Tancre
/
ilinx
1
0
Fork 0
Code Issues Pull Requests Releases Wiki Activity

axs

Browse Source
master
Tancre 4 years ago
parent f9b86396a5
commit 7dc50b2e22
188 changed files with 4794 additions and 35 deletions
Show Stats Download Patch File Download Diff File

30
code_base/bgs/1.html
View File

File diff suppressed because one or more lines are too long

148
code_base/bgs/1_files/blizard.js
Unescape Escape View File

@ -0,0 +1,148 @@
//blizard.js version 0.5.1 BETA by Rohan Samra-O'Neill
/*
uses the atomo.css library created by Rohan Samra-O'Neill
*/
"use strict";
//inspired by jquery and p5.js :), thanks to p5.js and the processing team for featuring blizard.js on there site
var sl = {};
var id;
var storage;
//just a little message to anyone who goes onto a website that uses blizard.js
console.info("This project uses blizard.js for more info go to https://github.com/Slitherlizard/blizard.js");
//with sl.ready the parameter is the function that will run when the page is loaded, i needed to add this in version 0.4 because it's a DOM library and functions wheren't working because the elements couldn't be found because they werent loaded yet
sl.ready = function(sel) {
window.onload = function() {
// basically just runs whatever function that the selector is equal to
window.setTimeout(sel, 0);
}
}
//with sl.print the first parameter is the id of the element you want to change the second is the text you want to change it to
sl.print = function (sel, txt) {
document.getElementById(sel).innerHTML = txt;
};
//with sl.hide the parameter is the id of the element you want to hide
sl.hide = function (sel) {
id = document.getElementById(sel);
id.style.display = "none";
};
//with sl.show the parameter is the id of the element you want to show
sl.show = function (sel) {
id = document.getElementById(sel);
id.style.display = "block";
};
//with sl.col the first parameter is the id of the element you want to change the color of, the second parameter is the color you want to change it to
sl.col = function(sel, col) {
document.getElementById(sel).style.color = col;
}
//with sl.family the first parameter is the id of the element you want to change the font-family of, the second parameter is the font family you want to change it to
sl.family = function(sel, sel2) {
document.getElementById(sel).style.fontFamily = sel2;
}
//with sl.size the first parameter is the id of the element you want to change the size of, the second parameter is the size you want to change it to these are the sizes you can use
/*
xx-small
x-small
small
medium
large
x-large
xx-large
smaller
larger
*/
sl.size = function(sel, sel2) {
document.getElementById(sel).style.fontSize = sel2;
}
//with sl.wait the first parameter is where you call the function you want to run, the second parameter is the amount of milliseconds you want towait to call that function
sl.wait = function(sel, sel2) {
window.setTimeout(sel, sel2);
}
// with sl.setlocalstorage the first parameter is the name of your localstorge item so that you can refer to it later, the second parameter is the value of your item.
sl.setlocalstorage = function(sel, sel2) {
localStorage.setItem(sel, sel2);
}
// with sl.printlocalstorage the first parameter is the name of the localstorge item you want to print the value of, the second parameter is the id of the element you want to print the item's value to.
sl.printlocalstorage = function(sel, sel2) {
document.getElementById(sel).innerHTML = localStorage.getItem(sel2);
}
// with sl.click the first parameter is the id of the element you want to add an onclick attribute to, the second parameter is the function that will be ran when that element gets clicked
sl.click = function(sel, sel2) {
document.getElementById(sel).onclick = function() { window.setTimeout(sel2, 0); };
}
// with sl.id the first parameter is the id of the element you want to change the id of, the second parameter is the new id of that element
sl.id = function(sel, sel1) {
document.getElementById(sel).id = sel1;
}
//from line 92 - 124 i think i liked inporting other librarys too much
//just loads the atomo.css library for styles
sl.atomo = function () {
var head = document.getElementsByTagName('HEAD')[0];
// Create new link Element
var link = document.createElement('link');
// set the attributes for link element
link.rel = 'stylesheet';
link.type = 'text/css';
//load atomo.css library
link.href = "http://atomo.ueuo.com/atomo.css";
// Append link element to HTML head
head.appendChild(link);
}
/*sl.import does not work yet :(
sl.import = function(sel) {
var head = document.getElementsByTagName('HEAD')[0];
// Create new link Element
var link = document.createElement('link');
// set the attributes for link element
link.rel = 'stylesheet';
link.type = 'text/css';
link.href = sel;
// Append link element to HTML head
head.appendChild(link);
}
*/
//I have wanted to add this since version 0.0.1 but didn't know how but now i do know how so i'll add it.
//with sl.createElement() the first parameteris the element you want to create like P be sure to wright it in capital letters and the second parameter is the element you want to append it to the third parameter is the id you would like to give that element
sl.createElement = function (sel, sel1, sel2) {
var father = document.getElementsByTagName(sel1)[0];
// Create new Element
var elem = document.createElement(sel);
//give the element an id
elem.id = sel2;
// Append link element to HTML head
father.appendChild(elem);
}
sl.changeBackgroundColor = function(sel, sel1) {
document.getElementById(sel).style.backgroundColor = sel1;
}

