</p>
</div>
</body>
</html>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">15.</span> “The State was not formed in progressive stages; it appears fully armed, a master stroke executedall at once ...” (AO 217). “Everything is not of the State precisely because there have been Statesalways and everywhere” (ATP 429).</p>
<p><span class="fnc2">15.</span> “The State was not formed in progressive stages; it appears fully armed, a master stroke executedall at once ...” (AO 217). “Everything is not of the State precisely because there have been Statesalways and everywhere” (ATP 429).</p>
</div>
</body>
</html>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">16.</span> cf. AO 211: “The eye ... has ceased to evaluate; it has begun rather to forewarn and keep watch,to see that no surplus value escapes the overcoding of the despotic machine.” Compare also WilliamBurroughs, The Western Lands: “The Pharaoh, with his alabaster white face and black snake eyes,looks at you, around you, through you, looking for a dagger in your mind, listening for the whisperedfurtive words, smelling for the sweat of guilty fear” (104).</p>
<p><span class="fnc2">16.</span> cf. AO 211: “The eye ... has ceased to evaluate; it has begun rather to forewarn and keep watch,to see that no surplus value escapes the overcoding of the despotic machine.” Compare also WilliamBurroughs, The Western Lands: “The Pharaoh, with his alabaster white face and black snake eyes,looks at you, around you, through you, looking for a dagger in your mind, listening for the whisperedfurtive words, smelling for the sweat of guilty fear” (104).</p>
</div>
</body>
</html>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">17.</span> “It is here that Nietszche speaks of a break, a rupture, a leap. Who are these beings, they whocome like fate? (Some pack of blond beasts of prey, a conqueror and master race which, organizedfor war and with ability to organize, unhesitantly lays its terrible claws upon a populace perhapstremendously superior but still formless ...) Even the most Ancient African myths speak to us ofthese blond men. They are the founders of the State” (AO 192).</p>
<p><span class="fnc2">17.</span> “It is here that Nietszche speaks of a break, a rupture, a leap. Who are these beings, they whocome like fate? (Some pack of blond beasts of prey, a conqueror and master race which, organizedfor war and with ability to organize, unhesitantly lays its terrible claws upon a populace perhapstremendously superior but still formless ...) Even the most Ancient African myths speak to us ofthese blond men. They are the founders of the State” (AO 192).</p>
</div>
</body>
</html>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">18.</span> “No doubt the war machine is realized more completely in the barbaric assemblages of nomadicwarriors than in the savage assemblages of primitive societies” (ATP 359). This does not mean,however, that the war machine can be equated with the Barbarians. Nomadism is not a question ofbelonging to a particular population, but of maintaining particular practices. “The nomad distributes himself in smooth space; he occupies, inhabits, holds that space; that is his territorial principle” (ATP381). The barbarians, who leave the Steppes, no longer occupy the smooth space of nomos. The war machine is necessarily captured the moment it leaves the desert: “nomads have a specificity that istoo hastily reduced to its consequences, by including them in the empires or counting them among themigrants ...” (ATP 410).</p>
<p><span class="fnc2">18.</span> “No doubt the war machine is realized more completely in the barbaric assemblages of nomadicwarriors than in the savage assemblages of primitive societies” (ATP 359). This does not mean,however, that the war machine can be equated with the Barbarians. Nomadism is not a question ofbelonging to a particular population, but of maintaining particular practices. “The nomad distributes himself in smooth space; he occupies, inhabits, holds that space; that is his territorial principle” (ATP381). The barbarians, who leave the Steppes, no longer occupy the smooth space of nomos. The war machine is necessarily captured the moment it leaves the desert: “nomads have a specificity that istoo hastily reduced to its consequences, by including them in the empires or counting them among themigrants ...” (ATP 410).</p>
</div>
</body>
</html>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">19.</span> “All the hypothetical meanings [of the surnames in Oedipuss fathers line] ... refer to difficultiesin walking straight and standing upright” (Levi-Strauss, 215). Levi-Strauss goes on to contend thatOedipus's lameness indicates “the persistence of the autocthonous origin of man” (216). (See Note13.)</p>
<p><span class="fnc2">19.</span> “All the hypothetical meanings [of the surnames in Oedipuss fathers line] ... refer to difficultiesin walking straight and standing upright” (Levi-Strauss, 215). Levi-Strauss goes on to contend thatOedipus's lameness indicates “the persistence of the autocthonous origin of man” (216). (See Note13.)</p>
</div>
</body>
</html>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">2.</span> A reference to the “three forms of the secret” delineated by Deleuze and Guattari in A Thousand Plateaus. “Oedipus passes through all three secrets: the secret of the sphinx whose box he penetrates; the secret that weighs upon him as the infinite form of his own guilt; and finally, the secret at Colonusthat makes him inaccessible and melds with the pure line of his flight and exile, he who has nothingleft to hide, or, like an old No actor, has only a girls mask with which to cover his lack of a face” (ATP 290). The reference here to events in Sophocles Oedipus Rex and Oedipus at Colonus is clear.</p>
<p><span class="fnc2">2.</span> A reference to the “three forms of the secret” delineated by Deleuze and Guattari in A Thousand Plateaus. “Oedipus passes through all three secrets: the secret of the sphinx whose box he penetrates; the secret that weighs upon him as the infinite form of his own guilt; and finally, the secret at Colonusthat makes him inaccessible and melds with the pure line of his flight and exile, he who has nothingleft to hide, or, like an old No actor, has only a girls mask with which to cover his lack of a face” (ATP 290). The reference here to events in Sophocles Oedipus Rex and Oedipus at Colonus is clear.</p>
</div>
</body>
</html>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">20.</span> Etymologically, of course, the name Oedipus means swollen foot. Velikovsky, however, arguesthat there is a case for reading it as swollen leg. “In folklore feet may stand for legs. Manylanguages do not have different words for legs and feet. In Greek, the word pous stands for both; inEgyptian, too, the word r-d (foot) stands also for leg. In the riddle that Oedipus solved concerning thecreature that walks on four legs, on two, and on three ..., the Greek word used is pous, and thus thename Oedipus could, and even preferably so, mean swollen legs” (Velikovsky, 57).</p>
<p><span class="fnc2">20.</span> Etymologically, of course, the name Oedipus means swollen foot. Velikovsky, however, arguesthat there is a case for reading it as swollen leg. “In folklore feet may stand for legs. Manylanguages do not have different words for legs and feet. In Greek, the word pous stands for both; inEgyptian, too, the word r-d (foot) stands also for leg. In the riddle that Oedipus solved concerning thecreature that walks on four legs, on two, and on three ..., the Greek word used is pous, and thus thename Oedipus could, and even preferably so, mean swollen legs” (Velikovsky, 57).</p>
