From ab23419dbddbcd0982c36ceb7a35d2f7245aeb4e Mon Sep 17 00:00:00 2001 From: Tancre Date: Tue, 9 Jun 2020 16:44:29 +0200 Subject: [PATCH] VB01 --- main/world1/AxS/000.html | 2 +- main/world1/AxS/0001.html | 2 +- main/world1/AxS/0002.html | 2 +- main/world1/AxS/0003.html | 2 +- main/world1/AxS/00031.html | 2 +- main/world1/AxS/00032.html | 2 +- main/world1/AxS/00033.html | 2 +- main/world1/AxS/001.html | 4 +- main/world1/AxS/0011.html | 2 +- main/world1/AxS/00111.html | 4 +- main/world1/AxS/002.html | 2 +- main/world1/AxS/0021.html | 2 +- main/world1/AxS/00211.html | 2 +- main/world1/AxS/003.html | 2 +- main/world1/AxS/0031.html | 2 +- main/world1/AxS/0032.html | 2 +- main/world1/AxS/01.html | 2 +- main/world1/AxS/011.html | 2 +- main/world1/AxS/0111.html | 2 +- main/world1/AxS/02.html | 4 +- main/world1/AxS/021.html | 2 +- main/world1/AxS/022.html | 2 +- main/world1/AxS/0221.html | 2 +- main/world1/AxS/02211.html | 2 +- main/world1/AxS/022111.html | 2 +- main/world1/AxS/03.html | 2 +- main/world1/AxS/031.html | 2 +- main/world1/AxS/032.html | 2 +- main/world1/AxS/033.html | 2 +- main/world1/AxS/1.html | 2 +- main/world1/AxS/11.html | 2 +- main/world1/AxS/12.html | 2 +- main/world1/AxS/121.html | 2 +- main/world1/AxS/1211.html | 2 +- main/world1/AxS/13.html | 2 +- main/world1/AxS/131.html | 2 +- main/world1/AxS/132.html | 2 +- main/world1/AxS/2.html | 2 +- main/world1/AxS/21.html | 2 +- main/world1/AxS/211.html | 2 +- main/world1/AxS/2111.html | 2 +- main/world1/AxS/21111.html | 2 +- main/world1/AxS/22.html | 2 +- main/world1/AxS/221.html | 2 +- main/world1/AxS/2211.html | 2 +- main/world1/AxS/22111.html | 2 +- main/world1/AxS/221111.html | 2 +- main/world1/AxS/2211111.html | 2 +- main/world1/AxS/22111111.html | 2 +- main/world1/AxS/222.html | 2 +- main/world1/AxS/3.html | 2 +- main/world1/AxS/31.html | 2 +- main/world1/AxS/311.html | 2 +- main/world1/AxS/32.html | 2 +- main/world1/AxS/33.html | 4 +- main/world1/AxS/index.html | 12 +- main/world1/AxS/ppp.js | 22 +- main/world1/AxS/style.css | 30 ++- main/world1/AxS/x1.html | 2 +- main/world1/AxS/x10.html | 2 +- main/world1/AxS/x11.html | 2 +- main/world1/AxS/x12.html | 2 +- main/world1/AxS/x13.html | 2 +- main/world1/AxS/x14.html | 2 +- main/world1/AxS/x15.html | 2 +- main/world1/AxS/x16.html | 2 +- main/world1/AxS/x17.html | 2 +- main/world1/AxS/x18.html | 2 +- main/world1/AxS/x19.html | 2 +- main/world1/AxS/x2.html | 2 +- main/world1/AxS/x20.html | 2 +- main/world1/AxS/x21.html | 2 +- main/world1/AxS/x22.html | 2 +- main/world1/AxS/x23.html | 2 +- main/world1/AxS/x24.html | 2 +- main/world1/AxS/x25.html | 2 +- main/world1/AxS/x26.html | 2 +- main/world1/AxS/x27.html | 2 +- main/world1/AxS/x28.html | 2 +- main/world1/AxS/x3.html | 2 +- main/world1/AxS/x4.html | 2 +- main/world1/AxS/x5.html | 2 +- main/world1/AxS/x6.html | 2 +- main/world1/AxS/x7.html | 2 +- main/world1/AxS/x8.html | 2 +- main/world1/AxS/x9.html | 2 +- main/world1/FS01.html | 4 +- main/world1/Ixse.html | 45 +++- main/world1/Ixse2.html | 22 +- main/world1/VB01.html | 383 +++++++++++++++++----------------- main/world1/style.css | 3 +- 91 files changed, 380 insertions(+), 315 deletions(-) diff --git a/main/world1/AxS/000.html b/main/world1/AxS/000.html index 58a89a2..36a598e 100644 --- a/main/world1/AxS/000.html +++ b/main/world1/AxS/000.html @@ -7,7 +7,7 @@ -

AxS:000Oedipus. Pure (Oedipal (figure made out of (nothing but))) time-distortion.