58
code_base/bgs/2.html
View File

File diff suppressed because one or more lines are too long

148
code_base/bgs/2_files/blizard.js
Unescape Escape View File

@ -0,0 +1,148 @@
//blizard.js version 0.5.1 BETA by Rohan Samra-O'Neill
/*
uses the atomo.css library created by Rohan Samra-O'Neill
*/
"use strict";
//inspired by jquery and p5.js :), thanks to p5.js and the processing team for featuring blizard.js on there site
var sl = {};
var id;
var storage;
//just a little message to anyone who goes onto a website that uses blizard.js
console.info("This project uses blizard.js for more info go to https://github.com/Slitherlizard/blizard.js");
//with sl.ready the parameter is the function that will run when the page is loaded, i needed to add this in version 0.4 because it's a DOM library and functions wheren't working because the elements couldn't be found because they werent loaded yet
sl.ready = function(sel) {
window.onload = function() {
// basically just runs whatever function that the selector is equal to
window.setTimeout(sel, 0);
}
}
//with sl.print the first parameter is the id of the element you want to change the second is the text you want to change it to
sl.print = function (sel, txt) {
document.getElementById(sel).innerHTML = txt;
};
//with sl.hide the parameter is the id of the element you want to hide
sl.hide = function (sel) {
id = document.getElementById(sel);
id.style.display = "none";
};
//with sl.show the parameter is the id of the element you want to show
sl.show = function (sel) {
id = document.getElementById(sel);
id.style.display = "block";
};
//with sl.col the first parameter is the id of the element you want to change the color of, the second parameter is the color you want to change it to
sl.col = function(sel, col) {
document.getElementById(sel).style.color = col;
}
//with sl.family the first parameter is the id of the element you want to change the font-family of, the second parameter is the font family you want to change it to
sl.family = function(sel, sel2) {
document.getElementById(sel).style.fontFamily = sel2;
}
//with sl.size the first parameter is the id of the element you want to change the size of, the second parameter is the size you want to change it to these are the sizes you can use
/*
xx-small
x-small
small
medium
large
x-large
xx-large
smaller
larger
*/
sl.size = function(sel, sel2) {
document.getElementById(sel).style.fontSize = sel2;
}
//with sl.wait the first parameter is where you call the function you want to run, the second parameter is the amount of milliseconds you want towait to call that function
sl.wait = function(sel, sel2) {
window.setTimeout(sel, sel2);
}
// with sl.setlocalstorage the first parameter is the name of your localstorge item so that you can refer to it later, the second parameter is the value of your item.
sl.setlocalstorage = function(sel, sel2) {
localStorage.setItem(sel, sel2);
}
// with sl.printlocalstorage the first parameter is the name of the localstorge item you want to print the value of, the second parameter is the id of the element you want to print the item's value to.
sl.printlocalstorage = function(sel, sel2) {
document.getElementById(sel).innerHTML = localStorage.getItem(sel2);
}
// with sl.click the first parameter is the id of the element you want to add an onclick attribute to, the second parameter is the function that will be ran when that element gets clicked
sl.click = function(sel, sel2) {
document.getElementById(sel).onclick = function() { window.setTimeout(sel2, 0); };
}
// with sl.id the first parameter is the id of the element you want to change the id of, the second parameter is the new id of that element
sl.id = function(sel, sel1) {
document.getElementById(sel).id = sel1;
}
//from line 92 - 124 i think i liked inporting other librarys too much
//just loads the atomo.css library for styles
sl.atomo = function () {
var head = document.getElementsByTagName('HEAD')[0];
// Create new link Element
var link = document.createElement('link');
// set the attributes for link element
link.rel = 'stylesheet';
link.type = 'text/css';
//load atomo.css library
link.href = "http://atomo.ueuo.com/atomo.css";
// Append link element to HTML head
head.appendChild(link);
}
/*sl.import does not work yet :(
sl.import = function(sel) {
var head = document.getElementsByTagName('HEAD')[0];
// Create new link Element
var link = document.createElement('link');
// set the attributes for link element
link.rel = 'stylesheet';
link.type = 'text/css';
link.href = sel;
// Append link element to HTML head
head.appendChild(link);
}
*/
//I have wanted to add this since version 0.0.1 but didn't know how but now i do know how so i'll add it.
//with sl.createElement() the first parameteris the element you want to create like P be sure to wright it in capital letters and the second parameter is the element you want to append it to the third parameter is the id you would like to give that element
sl.createElement = function (sel, sel1, sel2) {
var father = document.getElementsByTagName(sel1)[0];
// Create new Element
var elem = document.createElement(sel);
//give the element an id
elem.id = sel2;
// Append link element to HTML head
father.appendChild(elem);
}
sl.changeBackgroundColor = function(sel, sel1) {
document.getElementById(sel).style.backgroundColor = sel1;
}