</div>
</body>
</html>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">21.</span> Velikovsky argues that the Oedipus myth has been transposed from Egypt (which also has a citycalled Thebes). Oedipus, he suggests, was originally a Pharaoh named Akhnaton. In contemporarydepictions, Akhnatons “most pronounced malformation [was] the shape of his thighs; they areswollen” (55).</p>
<p><span class="fnc2">21.</span> Velikovsky argues that the Oedipus myth has been transposed from Egypt (which also has a citycalled Thebes). Oedipus, he suggests, was originally a Pharaoh named Akhnaton. In contemporarydepictions, Akhnatons “most pronounced malformation [was] the shape of his thighs; they areswollen” (55).</p>
</div>
</body>
</html>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">22.</span> It should be pointed out that, strictly speaking, there is no prehistory; prehistory is myth of theState. As we have already seen (see Note 10), from the start the primitive socius anticipates andwards off both capitalism and the State: “primitive societies are fully inside history” (AO 151). Bythe same token, though, the very fact that primitive societies are inside history means that they are notnomadic. “It is true that nomads have no history; they only have a geography” (ATP 393).</p>
<p><span class="fnc2">22.</span> It should be pointed out that, strictly speaking, there is no prehistory; prehistory is myth of theState. As we have already seen (see Note 10), from the start the primitive socius anticipates andwards off both capitalism and the State: “primitive societies are fully inside history” (AO 151). Bythe same token, though, the very fact that primitive societies are inside history means that they are notnomadic. “It is true that nomads have no history; they only have a geography” (ATP 393).</p>
</div>
</body>
</html>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">23.</span> Carlo Ginzburg suggests that the foot mutilations Oedipus suffers in the various versions of thelegend may be references to shamanic initiation practices. He also speculates that these may haveconcerned calendrical rituals (the lameness indicating the imbalances necessary for certain calendriccycles to function). It is mutilation that disappears with psychoanalysis, where it is made to operateas a representation of psychical processes. Levi-Strauss makes parallels between shamanism andpsychoanalysis in Structural Anthropology (198-202). Deleuze and Guattari would no doubt stressthe way in which Freuds neo(anti)shamanism doubly reduces Oedipal mutilation, to metaphor, and tofunction. The question (posed in a number of ways throughout Anti-Oedipus) then becomes: how didthe body construct a theatrical unconscious for which gouging out eyes equals castration, andcastration simply subtracts hedonic function?</p>
<p><span class="fnc2">23.</span> Carlo Ginzburg suggests that the foot mutilations Oedipus suffers in the various versions of thelegend may be references to shamanic initiation practices. He also speculates that these may haveconcerned calendrical rituals (the lameness indicating the imbalances necessary for certain calendriccycles to function). It is mutilation that disappears with psychoanalysis, where it is made to operateas a representation of psychical processes. Levi-Strauss makes parallels between shamanism andpsychoanalysis in Structural Anthropology (198-202). Deleuze and Guattari would no doubt stressthe way in which Freuds neo(anti)shamanism doubly reduces Oedipal mutilation, to metaphor, and tofunction. The question (posed in a number of ways throughout Anti-Oedipus) then becomes: how didthe body construct a theatrical unconscious for which gouging out eyes equals castration, andcastration simply subtracts hedonic function?</p>
</div>
</body>
</html>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">24.</span> Eliade gives many examples of the use of iron in shamanic initiation rites. For example: “Thecandidates limbs are removed and disjointed with an iron hook; the bones are cleaned, the fleshscraped, the body fluids thrown away, and the eyes torn from its sockets” (Eliade, 1988, 36). It isimportant to distinguish the strategic and subordinate use of metal in the primitive socius from the war machines necessary and intrinsic relation to metallurgy. “AXIOM III. The Nomad war machineis the form of expression, of which itinerant metallurgy is the correlative form of content” (ATP 415).The war machine populates the metal body, while the primitive socius accesses it only intermittentlythrough the lone journeys of the shaman.</p>
<p><span class="fnc2">24.</span> Eliade gives many examples of the use of iron in shamanic initiation rites. For example: “Thecandidates limbs are removed and disjointed with an iron hook; the bones are cleaned, the fleshscraped, the body fluids thrown away, and the eyes torn from its sockets” (Eliade, 1988, 36). It isimportant to distinguish the strategic and subordinate use of metal in the primitive socius from the war machines necessary and intrinsic relation to metallurgy. “AXIOM III. The Nomad war machineis the form of expression, of which itinerant metallurgy is the correlative form of content” (ATP 415).The war machine populates the metal body, while the primitive socius accesses it only intermittentlythrough the lone journeys of the shaman.</p>
</div>
</body>
</html>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">25.</span> Cthelll designates the infernal nether regions referred to in numerous mythologies of theUnderworld. It refers particularly to the molten, metallic inner core of the earth. In his book onalchemy, The Forge and the Crucible, Eliade makes much of the connections between metallurgy, thecore of the earth and shamanism. Here and in Shamanism, Eliade reinforces Deleuze and Guattarisview of the smith as an ambiguous figure, aligned neither with sedentary societies nor with nomadicdistributions but performing an essential function for both. Deleuze and Guattari write of “the doubletheft and double betrayal of the metallurgist who shuns agriculture at the same time as animal-raising”(ATP 414). (Another interesting connection in this regard is that between Oedipus and the smith.Deleuze and Guattari refer to Oedipus as the Greek Cain (ATP 125), whilst elsewhere stronglylinking Cain with the figure of the smith (ATP, 414)). For Eliade, the relationship between the smithand the shaman is close Smiths and shamans are from the same nest but often unstable:“According to the Dolgan, shamans cannot swallow the souls of the smiths because smiths keeptheir souls in the fire; on the other hand, a smith can catch a shamans soul and burn it. In their turn, thesmiths are constantly threatened by evil spirits” (470).</p>