+

AxS:000Oedipus. Pure (Oedipal (figure made out of (nothing but))) time-distortion.

\ No newline at end of file diff --git a/main/world1/AxS/0001.html b/main/world1/AxS/0001.html index 628a5ea..3ba90e5 100644 --- a/main/world1/AxS/0001.html +++ b/main/world1/AxS/0001.html @@ -9,7 +9,7 @@ -

AxS:0001 Closed fate (-loop (multi-linear)) nightmares.1

+

AxS:0001 Closed fate (-loop (multi-linear)) nightmares.1

\ No newline at end of file diff --git a/main/world1/AxS/0002.html b/main/world1/AxS/0002.html index 2d2a4fe..2ad1a3e 100644 --- a/main/world1/AxS/0002.html +++ b/main/world1/AxS/0002.html @@ -8,8 +8,8 @@ -

AxS:0002 Altitude times Spin produces a chronometric read-out.

+

AxS:0002 Altitude times Spin produces a chronometric read-out.

@@ -129,7 +133,7 @@

Hyping collapses SF into CATA CATA catalytic tic - efficiency, re-routing tomorrow through what its prospect + efficiency, re-routing tomorrow through what its prospect CT CT CT makes today. @@ -148,7 +152,7 @@

Virus is parasitic tic replicator code: an asignifying - sequence of machinic data ATA ATA flow-break on/off, + sequence of machinic data ATA ATA flow-break on/off, 1/0, yang/yin intrinsically destined for war. In place of @@ -190,7 +194,7 @@ TATTCCTCGATGATCGCATGGGCTGTGATG - GCATCGTATCCGATCGATTCGAGCGATTGCAGC + GCATCGTATCCGATCGATTCGAGCGATTGCAGC TACGCTATTCCTCCGAGGGATTGCAGCTACGTC @@ -571,9 +575,9 @@ var l = $('.ocr_line'); l.each( function(x){ this.title = "hypervirus"; }); - var p = $('.ocr_par'); + var p = $('.ocr_par'); p.each( function(x){ this.title = "hypervirus"; }); - var c = $('.ocr_carea'); + var c = $('.ocr_carea'); c.each( function(x){ this.title = "hypervirus"; }); var ww = $('.ocrx_word'); @@ -588,7 +592,7 @@ this.style.top = top + 'px'; this.style.color = "blue;" this.title = "hypervirus"; - }); + }); //store all class 'ocr_line' in 'lines' var lines = document.querySelectorAll(".ocr_line"); @@ -606,18 +610,43 @@ } } + // for (var i = 0; i < 50; i++){ + // var ra = Math.floor(ww.size()*Math.random()); + // var w = ww.get(ra); + + // var orig = $(w).html() + // $(w).html(''+ orig + '') + // } + + // var a = $('a'); window.setInterval( function(){ // console.log('interval', ww); var ra = Math.floor(ww.size()*Math.random()); + var w = ww.get(ra); + + // console.log(w); var col = ["b", "w"]; var fs =["9px","15px"]; $(w).css('visibility', 'visible'); $(w).removeClass('ocrx_word'); $(w).addClass(col[Math.floor(Math.random()*col.length)]); - }, 150); + }, 100); + + + + var rooms = ['FS01.html','VB01.html','./0/ilinx_0.html','Ixse2.html','Ixse2.html','Ixse2.html','Ixse2.html','cyberSit.html','./home/doorway.html','./AxS/index.html']; + + function rand(){ return Math.ceil(Math.random() * (rooms.length -1)) } + + window.setInterval( function(){ + var ra2 = Math.floor(ww.size()*Math.random()); + var a = ww.get(ra2); + var orig = $(a).html() + $(a).html(''+ orig + '') + }, 5000); // ------------ DRAG ------------ diff --git a/main/world1/Ixse2.html b/main/world1/Ixse2.html index 1a66328..76a6c4a 100644 --- a/main/world1/Ixse2.html +++ b/main/world1/Ixse2.html @@ -8,7 +8,7 @@ @@ -129,7 +131,7 @@

Hyping collapses SF into CATA CATA catalytic tic - efficiency, re-routing tomorrow through what its prospect + efficiency, re-routing tomorrow through what its prospect CT CT CT makes today. @@ -148,7 +150,7 @@