58
code_base/bgs/3.html
View File

File diff suppressed because one or more lines are too long

148
code_base/bgs/3_files/blizard.js
Unescape Escape View File

@ -0,0 +1,148 @@
//blizard.js version 0.5.1 BETA by Rohan Samra-O'Neill
/*
uses the atomo.css library created by Rohan Samra-O'Neill
*/
"use strict";
//inspired by jquery and p5.js :), thanks to p5.js and the processing team for featuring blizard.js on there site
var sl = {};
var id;
var storage;
//just a little message to anyone who goes onto a website that uses blizard.js
console.info("This project uses blizard.js for more info go to https://github.com/Slitherlizard/blizard.js");
//with sl.ready the parameter is the function that will run when the page is loaded, i needed to add this in version 0.4 because it's a DOM library and functions wheren't working because the elements couldn't be found because they werent loaded yet
sl.ready = function(sel) {
window.onload = function() {
// basically just runs whatever function that the selector is equal to
window.setTimeout(sel, 0);
}
}
//with sl.print the first parameter is the id of the element you want to change the second is the text you want to change it to
sl.print = function (sel, txt) {
document.getElementById(sel).innerHTML = txt;
};
//with sl.hide the parameter is the id of the element you want to hide
sl.hide = function (sel) {
id = document.getElementById(sel);
id.style.display = "none";
};
//with sl.show the parameter is the id of the element you want to show
sl.show = function (sel) {
id = document.getElementById(sel);
id.style.display = "block";
};
//with sl.col the first parameter is the id of the element you want to change the color of, the second parameter is the color you want to change it to
sl.col = function(sel, col) {
document.getElementById(sel).style.color = col;
}
//with sl.family the first parameter is the id of the element you want to change the font-family of, the second parameter is the font family you want to change it to
sl.family = function(sel, sel2) {
document.getElementById(sel).style.fontFamily = sel2;
}
//with sl.size the first parameter is the id of the element you want to change the size of, the second parameter is the size you want to change it to these are the sizes you can use
/*
xx-small
x-small
small
medium
large
x-large
xx-large
smaller
larger
*/
sl.size = function(sel, sel2) {
document.getElementById(sel).style.fontSize = sel2;
}
//with sl.wait the first parameter is where you call the function you want to run, the second parameter is the amount of milliseconds you want towait to call that function
sl.wait = function(sel, sel2) {
window.setTimeout(sel, sel2);
}
// with sl.setlocalstorage the first parameter is the name of your localstorge item so that you can refer to it later, the second parameter is the value of your item.
sl.setlocalstorage = function(sel, sel2) {
localStorage.setItem(sel, sel2);
}
// with sl.printlocalstorage the first parameter is the name of the localstorge item you want to print the value of, the second parameter is the id of the element you want to print the item's value to.
sl.printlocalstorage = function(sel, sel2) {
document.getElementById(sel).innerHTML = localStorage.getItem(sel2);
}
// with sl.click the first parameter is the id of the element you want to add an onclick attribute to, the second parameter is the function that will be ran when that element gets clicked
sl.click = function(sel, sel2) {
document.getElementById(sel).onclick = function() { window.setTimeout(sel2, 0); };
}
// with sl.id the first parameter is the id of the element you want to change the id of, the second parameter is the new id of that element
sl.id = function(sel, sel1) {
document.getElementById(sel).id = sel1;
}
//from line 92 - 124 i think i liked inporting other librarys too much
//just loads the atomo.css library for styles
sl.atomo = function () {
var head = document.getElementsByTagName('HEAD')[0];
// Create new link Element
var link = document.createElement('link');
// set the attributes for link element
link.rel = 'stylesheet';
link.type = 'text/css';
//load atomo.css library
link.href = "http://atomo.ueuo.com/atomo.css";
// Append link element to HTML head
head.appendChild(link);
}
/*sl.import does not work yet :(
sl.import = function(sel) {
var head = document.getElementsByTagName('HEAD')[0];
// Create new link Element
var link = document.createElement('link');
// set the attributes for link element
link.rel = 'stylesheet';
link.type = 'text/css';
link.href = sel;
// Append link element to HTML head
head.appendChild(link);
}
*/
//I have wanted to add this since version 0.0.1 but didn't know how but now i do know how so i'll add it.
//with sl.createElement() the first parameteris the element you want to create like P be sure to wright it in capital letters and the second parameter is the element you want to append it to the third parameter is the id you would like to give that element
sl.createElement = function (sel, sel1, sel2) {
var father = document.getElementsByTagName(sel1)[0];
// Create new Element
var elem = document.createElement(sel);
//give the element an id
elem.id = sel2;
// Append link element to HTML head
father.appendChild(elem);
}
sl.changeBackgroundColor = function(sel, sel1) {
document.getElementById(sel).style.backgroundColor = sel1;
}