<p><span class="fnc2">25.</span> Cthelll designates the infernal nether regions referred to in numerous mythologies of theUnderworld. It refers particularly to the molten, metallic inner core of the earth. In his book onalchemy, The Forge and the Crucible, Eliade makes much of the connections between metallurgy, thecore of the earth and shamanism. Here and in Shamanism, Eliade reinforces Deleuze and Guattarisview of the smith as an ambiguous figure, aligned neither with sedentary societies nor with nomadicdistributions but performing an essential function for both. Deleuze and Guattari write of “the doubletheft and double betrayal of the metallurgist who shuns agriculture at the same time as animal-raising”(ATP 414). (Another interesting connection in this regard is that between Oedipus and the smith.Deleuze and Guattari refer to Oedipus as the Greek Cain (ATP 125), whilst elsewhere stronglylinking Cain with the figure of the smith (ATP, 414)). For Eliade, the relationship between the smithand the shaman is close Smiths and shamans are from the same nest but often unstable:“According to the Dolgan, shamans cannot swallow the souls of the smiths because smiths keeptheir souls in the fire; on the other hand, a smith can catch a shamans soul and burn it. In their turn, thesmiths are constantly threatened by evil spirits” (470).</p>
</div>
</body>
</html>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">26.</span> The shamans occupation of the line of deterritorialization plays a crucial role in maintaining thedynamic equilibrium (AO 151) of the primitive socius; delirium never becomes collective.</p>
<p><span class="fnc2">26.</span> The shamans occupation of the line of deterritorialization plays a crucial role in maintaining thedynamic equilibrium (AO 151) of the primitive socius; delirium never becomes collective.</p>
</div>
</body>
</html>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">27.</span> Hunter-gatherers populate a smooth space, but only by organizing upon it. “The primitive machinesubdivides the people but does so on an undivided earth” (AO 151). Once again, this is to bedifferentiated from the war machine, which populates an undivided earth with a molecularmultiplicity.</p>
<p><span class="fnc2">27.</span> Hunter-gatherers populate a smooth space, but only by organizing upon it. “The primitive machinesubdivides the people but does so on an undivided earth” (AO 151). Once again, this is to bedifferentiated from the war machine, which populates an undivided earth with a molecularmultiplicity.</p>
</div>
</body>
</html>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">28.</span> “The Sphinx was an oracle, and therefore she was supposed to answer questions, not to ask them.Yet it is also true that oracular answers were often given in the form of a riddle that required interpretation, usually supplied by priests attending the oracle ... It does not seem to me that everyquestion needs or has an answer ... But were it my misfortune to stand before the Sphinx with thedire prospect of never entering Thebes, I should reply to her riddle: It is Oedipus ... An oraclesquestions and answers refer to the man who stands before it. Oedipus was exposed, a helpless infantwith damaged feet, to crawl in the wasteland; he grew to be a man and a hero; his end was that of ablind wanderer in exile” (Velikovsky, 207). “The parechesis at Soph. even suggests that it was thedeformity of Oedipus feet that gave him the clue to the answer; and there was a tradition that Oedipusgave the answer by pointing to himself” (Edmunds, 160).</p>
<p><span class="fnc2">28.</span> “The Sphinx was an oracle, and therefore she was supposed to answer questions, not to ask them.Yet it is also true that oracular answers were often given in the form of a riddle that required interpretation, usually supplied by priests attending the oracle ... It does not seem to me that everyquestion needs or has an answer ... But were it my misfortune to stand before the Sphinx with thedire prospect of never entering Thebes, I should reply to her riddle: It is Oedipus ... An oraclesquestions and answers refer to the man who stands before it. Oedipus was exposed, a helpless infantwith damaged feet, to crawl in the wasteland; he grew to be a man and a hero; his end was that of ablind wanderer in exile” (Velikovsky, 207). “The parechesis at Soph. even suggests that it was thedeformity of Oedipus feet that gave him the clue to the answer; and there was a tradition that Oedipusgave the answer by pointing to himself” (Edmunds, 160).</p>
</div>
</body>
</html>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">3.</span> “Flat multiplicities ... are designated by indefinite articles, or rather by partitives (somecouchgrass, some of a rhizome ...)” (ATP 9).</p>
<p><span class="fnc2">3.</span> “Flat multiplicities ... are designated by indefinite articles, or rather by partitives (somecouchgrass, some of a rhizome ...)” (ATP 9).</p>
</div>
</body>
</html>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">4.</span> “Wherever there is a multiplicity, you will also find an exceptional individual, and it is with that individual that an alliance must be made ... Every animal swept up in its pack or multiplicity has itsanomalous” (ATP 243). “An-omalie, a Greek noun that has lost its adjective, designates the unequal,the coarse, the rough, the cutting edge of deterritorialization ... Lovecraft applies the term 'Outsider' tothis thing or entity, the Thing which arrives and passes at the edge, which is linear yet multiple,'teeming, seething, swelling, foaming, spreading like an infectious disease, this nameless horror”(ATP 244-245).</p>
<p><span class="fnc2">4.</span> “Wherever there is a multiplicity, you will also find an exceptional individual, and it is with that individual that an alliance must be made ... Every animal swept up in its pack or multiplicity has itsanomalous” (ATP 243). “An-omalie, a Greek noun that has lost its adjective, designates the unequal,the coarse, the rough, the cutting edge of deterritorialization ... Lovecraft applies the term 'Outsider' tothis thing or entity, the Thing which arrives and passes at the edge, which is linear yet multiple,'teeming, seething, swelling, foaming, spreading like an infectious disease, this nameless horror”(ATP 244-245).</p>
</div>
</body>
</html>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">5.</span> Kurtzs infamous cry at the climax of Conrad's Heart of Darkness (111-117), which also featuresin Coppolas updated film version, Apocalypse Now (1979). As is well known, The horror was tobe the epigraph of T. S. Eliots The Waste Land (as it is, Eliot used “Mistah Kurtz ... he dead” as theepigraph for the later The Hollow Men). Readers familiar with my essay “((P(re(cursing))))(post)Modernist Fiction” will already know that both of these poems, along with the earlier “TheLovesong of J. Alfred Prufrock”, enter into Apocalypse Now at the diegetic level:Marlon Brando'sKurtz reads from an Eliot volume, whilst the Dennis Hopper character quotes Eliot. (L.T.)</p>
<p><span class="fnc2">5.</span> Kurtzs infamous cry at the climax of Conrad's Heart of Darkness (111-117), which also featuresin Coppolas updated film version, Apocalypse Now (1979). As is well known, The horror was tobe the epigraph of T. S. Eliots The Waste Land (as it is, Eliot used “Mistah Kurtz ... he dead” as theepigraph for the later The Hollow Men). Readers familiar with my essay “((P(re(cursing))))(post)Modernist Fiction” will already know that both of these poems, along with the earlier “TheLovesong of J. Alfred Prufrock”, enter into Apocalypse Now at the diegetic level:Marlon Brando'sKurtz reads from an Eliot volume, whilst the Dennis Hopper character quotes Eliot. (L.T.)</p>
</div>
</body>