Virus is parasitic tic replicator code: an asignifying - sequence of machinic data ATA ATA flow-break on/off, + sequence of machinic data ATA ATA flow-break on/off, 1/0, yang/yin intrinsically destined for war. In place of @@ -190,7 +192,7 @@ TATTCCTCGATGATCGCATGGGCTGTGATG - GCATCGTATCCGATCGATTCGAGCGATTGCAGC + GCATCGTATCCGATCGATTCGAGCGATTGCAGC TACGCTATTCCTCCGAGGGATTGCAGCTACGTC @@ -620,6 +622,18 @@ }, 150); + var rooms = ['FS01.html','VB01.html','./0/ilinx_0.html','Ixse.html','Ixse.html','Ixse.html','Ixse.html','cyberSit.html','./home/doorway.html','./AxS/index.html']; + + function rand(){ return Math.ceil(Math.random() * (rooms.length -1)) } + + window.setInterval( function(){ + var ra2 = Math.floor(ww.size()*Math.random()); + var a = ww.get(ra2); + var orig = $(a).html() + $(a).html(''+ orig + '') + }, 5000); + + // ------------ DRAG ------------ $( function() { diff --git a/main/world1/VB01.html b/main/world1/VB01.html index 746a48c..7b8e551 100644 --- a/main/world1/VB01.html +++ b/main/world1/VB01.html @@ -1,16 +1,15 @@ - - - @@@ilinχ - - - - - - + + +

-

AS WE MAY THINK

- - by VANNEVAR BUSH

- THE ATLANTIC MONTHLY, JULY 1945

- -----------------------------------------------------------------------

- -As Director of the Office of Scientific Research and Development, Dr. -Vannevar Bush has coordinated the activities of some six thousand -leading American scientists in the application of science to warfare. -In this significant article he holds up an incentive for scientists -when the fighting has ceased. He urges that men of science should -then turn to the massive task of making more accessible our -bewildering store of knowledge. For many years inventions have -extended man's physical powers rather than the powers of his mind. -Trip hammers that multiply the fists, microscopes that sharpen the -eye, and engines of destruction and detection are new results, but the -end results, of modern science. Now, says Dr. Bush, instruments are -at hand which, if properly developed, will give man access to and -command over the inherited knowledge of the ages. The perfection of -these pacific instruments should be the first objective of our -scientists as they emerge from their war work. Like Emerson's famous -address of 1837 on "The American Scholar", this paper by Dr. Bush -calls for a new relationship between thinking man and the sum of our -knowledge. - The Editor

- - -----------------------------------------------------------------------

- -
+

AS WE MAY THINK

+ + by VANNEVAR BUSH

+ THE ATLANTIC MONTHLY, JULY 1945

+ + ----------------------------------------------------------------------

+ + As Director of the Office of Scientific Research and Development, Dr. + Vannevar Bush has coordinated the activities of some six thousand + leading American scientists in the application of science to warfare. + In this significant article he holds up an incentive for scientists + when the fighting has ceased. He urges that men of science should + then turn to the massive task of making more accessible our + bewildering store of knowledge. For many years inventions have + extended man's physical powers rather than the powers of his mind. + Trip hammers that multiply the fists, microscopes that sharpen the + eye, and engines of destruction and detection are new results, but the + end results, of modern science. Now, says Dr. Bush, instruments are + at hand which, if properly developed, will give man access to and + command over the inherited knowledge of the ages. The perfection of + these pacific instruments should be the first objective of our + scientists as they emerge from their war work. Like Emerson's famous + address of 1837 on "The American Scholar", this paper by Dr. Bush + calls for a new relationship between thinking man and the sum of our + knowledge. - The Editor

+ + + ----------------------------------------------------------------------

+ +
This has not been a scientist's war; it has been a war in which all have had a part. The scientists, burying their old professional competition in the demand of a common cause, have shared greatly and @@ -889,166 +888,158 @@ to wield that record for his true good. Yet, in the application of science to the needs and desires of man, it would seem to be a singularly unfortunate stage at which to terminate the process, or to lose hope as to the outcome. -
-
- - - + \ No newline at end of file diff --git a/main/world1/style.css b/main/world1/style.css index 0f36c82..48aef05 100644 --- a/main/world1/style.css +++ b/main/world1/style.css @@ -5,7 +5,8 @@ overflow: hidden; background-color: black; color: white;} -p { font-size: 20px; } +p { font-size: 20px; +} a{ text-decoration: none; }