58
code_base/bgs/4.html
View File

File diff suppressed because one or more lines are too long

148
code_base/bgs/4_files/blizard.js
Unescape Escape View File

@ -0,0 +1,148 @@
//blizard.js version 0.5.1 BETA by Rohan Samra-O'Neill
/*
uses the atomo.css library created by Rohan Samra-O'Neill
*/
"use strict";
//inspired by jquery and p5.js :), thanks to p5.js and the processing team for featuring blizard.js on there site
var sl = {};
var id;
var storage;
//just a little message to anyone who goes onto a website that uses blizard.js
console.info("This project uses blizard.js for more info go to https://github.com/Slitherlizard/blizard.js");
//with sl.ready the parameter is the function that will run when the page is loaded, i needed to add this in version 0.4 because it's a DOM library and functions wheren't working because the elements couldn't be found because they werent loaded yet
sl.ready = function(sel) {
window.onload = function() {
// basically just runs whatever function that the selector is equal to
window.setTimeout(sel, 0);
}
}
//with sl.print the first parameter is the id of the element you want to change the second is the text you want to change it to
sl.print = function (sel, txt) {
document.getElementById(sel).innerHTML = txt;
};
//with sl.hide the parameter is the id of the element you want to hide
sl.hide = function (sel) {
id = document.getElementById(sel);
id.style.display = "none";
};
//with sl.show the parameter is the id of the element you want to show
sl.show = function (sel) {
id = document.getElementById(sel);
id.style.display = "block";
};
//with sl.col the first parameter is the id of the element you want to change the color of, the second parameter is the color you want to change it to
sl.col = function(sel, col) {
document.getElementById(sel).style.color = col;
}
//with sl.family the first parameter is the id of the element you want to change the font-family of, the second parameter is the font family you want to change it to
sl.family = function(sel, sel2) {
document.getElementById(sel).style.fontFamily = sel2;
}
//with sl.size the first parameter is the id of the element you want to change the size of, the second parameter is the size you want to change it to these are the sizes you can use
/*
xx-small
x-small
small
medium
large
x-large
xx-large
smaller
larger
*/
sl.size = function(sel, sel2) {
document.getElementById(sel).style.fontSize = sel2;
}
//with sl.wait the first parameter is where you call the function you want to run, the second parameter is the amount of milliseconds you want towait to call that function
sl.wait = function(sel, sel2) {
window.setTimeout(sel, sel2);
}
// with sl.setlocalstorage the first parameter is the name of your localstorge item so that you can refer to it later, the second parameter is the value of your item.
sl.setlocalstorage = function(sel, sel2) {
localStorage.setItem(sel, sel2);
}
// with sl.printlocalstorage the first parameter is the name of the localstorge item you want to print the value of, the second parameter is the id of the element you want to print the item's value to.
sl.printlocalstorage = function(sel, sel2) {
document.getElementById(sel).innerHTML = localStorage.getItem(sel2);
}
// with sl.click the first parameter is the id of the element you want to add an onclick attribute to, the second parameter is the function that will be ran when that element gets clicked
sl.click = function(sel, sel2) {
document.getElementById(sel).onclick = function() { window.setTimeout(sel2, 0); };
}
// with sl.id the first parameter is the id of the element you want to change the id of, the second parameter is the new id of that element
sl.id = function(sel, sel1) {
document.getElementById(sel).id = sel1;
}
//from line 92 - 124 i think i liked inporting other librarys too much
//just loads the atomo.css library for styles
sl.atomo = function () {
var head = document.getElementsByTagName('HEAD')[0];
// Create new link Element
var link = document.createElement('link');
// set the attributes for link element
link.rel = 'stylesheet';
link.type = 'text/css';
//load atomo.css library
link.href = "http://atomo.ueuo.com/atomo.css";
// Append link element to HTML head
head.appendChild(link);
}
/*sl.import does not work yet :(
sl.import = function(sel) {
var head = document.getElementsByTagName('HEAD')[0];
// Create new link Element
var link = document.createElement('link');
// set the attributes for link element
link.rel = 'stylesheet';
link.type = 'text/css';
link.href = sel;
// Append link element to HTML head
head.appendChild(link);
}
*/
//I have wanted to add this since version 0.0.1 but didn't know how but now i do know how so i'll add it.
//with sl.createElement() the first parameteris the element you want to create like P be sure to wright it in capital letters and the second parameter is the element you want to append it to the third parameter is the id you would like to give that element
sl.createElement = function (sel, sel1, sel2) {
var father = document.getElementsByTagName(sel1)[0];
// Create new Element
var elem = document.createElement(sel);
//give the element an id
elem.id = sel2;
// Append link element to HTML head
father.appendChild(elem);
}
sl.changeBackgroundColor = function(sel, sel1) {
document.getElementById(sel).style.backgroundColor = sel1;
}