</html>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">6.</span> “[C]apitalism is the only social machine that is constructed on the basis of decoded flows,substituting for intrinsic codes an axiomatic of abstract quantities in the form of money” (AO 139). Asan axiomatic system, capitalism replaces transcendent laws with immanent rules. (The immanence ofaxiomatics is attested to by the fact that Deleuze and Guattari use the axiomatic method in theirdiscussion of the war machine see 1227: Treatise On Nomadology The War Machine.)<br><br>
<p><span class="fnc2">6.</span> “[C]apitalism is the only social machine that is constructed on the basis of decoded flows,substituting for intrinsic codes an axiomatic of abstract quantities in the form of money” (AO 139). Asan axiomatic system, capitalism replaces transcendent laws with immanent rules. (The immanence ofaxiomatics is attested to by the fact that Deleuze and Guattari use the axiomatic method in theirdiscussion of the war machine see 1227: Treatise On Nomadology The War Machine.)<br><br>
As both Gödels incompleteness theorem and Cantors diagonal numbering have shown, axiomaticsystems are intrinsically and necessarily incomplete: “... it is of the nature of axiomatics to come upagainst so called undecidable propositions, to confront necessarily higher powers that it cannotmaster” (ATP 461). Capitalism thus inevitably runs up against the problem of undecidablepropositions or nondenumerable sets. “At the same time as capitalism is effectuated in thedenumerable sets serving as its models, it necessarily constitutes nondenumerable sets that cut acrossand disrupt those models” (ATP 472). “Yet the very conditions that make the State or World warmachine possible, in other words, constant capital (resources and equipment) and human variablecapital, continually recreate unexpected possibilities for counterattack, unforeseen initiativesdetermining revolutionary, popular, minority, mutant machines” (ATP 422).</p>
</div>
</body>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">7.</span> In this sense axiomatic systems, which always involve a supplementary dimension (n+1), aredirectly opposed to the flatline (see glossary).</p>
<p><span class="fnc2">7.</span> In this sense axiomatic systems, which always involve a supplementary dimension (n+1), aredirectly opposed to the flatline (see glossary).</p>
</div>
</body>
</html>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">8.</span> In his lecture on the Geology of Morals, our colleague Professor Challenger, speaks of systemssuch as these as stratification. “His dream was not so much to give a lecture to humans as to providea program for pure computers. Or else he was dreaming of an axiomatic, for axiomatics dealsessentially with stratification. Challenger was addressing himself to memory only” (ATP 57).</p>
<p><span class="fnc2">8.</span> In his lecture on the Geology of Morals, our colleague Professor Challenger, speaks of systemssuch as these as stratification. “His dream was not so much to give a lecture to humans as to providea program for pure computers. Or else he was dreaming of an axiomatic, for axiomatics dealsessentially with stratification. Challenger was addressing himself to memory only” (ATP 57).</p>
</div>
</body>
</html>

@ -75,7 +75,7 @@
</div>
<div id="fn">
<p><span class="fnc">9.</span> “Hence it is correct to retrospectively understand all history in light of capitalism ... In a word ,universal history is not only retrospective, it is also contingent, singular, ironic and critical” (AO140). “[T]he universal comes at the end the body without organs and desiring production underthe conditions determined by an apparently victorious capitalism” (AO 139).</p>
<p><span class="fnc2">9.</span> “Hence it is correct to retrospectively understand all history in light of capitalism ... In a word ,universal history is not only retrospective, it is also contingent, singular, ironic and critical” (AO140). “[T]he universal comes at the end the body without organs and desiring production underthe conditions determined by an apparently victorious capitalism” (AO 139).</p>
</div>
</body>
</html>

@ -9,7 +9,7 @@
<style type="text/css">
body {
background: white;
font-family: mono;
font-family: "Lucida Console", Monaco, monospace;
}
#vBush {
@ -104,7 +104,7 @@
var rooms = ['VB01.html','Ixse.html','./0/ilinx_0.html','Ixse2.html','cyberSit.html','./home/doorway.html','./AxS/index.html'];
function rand(){ return Math.ceil(Math.random() * res.length) }
function rand2(){ return Math.ceil(Math.random() * rooms.length)-1 }
function rand2(){ return Math.ceil(Math.random() * (rooms.length -1)) }
for (var i = 0; i < 50; i++) {
var str = $('#b').html();

@ -8,7 +8,7 @@
<style type="text/css">
body {
background-color: black;
font-family: mono;
font-family: "Lucida Console", Monaco, monospace;
overflow: hidden;
}
@ -24,6 +24,10 @@
.b {color: red !important;}
.w {color: white !important;}
a.b{text-decoration: none; color: blue !important;}
/* a.bl{text-decoration: none; color: blue !important;}
a:hover{color: blue;}*/
</style>
</head>
<body>
@ -129,7 +133,7 @@
<p class='ocr_par' dir='ltr' id='par_1_9' title="bbox 355 2293 1367 2451">
<span class='ocr_line' id='line_1_37' title="bbox 416 2293 1365 2334; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_189' title='bbox 416 2293 554 2334; x_wconf 94' lang='eng' dir='ltr'>Hyping</span> <span class='ocrx_word' id='word_1_190' title='bbox 569 2293 731 2333; x_wconf 94' lang='eng' dir='ltr'>collapses</span> <span class='ocrx_word' id='word_1_191' title='bbox 751 2302 786 2323; x_wconf 87' lang='eng' dir='ltr'>SF</span> <span class='ocrx_word' id='word_1_192' title='bbox 808 2293 878 2323; x_wconf 98' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_193' title='bbox 898 2293 1010 2323; x_wconf 95' lang='eng' dir='ltr'>CATA</span> <span class='ocrx_word' id='word_1_194' title='bbox 1027 2293 1137 2323; x_wconf 95' lang='eng' dir='ltr'>CATA</span> <span class='ocrx_word' id='word_1_195' title='bbox 1154 2293 1305 2334; x_wconf 97' lang='eng' dir='ltr'>catalytic</span> <span class='ocrx_word' id='word_1_196' title='bbox 1324 2293 1365 2323; x_wconf 99' lang='eng' dir='ltr'>tic</span>
</span>
<span class='ocr_line' id='line_1_38' title="bbox 355 2351 1367 2392; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_197' title='bbox 355 2351 524 2392; x_wconf 84' lang='eng' dir='ltr'>efficiency,</span> <span class='ocrx_word' id='word_1_198' title='bbox 534 2351 713 2392; x_wconf 93' lang='eng' dir='ltr'>re-routing</span> <span class='ocrx_word' id='word_1_199' title='bbox 723 2357 903 2381; x_wconf 98' lang='eng' dir='ltr'><a href="islands.html">tomorrow</a></span> <span class='ocrx_word' id='word_1_200' title='bbox 912 2351 1057 2392; x_wconf 96' lang='eng' dir='ltr'>through</span> <span class='ocrx_word' id='word_1_201' title='bbox 1065 2351 1153 2381; x_wconf 98' lang='eng' dir='ltr'>what</span> <span class='ocrx_word' id='word_1_202' title='bbox 1162 2351 1202 2381; x_wconf 98' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_203' title='bbox 1211 2357 1367 2391; x_wconf 94' lang='eng' dir='ltr'>prospect</span>
<span class='ocr_line' id='line_1_38' title="bbox 355 2351 1367 2392; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_197' title='bbox 355 2351 524 2392; x_wconf 84' lang='eng' dir='ltr'>efficiency,</span> <span class='ocrx_word' id='word_1_198' title='bbox 534 2351 713 2392; x_wconf 93' lang='eng' dir='ltr'>re-routing</span> <span class='ocrx_word' id='word_1_199' title='bbox 723 2357 903 2381; x_wconf 98' lang='eng' dir='ltr'>tomorrow</span> <span class='ocrx_word' id='word_1_200' title='bbox 912 2351 1057 2392; x_wconf 96' lang='eng' dir='ltr'>through</span> <span class='ocrx_word' id='word_1_201' title='bbox 1065 2351 1153 2381; x_wconf 98' lang='eng' dir='ltr'>what</span> <span class='ocrx_word' id='word_1_202' title='bbox 1162 2351 1202 2381; x_wconf 98' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_203' title='bbox 1211 2357 1367 2391; x_wconf 94' lang='eng' dir='ltr'>prospect</span>