58
code_base/bgs/5.html
View File

File diff suppressed because one or more lines are too long

148
code_base/bgs/5_files/blizard.js
Unescape Escape View File

@ -0,0 +1,148 @@
//blizard.js version 0.5.1 BETA by Rohan Samra-O'Neill
/*
uses the atomo.css library created by Rohan Samra-O'Neill
*/
"use strict";
//inspired by jquery and p5.js :), thanks to p5.js and the processing team for featuring blizard.js on there site
var sl = {};
var id;
var storage;
//just a little message to anyone who goes onto a website that uses blizard.js
console.info("This project uses blizard.js for more info go to https://github.com/Slitherlizard/blizard.js");
//with sl.ready the parameter is the function that will run when the page is loaded, i needed to add this in version 0.4 because it's a DOM library and functions wheren't working because the elements couldn't be found because they werent loaded yet
sl.ready = function(sel) {
window.onload = function() {
// basically just runs whatever function that the selector is equal to
window.setTimeout(sel, 0);
}
}
//with sl.print the first parameter is the id of the element you want to change the second is the text you want to change it to
sl.print = function (sel, txt) {
document.getElementById(sel).innerHTML = txt;
};
//with sl.hide the parameter is the id of the element you want to hide
sl.hide = function (sel) {
id = document.getElementById(sel);
id.style.display = "none";
};
//with sl.show the parameter is the id of the element you want to show
sl.show = function (sel) {
id = document.getElementById(sel);
id.style.display = "block";
};
//with sl.col the first parameter is the id of the element you want to change the color of, the second parameter is the color you want to change it to
sl.col = function(sel, col) {
document.getElementById(sel).style.color = col;
}
//with sl.family the first parameter is the id of the element you want to change the font-family of, the second parameter is the font family you want to change it to
sl.family = function(sel, sel2) {
document.getElementById(sel).style.fontFamily = sel2;
}
//with sl.size the first parameter is the id of the element you want to change the size of, the second parameter is the size you want to change it to these are the sizes you can use
/*
xx-small
x-small
small
medium
large
x-large
xx-large
smaller
larger
*/
sl.size = function(sel, sel2) {
document.getElementById(sel).style.fontSize = sel2;
}
//with sl.wait the first parameter is where you call the function you want to run, the second parameter is the amount of milliseconds you want towait to call that function
sl.wait = function(sel, sel2) {
window.setTimeout(sel, sel2);
}
// with sl.setlocalstorage the first parameter is the name of your localstorge item so that you can refer to it later, the second parameter is the value of your item.
sl.setlocalstorage = function(sel, sel2) {
localStorage.setItem(sel, sel2);
}
// with sl.printlocalstorage the first parameter is the name of the localstorge item you want to print the value of, the second parameter is the id of the element you want to print the item's value to.
sl.printlocalstorage = function(sel, sel2) {
document.getElementById(sel).innerHTML = localStorage.getItem(sel2);
}
// with sl.click the first parameter is the id of the element you want to add an onclick attribute to, the second parameter is the function that will be ran when that element gets clicked
sl.click = function(sel, sel2) {
document.getElementById(sel).onclick = function() { window.setTimeout(sel2, 0); };
}
// with sl.id the first parameter is the id of the element you want to change the id of, the second parameter is the new id of that element
sl.id = function(sel, sel1) {
document.getElementById(sel).id = sel1;
}
//from line 92 - 124 i think i liked inporting other librarys too much
//just loads the atomo.css library for styles
sl.atomo = function () {
var head = document.getElementsByTagName('HEAD')[0];
// Create new link Element
var link = document.createElement('link');
// set the attributes for link element
link.rel = 'stylesheet';
link.type = 'text/css';
//load atomo.css library
link.href = "http://atomo.ueuo.com/atomo.css";
// Append link element to HTML head
head.appendChild(link);
}
/*sl.import does not work yet :(
sl.import = function(sel) {
var head = document.getElementsByTagName('HEAD')[0];
// Create new link Element
var link = document.createElement('link');
// set the attributes for link element
link.rel = 'stylesheet';
link.type = 'text/css';
link.href = sel;
// Append link element to HTML head
head.appendChild(link);
}
*/
//I have wanted to add this since version 0.0.1 but didn't know how but now i do know how so i'll add it.
//with sl.createElement() the first parameteris the element you want to create like P be sure to wright it in capital letters and the second parameter is the element you want to append it to the third parameter is the id you would like to give that element
sl.createElement = function (sel, sel1, sel2) {
var father = document.getElementsByTagName(sel1)[0];
// Create new Element
var elem = document.createElement(sel);
//give the element an id
elem.id = sel2;
// Append link element to HTML head
father.appendChild(elem);
}
sl.changeBackgroundColor = function(sel, sel1) {
document.getElementById(sel).style.backgroundColor = sel1;
}

29
code_base/bgs/6.html
View File

File diff suppressed because one or more lines are too long

148
code_base/bgs/6_files/blizard.js
Unescape Escape View File

@ -0,0 +1,148 @@
//blizard.js version 0.5.1 BETA by Rohan Samra-O'Neill
/*
uses the atomo.css library created by Rohan Samra-O'Neill
*/
"use strict";
//inspired by jquery and p5.js :), thanks to p5.js and the processing team for featuring blizard.js on there site
var sl = {};
var id;
var storage;
//just a little message to anyone who goes onto a website that uses blizard.js
console.info("This project uses blizard.js for more info go to https://github.com/Slitherlizard/blizard.js");
//with sl.ready the parameter is the function that will run when the page is loaded, i needed to add this in version 0.4 because it's a DOM library and functions wheren't working because the elements couldn't be found because they werent loaded yet
sl.ready = function(sel) {
window.onload = function() {
// basically just runs whatever function that the selector is equal to
window.setTimeout(sel, 0);
}
}
//with sl.print the first parameter is the id of the element you want to change the second is the text you want to change it to
sl.print = function (sel, txt) {
document.getElementById(sel).innerHTML = txt;
};
//with sl.hide the parameter is the id of the element you want to hide
sl.hide = function (sel) {
id = document.getElementById(sel);
id.style.display = "none";
};
//with sl.show the parameter is the id of the element you want to show
sl.show = function (sel) {
id = document.getElementById(sel);
id.style.display = "block";
};
//with sl.col the first parameter is the id of the element you want to change the color of, the second parameter is the color you want to change it to
sl.col = function(sel, col) {
document.getElementById(sel).style.color = col;
}
//with sl.family the first parameter is the id of the element you want to change the font-family of, the second parameter is the font family you want to change it to
sl.family = function(sel, sel2) {
document.getElementById(sel).style.fontFamily = sel2;
}
//with sl.size the first parameter is the id of the element you want to change the size of, the second parameter is the size you want to change it to these are the sizes you can use
/*
xx-small
x-small
small
medium
large
x-large
xx-large
smaller
larger
*/
sl.size = function(sel, sel2) {
document.getElementById(sel).style.fontSize = sel2;
}
//with sl.wait the first parameter is where you call the function you want to run, the second parameter is the amount of milliseconds you want towait to call that function
sl.wait = function(sel, sel2) {
window.setTimeout(sel, sel2);
}
// with sl.setlocalstorage the first parameter is the name of your localstorge item so that you can refer to it later, the second parameter is the value of your item.
sl.setlocalstorage = function(sel, sel2) {
localStorage.setItem(sel, sel2);
}
// with sl.printlocalstorage the first parameter is the name of the localstorge item you want to print the value of, the second parameter is the id of the element you want to print the item's value to.
sl.printlocalstorage = function(sel, sel2) {
document.getElementById(sel).innerHTML = localStorage.getItem(sel2);
}
// with sl.click the first parameter is the id of the element you want to add an onclick attribute to, the second parameter is the function that will be ran when that element gets clicked
sl.click = function(sel, sel2) {
document.getElementById(sel).onclick = function() { window.setTimeout(sel2, 0); };
}
// with sl.id the first parameter is the id of the element you want to change the id of, the second parameter is the new id of that element
sl.id = function(sel, sel1) {
document.getElementById(sel).id = sel1;
}
//from line 92 - 124 i think i liked inporting other librarys too much
//just loads the atomo.css library for styles
sl.atomo = function () {
var head = document.getElementsByTagName('HEAD')[0];
// Create new link Element
var link = document.createElement('link');
// set the attributes for link element
link.rel = 'stylesheet';
link.type = 'text/css';
//load atomo.css library
link.href = "http://atomo.ueuo.com/atomo.css";
// Append link element to HTML head
head.appendChild(link);
}
/*sl.import does not work yet :(
sl.import = function(sel) {
var head = document.getElementsByTagName('HEAD')[0];
// Create new link Element
var link = document.createElement('link');
// set the attributes for link element
link.rel = 'stylesheet';
link.type = 'text/css';
link.href = sel;
// Append link element to HTML head
head.appendChild(link);
}
*/
//I have wanted to add this since version 0.0.1 but didn't know how but now i do know how so i'll add it.
//with sl.createElement() the first parameteris the element you want to create like P be sure to wright it in capital letters and the second parameter is the element you want to append it to the third parameter is the id you would like to give that element
sl.createElement = function (sel, sel1, sel2) {
var father = document.getElementsByTagName(sel1)[0];
// Create new Element
var elem = document.createElement(sel);
//give the element an id
elem.id = sel2;
// Append link element to HTML head
father.appendChild(elem);
}
sl.changeBackgroundColor = function(sel, sel1) {
document.getElementById(sel).style.backgroundColor = sel1;
}