</span>
<span class='ocr_line' id='line_1_39' title="bbox 356 2410 793 2451; baseline -0.002 -10; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_204' title='bbox 356 2411 412 2441; x_wconf 89' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_205' title='bbox 422 2410 482 2440; x_wconf 89' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_206' title='bbox 491 2410 551 2440; x_wconf 89' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_207' title='bbox 559 2410 673 2440; x_wconf 88' lang='eng' dir='ltr'>makes</span> <span class='ocrx_word' id='word_1_208' title='bbox 686 2410 793 2451; x_wconf 88' lang='eng' dir='ltr'>today.</span>
</span>
@ -148,7 +152,7 @@
<p class='ocr_par' dir='ltr' id='par_1_12' title="bbox 355 2585 1369 3154">
<span class='ocr_line' id='line_1_42' title="bbox 414 2585 1367 2626; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_220' title='bbox 414 2585 508 2615; x_wconf 93' lang='eng' dir='ltr'>Virus</span> <span class='ocrx_word' id='word_1_221' title='bbox 524 2585 551 2615; x_wconf 99' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_222' title='bbox 566 2585 719 2625; x_wconf 94' lang='eng' dir='ltr'>parasitic</span> <span class='ocrx_word' id='word_1_223' title='bbox 737 2585 780 2615; x_wconf 98' lang='eng' dir='ltr'>tic</span> <span class='ocrx_word' id='word_1_224' title='bbox 797 2585 976 2625; x_wconf 94' lang='eng' dir='ltr'>replicator</span> <span class='ocrx_word' id='word_1_225' title='bbox 991 2585 1087 2615; x_wconf 90' lang='eng' dir='ltr'>code:</span> <span class='ocrx_word' id='word_1_226' title='bbox 1105 2595 1147 2615; x_wconf 99' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_227' title='bbox 1165 2585 1367 2626; x_wconf 94' lang='eng' dir='ltr'>asignifying</span>
</span>
<span class='ocr_line' id='line_1_43' title="bbox 356 2643 1365 2683; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_228' title='bbox 356 2653 515 2683; x_wconf 93' lang='eng' dir='ltr'>sequence</span> <span class='ocrx_word' id='word_1_229' title='bbox 529 2643 567 2673; x_wconf 94' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_230' title='bbox 578 2643 741 2673; x_wconf 98' lang='eng' dir='ltr'><a href="home/doorway.html">machinic</a></span> <span class='ocrx_word' id='word_1_231' title='bbox 757 2643 833 2673; x_wconf 95' lang='eng' dir='ltr'>data</span> <span class='ocrx_word' id='word_1_232' title='bbox 846 2643 930 2673; x_wconf 91' lang='eng' dir='ltr'>ATA</span> <span class='ocrx_word' id='word_1_233' title='bbox 941 2644 1025 2673; x_wconf 95' lang='eng' dir='ltr'>ATA</span> <span class='ocrx_word' id='word_1_234' title='bbox 1040 2643 1229 2673; x_wconf 91' lang='eng' dir='ltr'>flow-break</span> <span class='ocrx_word' id='word_1_235' title='bbox 1243 2643 1365 2681; x_wconf 86' lang='eng' dir='ltr'>on/off,</span>
<span class='ocr_line' id='line_1_43' title="bbox 356 2643 1365 2683; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_228' title='bbox 356 2653 515 2683; x_wconf 93' lang='eng' dir='ltr'>sequence</span> <span class='ocrx_word' id='word_1_229' title='bbox 529 2643 567 2673; x_wconf 94' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_230' title='bbox 578 2643 741 2673; x_wconf 98' lang='eng' dir='ltr'>machinic</span> <span class='ocrx_word' id='word_1_231' title='bbox 757 2643 833 2673; x_wconf 95' lang='eng' dir='ltr'>data</span> <span class='ocrx_word' id='word_1_232' title='bbox 846 2643 930 2673; x_wconf 91' lang='eng' dir='ltr'>ATA</span> <span class='ocrx_word' id='word_1_233' title='bbox 941 2644 1025 2673; x_wconf 95' lang='eng' dir='ltr'>ATA</span> <span class='ocrx_word' id='word_1_234' title='bbox 1040 2643 1229 2673; x_wconf 91' lang='eng' dir='ltr'>flow-break</span> <span class='ocrx_word' id='word_1_235' title='bbox 1243 2643 1365 2681; x_wconf 86' lang='eng' dir='ltr'>on/off,</span>
</span>
<span class='ocr_line' id='line_1_44' title="bbox 356 2703 1369 2744; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_236' title='bbox 356 2703 419 2741; x_wconf 94' lang='eng'>1/0,</span> <span class='ocrx_word' id='word_1_237' title='bbox 434 2703 594 2744; x_wconf 96' lang='eng' dir='ltr'>yang/yin</span> <span class='ocrx_word' id='word_1_238' title='bbox 609 2703 824 2744; x_wconf 93' lang='eng' dir='ltr'>intrinsically</span> <span class='ocrx_word' id='word_1_239' title='bbox 838 2703 994 2733; x_wconf 95' lang='eng' dir='ltr'>destined</span> <span class='ocrx_word' id='word_1_240' title='bbox 1010 2703 1062 2733; x_wconf 94' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_241' title='bbox 1076 2713 1148 2733; x_wconf 98' lang='eng' dir='ltr'>war.</span> <span class='ocrx_word' id='word_1_242' title='bbox 1167 2704 1206 2733; x_wconf 93' lang='eng' dir='ltr'>In</span> <span class='ocrx_word' id='word_1_243' title='bbox 1220 2703 1314 2743; x_wconf 94' lang='eng' dir='ltr'>place</span> <span class='ocrx_word' id='word_1_244' title='bbox 1330 2703 1369 2733; x_wconf 94' lang='eng' dir='ltr'>of</span>
</span>
@ -190,7 +194,7 @@
</span>
<span class='ocr_line' id='line_1_60' title="bbox 357 3637 1363 3667; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_324' title='bbox 357 3637 1363 3667; x_wconf 90' lang='eng' dir='ltr'>TATTCCTCGATGATCGCATGGGCTGTGATG</span>
</span>
<span class='ocr_line' id='line_1_61' title="bbox 358 3696 1363 3726; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_325' title='bbox 358 3696 1363 3726; x_wconf 77' lang='eng' dir='ltr'><a href="VB01.html">GCATCGTATCCGATCGATTCGAGCGATTGCAGC</a></span>
<span class='ocr_line' id='line_1_61' title="bbox 358 3696 1363 3726; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_325' title='bbox 358 3696 1363 3726; x_wconf 77' lang='eng' dir='ltr'>GCATCGTATCCGATCGATTCGAGCGATTGCAGC</span>
</span>
<span class='ocr_line' id='line_1_62' title="bbox 357 3754 1362 3784; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_326' title='bbox 357 3754 1362 3784; x_wconf 75' lang='eng' dir='ltr'>TACGCTATTCCTCCGAGGGATTGCAGCTACGTC</span>
</span>
@ -571,9 +575,9 @@
var l = $('.ocr_line');
l.each( function(x){ this.title = "hypervirus"; });
var p = $('.ocr_par');
var p = $('.ocr_par');
p.each( function(x){ this.title = "hypervirus"; });
var c = $('.ocr_carea');
var c = $('.ocr_carea');
c.each( function(x){ this.title = "hypervirus"; });
var ww = $('.ocrx_word');
@ -588,7 +592,7 @@
this.style.top = top + 'px';
this.style.color = "blue;"
this.title = "hypervirus";
});
});
//store all class 'ocr_line' in 'lines'
var lines = document.querySelectorAll(".ocr_line");
@ -606,18 +610,43 @@
}
}
// for (var i = 0; i < 50; i++){
// var ra = Math.floor(ww.size()*Math.random());
// var w = ww.get(ra);
// var orig = $(w).html()
// $(w).html('<a class="b" href="#">'+ orig + '</a>')
// }
// var a = $('a');
window.setInterval( function(){
// console.log('interval', ww);
var ra = Math.floor(ww.size()*Math.random());
var w = ww.get(ra);
// console.log(w);
var col = ["b", "w"];
var fs =["9px","15px"];
$(w).css('visibility', 'visible');
$(w).removeClass('ocrx_word');
$(w).addClass(col[Math.floor(Math.random()*col.length)]);
}, 150);
}, 100);
var rooms = ['FS01.html','VB01.html','./0/ilinx_0.html','Ixse2.html','Ixse2.html','Ixse2.html','Ixse2.html','cyberSit.html','./home/doorway.html','./AxS/index.html'];