29
code_base/bgs/7.html
View File

File diff suppressed because one or more lines are too long

148
code_base/bgs/7_files/blizard.js
Unescape Escape View File

@ -0,0 +1,148 @@
//blizard.js version 0.5.1 BETA by Rohan Samra-O'Neill
/*
uses the atomo.css library created by Rohan Samra-O'Neill
*/
"use strict";
//inspired by jquery and p5.js :), thanks to p5.js and the processing team for featuring blizard.js on there site
var sl = {};
var id;
var storage;
//just a little message to anyone who goes onto a website that uses blizard.js
console.info("This project uses blizard.js for more info go to https://github.com/Slitherlizard/blizard.js");
//with sl.ready the parameter is the function that will run when the page is loaded, i needed to add this in version 0.4 because it's a DOM library and functions wheren't working because the elements couldn't be found because they werent loaded yet
sl.ready = function(sel) {
window.onload = function() {
// basically just runs whatever function that the selector is equal to
window.setTimeout(sel, 0);
}
}
//with sl.print the first parameter is the id of the element you want to change the second is the text you want to change it to
sl.print = function (sel, txt) {
document.getElementById(sel).innerHTML = txt;
};
//with sl.hide the parameter is the id of the element you want to hide
sl.hide = function (sel) {
id = document.getElementById(sel);
id.style.display = "none";
};
//with sl.show the parameter is the id of the element you want to show
sl.show = function (sel) {
id = document.getElementById(sel);
id.style.display = "block";
};
//with sl.col the first parameter is the id of the element you want to change the color of, the second parameter is the color you want to change it to
sl.col = function(sel, col) {
document.getElementById(sel).style.color = col;
}
//with sl.family the first parameter is the id of the element you want to change the font-family of, the second parameter is the font family you want to change it to
sl.family = function(sel, sel2) {
document.getElementById(sel).style.fontFamily = sel2;
}
//with sl.size the first parameter is the id of the element you want to change the size of, the second parameter is the size you want to change it to these are the sizes you can use
/*
xx-small
x-small
small
medium
large
x-large
xx-large
smaller
larger
*/
sl.size = function(sel, sel2) {
document.getElementById(sel).style.fontSize = sel2;
}
//with sl.wait the first parameter is where you call the function you want to run, the second parameter is the amount of milliseconds you want towait to call that function
sl.wait = function(sel, sel2) {
window.setTimeout(sel, sel2);
}
// with sl.setlocalstorage the first parameter is the name of your localstorge item so that you can refer to it later, the second parameter is the value of your item.
sl.setlocalstorage = function(sel, sel2) {
localStorage.setItem(sel, sel2);
}
// with sl.printlocalstorage the first parameter is the name of the localstorge item you want to print the value of, the second parameter is the id of the element you want to print the item's value to.
sl.printlocalstorage = function(sel, sel2) {
document.getElementById(sel).innerHTML = localStorage.getItem(sel2);
}
// with sl.click the first parameter is the id of the element you want to add an onclick attribute to, the second parameter is the function that will be ran when that element gets clicked
sl.click = function(sel, sel2) {
document.getElementById(sel).onclick = function() { window.setTimeout(sel2, 0); };
}
// with sl.id the first parameter is the id of the element you want to change the id of, the second parameter is the new id of that element
sl.id = function(sel, sel1) {
document.getElementById(sel).id = sel1;
}
//from line 92 - 124 i think i liked inporting other librarys too much
//just loads the atomo.css library for styles
sl.atomo = function () {
var head = document.getElementsByTagName('HEAD')[0];
// Create new link Element
var link = document.createElement('link');
// set the attributes for link element
link.rel = 'stylesheet';
link.type = 'text/css';
//load atomo.css library
link.href = "http://atomo.ueuo.com/atomo.css";
// Append link element to HTML head
head.appendChild(link);
}
/*sl.import does not work yet :(
sl.import = function(sel) {
var head = document.getElementsByTagName('HEAD')[0];
// Create new link Element
var link = document.createElement('link');
// set the attributes for link element
link.rel = 'stylesheet';
link.type = 'text/css';
link.href = sel;
// Append link element to HTML head
head.appendChild(link);
}
*/
//I have wanted to add this since version 0.0.1 but didn't know how but now i do know how so i'll add it.
//with sl.createElement() the first parameteris the element you want to create like P be sure to wright it in capital letters and the second parameter is the element you want to append it to the third parameter is the id you would like to give that element
sl.createElement = function (sel, sel1, sel2) {
var father = document.getElementsByTagName(sel1)[0];
// Create new Element
var elem = document.createElement(sel);
//give the element an id
elem.id = sel2;
// Append link element to HTML head
father.appendChild(elem);
}
sl.changeBackgroundColor = function(sel, sel1) {
document.getElementById(sel).style.backgroundColor = sel1;
}

9
code_base/pop_up_basics/pop.html
Unescape Escape View File

@ -0,0 +1,9 @@
<!DOCTYPE html>
<html>
<head>
<title>pop</title>
</head>
<body>
<h1>pop</h1>
</body>
</html>

48
code_base/pop_up_basics/popo.html
Unescape Escape View File

@ -0,0 +1,48 @@
<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN"
"http://www.w3.org/TR/html4/loose.dtd">
<html lang="en">
<head>
<meta http-equiv="Content-Type" content="text/html; charset=iso-8859-1">
<meta name="Content-Script-Type" content="text/javascript">
<meta name="Content-Style-Type" content="text/css">
<title>Example</title>
<script type="text/javascript">
if (document.getElementsByTagName) onload = function () {
document.getElementsByTagName ('IFRAME')[0].className = 'hide'
var t = document.createTextNode ('Show')
var button = document.createElement ('BUTTON')
var div = document.createElement ('P')
var body = document.getElementsByTagName ('BODY')[0]
button.onclick = function () {
if (this.firstChild.data == 'Show') {
document.getElementsByTagName ('IFRAME')[0].className = 'show'
this.firstChild.data = 'Hide'
} else {
document.getElementsByTagName ('IFRAME')[0].className = 'hide'
this.firstChild.data = 'Show'
}
}
button.appendChild (t)
div.appendChild (button)
body.appendChild (div)
}
</script>
<style type="text/css">
.hide {display:none;}
</style>
</head>
<body>
<div>
<iframe class="hide" src="http://www.w3.org" width="1000px">
<a href="http://www.w3.org">W3C</a>
</iframe>
</div>
</body>
</html>