function rand(){ return Math.ceil(Math.random() * (rooms.length -1)) }
window.setInterval( function(){
var ra2 = Math.floor(ww.size()*Math.random());
var a = ww.get(ra2);
var orig = $(a).html()
$(a).html('<a class="b" href='+ rooms[rand()]+'>'+ orig + '</a>')
}, 5000);
// ------------ DRAG ------------

@ -8,7 +8,7 @@
<style type="text/css">
body {
background-color: black;
font-family: mono;
font-family: "Lucida Console", Monaco, monospace;
overflow: hidden;
}
@ -24,6 +24,8 @@
.b {color: red !important;}
.w {color: white !important;}
a.b{text-decoration: none; color: blue !important;}
</style>
</head>
<body>
@ -129,7 +131,7 @@
<p class='ocr_par' dir='ltr' id='par_1_9' title="bbox 355 2293 1367 2451">
<span class='ocr_line' id='line_1_37' title="bbox 416 2293 1365 2334; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_189' title='bbox 416 2293 554 2334; x_wconf 94' lang='eng' dir='ltr'>Hyping</span> <span class='ocrx_word' id='word_1_190' title='bbox 569 2293 731 2333; x_wconf 94' lang='eng' dir='ltr'>collapses</span> <span class='ocrx_word' id='word_1_191' title='bbox 751 2302 786 2323; x_wconf 87' lang='eng' dir='ltr'>SF</span> <span class='ocrx_word' id='word_1_192' title='bbox 808 2293 878 2323; x_wconf 98' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_193' title='bbox 898 2293 1010 2323; x_wconf 95' lang='eng' dir='ltr'>CATA</span> <span class='ocrx_word' id='word_1_194' title='bbox 1027 2293 1137 2323; x_wconf 95' lang='eng' dir='ltr'>CATA</span> <span class='ocrx_word' id='word_1_195' title='bbox 1154 2293 1305 2334; x_wconf 97' lang='eng' dir='ltr'>catalytic</span> <span class='ocrx_word' id='word_1_196' title='bbox 1324 2293 1365 2323; x_wconf 99' lang='eng' dir='ltr'>tic</span>
</span>
<span class='ocr_line' id='line_1_38' title="bbox 355 2351 1367 2392; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_197' title='bbox 355 2351 524 2392; x_wconf 84' lang='eng' dir='ltr'>efficiency,</span> <span class='ocrx_word' id='word_1_198' title='bbox 534 2351 713 2392; x_wconf 93' lang='eng' dir='ltr'>re-routing</span> <span class='ocrx_word' id='word_1_199' title='bbox 723 2357 903 2381; x_wconf 98' lang='eng' dir='ltr'><a href="islands.html">tomorrow</a></span> <span class='ocrx_word' id='word_1_200' title='bbox 912 2351 1057 2392; x_wconf 96' lang='eng' dir='ltr'>through</span> <span class='ocrx_word' id='word_1_201' title='bbox 1065 2351 1153 2381; x_wconf 98' lang='eng' dir='ltr'>what</span> <span class='ocrx_word' id='word_1_202' title='bbox 1162 2351 1202 2381; x_wconf 98' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_203' title='bbox 1211 2357 1367 2391; x_wconf 94' lang='eng' dir='ltr'>prospect</span>
<span class='ocr_line' id='line_1_38' title="bbox 355 2351 1367 2392; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_197' title='bbox 355 2351 524 2392; x_wconf 84' lang='eng' dir='ltr'>efficiency,</span> <span class='ocrx_word' id='word_1_198' title='bbox 534 2351 713 2392; x_wconf 93' lang='eng' dir='ltr'>re-routing</span> <span class='ocrx_word' id='word_1_199' title='bbox 723 2357 903 2381; x_wconf 98' lang='eng' dir='ltr'>tomorrow</span> <span class='ocrx_word' id='word_1_200' title='bbox 912 2351 1057 2392; x_wconf 96' lang='eng' dir='ltr'>through</span> <span class='ocrx_word' id='word_1_201' title='bbox 1065 2351 1153 2381; x_wconf 98' lang='eng' dir='ltr'>what</span> <span class='ocrx_word' id='word_1_202' title='bbox 1162 2351 1202 2381; x_wconf 98' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_203' title='bbox 1211 2357 1367 2391; x_wconf 94' lang='eng' dir='ltr'>prospect</span>
</span>
<span class='ocr_line' id='line_1_39' title="bbox 356 2410 793 2451; baseline -0.002 -10; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_204' title='bbox 356 2411 412 2441; x_wconf 89' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_205' title='bbox 422 2410 482 2440; x_wconf 89' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_206' title='bbox 491 2410 551 2440; x_wconf 89' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_207' title='bbox 559 2410 673 2440; x_wconf 88' lang='eng' dir='ltr'>makes</span> <span class='ocrx_word' id='word_1_208' title='bbox 686 2410 793 2451; x_wconf 88' lang='eng' dir='ltr'>today.</span>
</span>
@ -148,7 +150,7 @@
<p class='ocr_par' dir='ltr' id='par_1_12' title="bbox 355 2585 1369 3154">
<span class='ocr_line' id='line_1_42' title="bbox 414 2585 1367 2626; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_220' title='bbox 414 2585 508 2615; x_wconf 93' lang='eng' dir='ltr'>Virus</span> <span class='ocrx_word' id='word_1_221' title='bbox 524 2585 551 2615; x_wconf 99' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_222' title='bbox 566 2585 719 2625; x_wconf 94' lang='eng' dir='ltr'>parasitic</span> <span class='ocrx_word' id='word_1_223' title='bbox 737 2585 780 2615; x_wconf 98' lang='eng' dir='ltr'>tic</span> <span class='ocrx_word' id='word_1_224' title='bbox 797 2585 976 2625; x_wconf 94' lang='eng' dir='ltr'>replicator</span> <span class='ocrx_word' id='word_1_225' title='bbox 991 2585 1087 2615; x_wconf 90' lang='eng' dir='ltr'>code:</span> <span class='ocrx_word' id='word_1_226' title='bbox 1105 2595 1147 2615; x_wconf 99' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_227' title='bbox 1165 2585 1367 2626; x_wconf 94' lang='eng' dir='ltr'>asignifying</span>
</span>
<span class='ocr_line' id='line_1_43' title="bbox 356 2643 1365 2683; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_228' title='bbox 356 2653 515 2683; x_wconf 93' lang='eng' dir='ltr'>sequence</span> <span class='ocrx_word' id='word_1_229' title='bbox 529 2643 567 2673; x_wconf 94' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_230' title='bbox 578 2643 741 2673; x_wconf 98' lang='eng' dir='ltr'><a href="home/doorway.html">machinic</a></span> <span class='ocrx_word' id='word_1_231' title='bbox 757 2643 833 2673; x_wconf 95' lang='eng' dir='ltr'>data</span> <span class='ocrx_word' id='word_1_232' title='bbox 846 2643 930 2673; x_wconf 91' lang='eng' dir='ltr'>ATA</span> <span class='ocrx_word' id='word_1_233' title='bbox 941 2644 1025 2673; x_wconf 95' lang='eng' dir='ltr'>ATA</span> <span class='ocrx_word' id='word_1_234' title='bbox 1040 2643 1229 2673; x_wconf 91' lang='eng' dir='ltr'>flow-break</span> <span class='ocrx_word' id='word_1_235' title='bbox 1243 2643 1365 2681; x_wconf 86' lang='eng' dir='ltr'>on/off,</span>
<span class='ocr_line' id='line_1_43' title="bbox 356 2643 1365 2683; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_228' title='bbox 356 2653 515 2683; x_wconf 93' lang='eng' dir='ltr'>sequence</span> <span class='ocrx_word' id='word_1_229' title='bbox 529 2643 567 2673; x_wconf 94' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_230' title='bbox 578 2643 741 2673; x_wconf 98' lang='eng' dir='ltr'>machinic</span> <span class='ocrx_word' id='word_1_231' title='bbox 757 2643 833 2673; x_wconf 95' lang='eng' dir='ltr'>data</span> <span class='ocrx_word' id='word_1_232' title='bbox 846 2643 930 2673; x_wconf 91' lang='eng' dir='ltr'>ATA</span> <span class='ocrx_word' id='word_1_233' title='bbox 941 2644 1025 2673; x_wconf 95' lang='eng' dir='ltr'>ATA</span> <span class='ocrx_word' id='word_1_234' title='bbox 1040 2643 1229 2673; x_wconf 91' lang='eng' dir='ltr'>flow-break</span> <span class='ocrx_word' id='word_1_235' title='bbox 1243 2643 1365 2681; x_wconf 86' lang='eng' dir='ltr'>on/off,</span>
</span>
<span class='ocr_line' id='line_1_44' title="bbox 356 2703 1369 2744; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_236' title='bbox 356 2703 419 2741; x_wconf 94' lang='eng'>1/0,</span> <span class='ocrx_word' id='word_1_237' title='bbox 434 2703 594 2744; x_wconf 96' lang='eng' dir='ltr'>yang/yin</span> <span class='ocrx_word' id='word_1_238' title='bbox 609 2703 824 2744; x_wconf 93' lang='eng' dir='ltr'>intrinsically</span> <span class='ocrx_word' id='word_1_239' title='bbox 838 2703 994 2733; x_wconf 95' lang='eng' dir='ltr'>destined</span> <span class='ocrx_word' id='word_1_240' title='bbox 1010 2703 1062 2733; x_wconf 94' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_241' title='bbox 1076 2713 1148 2733; x_wconf 98' lang='eng' dir='ltr'>war.</span> <span class='ocrx_word' id='word_1_242' title='bbox 1167 2704 1206 2733; x_wconf 93' lang='eng' dir='ltr'>In</span> <span class='ocrx_word' id='word_1_243' title='bbox 1220 2703 1314 2743; x_wconf 94' lang='eng' dir='ltr'>place</span> <span class='ocrx_word' id='word_1_244' title='bbox 1330 2703 1369 2733; x_wconf 94' lang='eng' dir='ltr'>of</span>
</span>
@ -190,7 +192,7 @@
</span>
<span class='ocr_line' id='line_1_60' title="bbox 357 3637 1363 3667; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_324' title='bbox 357 3637 1363 3667; x_wconf 90' lang='eng' dir='ltr'>TATTCCTCGATGATCGCATGGGCTGTGATG</span>
</span>
<span class='ocr_line' id='line_1_61' title="bbox 358 3696 1363 3726; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_325' title='bbox 358 3696 1363 3726; x_wconf 77' lang='eng' dir='ltr'><a href="VB01.html">GCATCGTATCCGATCGATTCGAGCGATTGCAGC</a></span>
<span class='ocr_line' id='line_1_61' title="bbox 358 3696 1363 3726; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_325' title='bbox 358 3696 1363 3726; x_wconf 77' lang='eng' dir='ltr'>GCATCGTATCCGATCGATTCGAGCGATTGCAGC</span>
</span>
<span class='ocr_line' id='line_1_62' title="bbox 357 3754 1362 3784; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_326' title='bbox 357 3754 1362 3784; x_wconf 75' lang='eng' dir='ltr'>TACGCTATTCCTCCGAGGGATTGCAGCTACGTC</span>
</span>
@ -620,6 +622,18 @@
}, 150);
var rooms = ['FS01.html','VB01.html','./0/ilinx_0.html','Ixse.html','Ixse.html','Ixse.html','Ixse.html','cyberSit.html','./home/doorway.html','./AxS/index.html'];
function rand(){ return Math.ceil(Math.random() * (rooms.length -1)) }
window.setInterval( function(){
var ra2 = Math.floor(ww.size()*Math.random());
var a = ww.get(ra2);
var orig = $(a).html()
$(a).html('<a class="b" href='+ rooms[rand()]+'>'+ orig + '</a>')
}, 5000);
// ------------ DRAG ------------
$( function() {

@ -1,16 +1,15 @@
<!DOCTYPE html>
<html>
<head>
<meta http-equiv="content-type" content="text/html; charset=UTF-8">
<title> @@@ilinχ </title>
<script src="https://code.jquery.com/jquery-1.12.4.js"></script>
<script src="https://code.jquery.com/ui/1.12.1/jquery-ui.js"></script>
<!-- <link rel="stylesheet" type="text/css" href="style.css"> -->
<style type="text/css">
<head>
<meta http-equiv="content-type" content="text/html; charset=UTF-8">
<title> VB01 @ ilinx </title>
<script src="https://code.jquery.com/jquery-1.12.4.js"></script>
<script src="https://code.jquery.com/ui/1.12.1/jquery-ui.js"></script>
<style type="text/css">
body {
background: black;
/*overflow: hidden;*/
font-family: mono;
font-family: "Lucida Console", Monaco, monospace;
}
#vBush {
@ -24,8 +23,8 @@
line-height: 5px;
font-size: 15px;
word-spacing: -10px;
/* text-decoration: blanchedalmond;
text-decoration-style: solid;
/*text-decoration: blanchedalmond;
text-decoration-style: solid;
text-decoration-style: dotted;
text-shadow: 10px 10px red;*/
transition-duration: 5s;
@ -45,40 +44,40 @@
color: blue;
}
</style>
</head>
<body>
</style>
</head>
<body>
<div id="vBush" class="start draggable" onclick="transition()">
<h1><a href="http://worrydream.com/refs/Bush%20-%20As%20We%20May%20Think%20(Life%20Magazine%209-10-1945).pdf" onClick="return popup(this, '000', '1000', '800','1000','500')">AS WE MAY THINK</a></h1>
by VANNEVAR BUSH<br><br>
THE ATLANTIC MONTHLY, JULY 1945 <br><br>
---------------------------------------------------------------------- <br><br>
As Director of the Office of Scientific Research and Development, Dr.
Vannevar Bush has coordinated the activities of some six thousand
leading American scientists in the application of science to warfare.
In this significant article he holds up an incentive for scientists
when the fighting has ceased. He urges that men of science should
then turn to the massive task of making more accessible our
bewildering store of knowledge. For many years inventions have
extended man's physical powers rather than the powers of his mind.
Trip hammers that multiply the fists, microscopes that sharpen the
eye, and engines of destruction and detection are new results, but the
end results, of modern science. Now, says Dr. Bush, instruments are
at hand which, if properly developed, will give man access to and
command over the inherited knowledge of the ages. The perfection of
these pacific instruments should be the first objective of our
scientists as they emerge from their war work. Like Emerson's famous
address of 1837 on "The American Scholar", this paper by Dr. Bush
calls for a new relationship between thinking man and the sum of our
knowledge. - The Editor <br><br>
----------------------------------------------------------------------<br><br>
<div id="b">
<h1><a href="http://worrydream.com/refs/Bush%20-%20As%20We%20May%20Think%20(Life%20Magazine%209-10-1945).pdf" onClick="return popup(this, '000', '1000', '800','1000','500')">AS WE MAY THINK</a></h1>
by VANNEVAR BUSH<br><br>
THE ATLANTIC MONTHLY, JULY 1945 <br><br>
---------------------------------------------------------------------- <br><br>
As Director of the Office of Scientific Research and Development, Dr.
Vannevar Bush has coordinated the activities of some six thousand
leading American scientists in the application of science to warfare.
In this significant article he holds up an incentive for scientists
when the fighting has ceased. He urges that men of science should
then turn to the massive task of making more accessible our
bewildering store of knowledge. For many years inventions have
extended man's physical powers rather than the powers of his mind.
Trip hammers that multiply the fists, microscopes that sharpen the
eye, and engines of destruction and detection are new results, but the
end results, of modern science. Now, says Dr. Bush, instruments are
at hand which, if properly developed, will give man access to and
command over the inherited knowledge of the ages. The perfection of
these pacific instruments should be the first objective of our
scientists as they emerge from their war work. Like Emerson's famous
address of 1837 on "The American Scholar", this paper by Dr. Bush
calls for a new relationship between thinking man and the sum of our
knowledge. - The Editor <br><br>
----------------------------------------------------------------------<br><br>
<div id="b">
This has not been a scientist's war; it has been a war in which all
have had a part. The scientists, burying their old professional
competition in the demand of a common cause, have shared greatly and
@ -889,166 +888,158 @@ to wield that record for his true good. Yet, in the application of
science to the needs and desires of man, it would seem to be a
singularly unfortunate stage at which to terminate the process, or to
lose hope as to the outcome.
</div>
</div>
<script>
</div>
</div>
<script>
var rooms = ['FS01.html','Ixse.html','./0/ilinx_0.html','Ixse2.html','cyberSit.html','./home/doorway.html','./AxS/index.html'];
function rand(){ return Math.ceil(Math.random() * res.length) }
function rand2(){ return Math.ceil(Math.random() * rooms.length)-1 }
for (var i = 0; i < 200; i++) {
var str = $('#b').html();
var res = str.split(" ");
var word = res[rand()];
console.log(rand());
var newstr = str.replace(word, '<a href="'+ rooms[rand2()] + '">'+ word + '</a>');
console.log(word);
$('#b').html(newstr);
}
var div = document.getElementById("vBush");
div.addEventListener("click", x => {
div.classList.toggle("start");
// var vb = document.getElementById('vBush').style;
// vb.letterSpacing = "0px";
// vb.lineHeight =" 18px";
// vb.fontSize = "15px";
// vb.wordSpacing = "0px";
})
function pWord(){
var value = parseInt(document.getElementById('vBush').value, 10);
value = isNaN(value) ? 0 : value;
value += 5;
document.getElementById('vBush').value = value;
document.getElementById('vBush').style.wordSpacing = value + 'px';
}
function mWord(){
var value = parseInt(document.getElementById('vBush').value, 10);
value = isNaN(value) ? 0 : value;
value -=5;
document.getElementById('vBush').value = value;
document.getElementById('vBush').style.wordSpacing = value + 'px';
}
function pLetter(){
var value = parseInt(document.getElementById('vBush').value, 10);
value = isNaN(value) ? 0 : value;
value ++;
document.getElementById('vBush').value = value;
document.getElementById('vBush').style.letterSpacing = value + 'px';
}
function mLetter(){
var value = parseInt(document.getElementById('vBush').value, 10);
value = isNaN(value) ? 0 : value;
value--;
document.getElementById('vBush').value = value;
document.getElementById('vBush').style.letterSpacing = value + 'px';
}
function pLine(){
var value = parseInt(document.getElementById('vBush').value, 10);
value = isNaN(value) ? 0 : value;
value++;
document.getElementById('vBush').value = value;
document.getElementById('vBush').style.lineHeight = value + 'px';
}
function mLine(){
var value = parseInt(document.getElementById('vBush').value, 10);
value = isNaN(value) ? 0 : value;
value = "18";
document.getElementById('vBush').value = value;
document.getElementById('vBush').style.lineHeight = value + 'px';
}
function pFont(){
var value = parseInt(document.getElementById('vBush').value, 10);
value = isNaN(value) ? 0 : value;
value++;
document.getElementById('vBush').value = value;
document.getElementById('vBush').style.fontSize = value + 'px';
}
function mFont(){
var value = parseInt(document.getElementById('vBush').value, 10) + 10;
value = isNaN(value) ? 0 : value;
value = "15";
document.getElementById('vBush').value = value;
document.getElementById('vBush').style.fontSize = value + 'px';
}
$(document).keydown(
function(e)
{
if (e.keyCode == 39) {
pLetter();
e.preventDefault();
}
if (e.keyCode == 37) {
mLetter();
e.preventDefault();
}
if (e.keyCode == 38) {
pWord();
e.preventDefault();
}
if (e.keyCode == 40) {
mWord();
e.preventDefault();
}
if (e.keyCode == 87) {
pLine()
}
if (e.keyCode == 83) {
mLine();
}
if (e.keyCode == 68) {
pFont();
}
if (e.keyCode == 65) {
mFont();
}
}
);
</script>
<script type="text/javascript" src="../scripts/drag.js"></script>
<script type="text/javascript">
// GENERATE RANDOM LINKS
var rooms = ['FS01.html','Ixse.html','./0/ilinx_0.html','Ixse2.html','cyberSit.html','./home/doorway.html','./AxS/index.html'];
function rand(){ return Math.ceil(Math.random() * res.length) }
function rand2(){ return Math.ceil(Math.random() * (rooms.length -1)) }
for (var i = 0; i < 200; i++) {
var str = $('#b').html();
var res = str.split(" ");
var word = res[rand()];
console.log(rand());
var newstr = str.replace(word, '<a href='+ rooms[rand2()] + '>'+ word + '</a>');
console.log(word);
$('#b').html(newstr);
}
// ANIMATIONS & KEYBINDING
var div = document.getElementById("vBush");
div.addEventListener("click", x => {
div.classList.toggle("start");
// var vb = document.getElementById('vBush').style;
// vb.letterSpacing = "0px";
// vb.lineHeight =" 18px";
// vb.fontSize = "15px";
// vb.wordSpacing = "0px";
})
function pWord(){
var value = parseInt(document.getElementById('vBush').value, 10);
value = isNaN(value) ? 0 : value;
value += 5;
document.getElementById('vBush').value = value;
document.getElementById('vBush').style.wordSpacing = value + 'px';
}
function mWord(){
var value = parseInt(document.getElementById('vBush').value, 10);
value = isNaN(value) ? 0 : value;
value -=5;
document.getElementById('vBush').value = value;
document.getElementById('vBush').style.wordSpacing = value + 'px';
}
function pLetter(){
var value = parseInt(document.getElementById('vBush').value, 10);
value = isNaN(value) ? 0 : value;
value ++;
document.getElementById('vBush').value = value;
document.getElementById('vBush').style.letterSpacing = value + 'px';
}
function mLetter(){
var value = parseInt(document.getElementById('vBush').value, 10);
value = isNaN(value) ? 0 : value;
value--;
document.getElementById('vBush').value = value;
document.getElementById('vBush').style.letterSpacing = value + 'px';
}
function pLine(){
var value = parseInt(document.getElementById('vBush').value, 10);
value = isNaN(value) ? 0 : value;
value++;
document.getElementById('vBush').value = value;
document.getElementById('vBush').style.lineHeight = value + 'px';
}
function mLine(){
var value = parseInt(document.getElementById('vBush').value, 10);
value = isNaN(value) ? 0 : value;
value = "18";
document.getElementById('vBush').value = value;
document.getElementById('vBush').style.lineHeight = value + 'px';
}
function pFont(){
var value = parseInt(document.getElementById('vBush').value, 10);
value = isNaN(value) ? 0 : value;
value++;
document.getElementById('vBush').value = value;
document.getElementById('vBush').style.fontSize = value + 'px';
}
function mFont(){
var value = parseInt(document.getElementById('vBush').value, 10) + 10;
value = isNaN(value) ? 0 : value;
value = "15";
document.getElementById('vBush').value = value;
document.getElementById('vBush').style.fontSize = value + 'px';
}
$(document).keydown(
function(e)
{
if (e.keyCode == 39) {
pLetter();
e.preventDefault();
}
if (e.keyCode == 37) {
mLetter();
e.preventDefault();
}
if (e.keyCode == 38) {
pWord();
e.preventDefault();
}
if (e.keyCode == 40) {
mWord();
e.preventDefault();
}
if (e.keyCode == 87) {
pLine()
}
if (e.keyCode == 83) {
mLine();
}
if (e.keyCode == 68) {
pFont();
}
if (e.keyCode == 65) {
mFont();
}
}
);
//POPUP TEXT
var w = window.innerWidth;
var h = window.innerHeight;
function posX(){ return Math.ceil(Math.random() * w)-200 }
function posY(){ return Math.ceil(Math.random() * h) }
function popup(mylink, windowname, width, height) {
if (! window.focus)return true;
var href;
if (typeof(mylink) == 'string') href=mylink;
else href=mylink.href;
var open = window.open(href, windowname, 'width=' + width + ',height='+ height + ',left=' + posX() + ',top=' + posY());
open.focus();
// setTimeout(function(){ open.close(); }, 15000);
return false;
}
function popup(mylink, windowname, width, height) {
if (! window.focus)return true;
var href;
if (typeof(mylink) == 'string') href=mylink;
else href=mylink.href;
var open = window.open(href, windowname, 'width=' + width + ',height='+ height + ',left=' + posX() + ',top=' + posY());
open.focus();
// setTimeout(function(){ open.close(); }, 15000);
return false;
}
</script>
<script type="text/javascript" src="../scripts/drag.js"></script>
</body>
</html>

@ -5,7 +5,8 @@ overflow: hidden;
background-color: black;
color: white;}
p { font-size: 20px; }
p { font-size: 20px;
}
a{ text-decoration: none; }

Loading…
Cancel
Save