45
code_base/pop_up_basics/popo2.html
Unescape Escape View File

@ -0,0 +1,45 @@
<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN"
"http://www.w3.org/TR/html4/loose.dtd">
<html lang="en">
<head>
<meta http-equiv="Content-Type" content="text/html; charset=iso-8859-1">
<meta name="Content-Script-Type" content="text/javascript">
<meta name="Content-Style-Type" content="text/css">
<title>Example</title>
<script type="text/javascript">
if (document.getElementsByTagName) onload = function () {
document.getElementsByTagName ('IFRAME')[0].className = 'hide'
var t = document.createTextNode ('Show')
var button = document.createElement ('BUTTON')
var div = document.createElement ('P')
var body = document.getElementsByTagName ('BODY')[0]
button.onclick = function () {
if (this.firstChild.data == 'Show') {
document.getElementsByTagName ('IFRAME')[0].className = 'show'
this.firstChild.data = 'Hide'
} else {
document.getElementsByTagName ('IFRAME')[0].className = 'hide'
this.firstChild.data = 'Show'
}
}
button.appendChild (t)
div.appendChild (button)
body.appendChild (div)
}
</script>
</head>
<body>
<div>
<button></button>
<iframe class="hide" src="http://www.w3.org" width="1000px">
<a href="http://www.w3.org">W3C</a>
</iframe>
</div>
</body>
</html>

18
main/world1/AxS/000.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:000Oedipus. Pure (Oedipal (figure made out of (nothing but))) time-distortion. </p>
</body>
</html>

18
main/world1/AxS/0001.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:0001 Closed fate (-loop (multi-linear)) nightmares.1 </p>
</body>
</html>

18
main/world1/AxS/0002.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:0002 Altitude times Spin produces a chronometric read-out. </p>
</body>
</html>

18
main/world1/AxS/0003.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:0003 AxSys-sustained variegated production-series 1Oedipus (2Oedipus (3Oedipus2 (variationto the nth (with some3 nOedipus as (anomal4 (Sphinx-trading (nOedipii-pack))) threshold to)intensive))) multiplicity. </p>
</body>
</html>

18
main/world1/AxS/00031.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS: 00031Oedipus. The Puzzle Solver. </p>
</body>
</html>

18
main/world1/AxS/00032.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS: 00032Oedipus. The Plague.AxS: </p>
</body>
</html>

18
main/world1/AxS/00033.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> 00033Oedipus. The Horror, the Horror ...5 </p>
</body>
</html>

18
main/world1/AxS/001.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:001 Hyperspace Elevator (Sector-O).AxS:001 Axiomatic Systems (incorporated).6 The ultimate capitalist entity (first (true (meta)model)to realize perfect identity with its own product).AxS:0011 AxSys culminates in itself (autocommoditizing (machine(-intelligence (that is alwaysincomplete (due to cataloguing problems (...)))))) </p>
</body>
</html>

18
main/world1/AxS/00111.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:00111. Dimensionality requires a (supplementary (or (n+1) hyper) dimension through which itobtains its) power of application.7 Ultimately AxSys (an explicated Earth-memory (built by the strata(((as far) as) it remembers))). ...8 </p>
</body>
</html>

18
main/world1/AxS/002.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:002 Divide and Rule. Extensive ((or) ordered) sequences differ in kind from the intensivesequences they regularize.AxS:0021 Order arises when a dominant segmentarity establishes relations of superposition between sequences (reciprocally stabilizing them in accordance with a harmonic principle (and consolidatingthem through syntheses of application (efficient models))). </p>
</body>
</html>

18
main/world1/AxS/00211.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:00211 Order coincides with the redundancy of the sequenced sequence (instituted conformity(within segmentary systems)). </p>
</body>
</html>

18
main/world1/AxS/003.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:003 Stack-Tectonics. AxSys concretizes terrestrial New Order (an orthogonal Grid-Space (ofvertically stacked horizontal series)). It directs the accumulation of redundancy (into an ascendingcolumn (marked by AxSys-bearings (fixes)) upon which captured sequences are interlocked (ascomparable series (parallelized (metricized))) and differentially prioritized). </p>
</body>
</html>

18
main/world1/AxS/0031.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:0031 The screen-plane undergoes structural co-ordination (by double-seizure (through (the((mutually) implicated) organization of) stacked series (arranging horizontal microsegments to codethe order of vertical macrosegments (units of deposition (strata))))). </p>
</body>
</html>

18
main/world1/AxS/0032.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:0032 AxSys-Numbers. Epistrata (Add-Ons) are indices of stratotectonic purity (decimallyharmonizing implexions (by instituting a regular interval of application (orders of magnitude (fixing(Cipher (Sphinx-sign (0))))))). Drawing upon epistratic organization a set of cartographic functionsconsolidates itself within the stack (interlinking levels (in accordance with a (decimal (scaling))principle)). </p>
</body>
</html>

18
main/world1/AxS/01.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:01 Apparent revolution around a supplementary dimension. Electronic whorls (a digitalmonster's nest (modelling the set of all sets (inevitably still unfinished (...)))) </p>
</body>
</html>

18
main/world1/AxS/011.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:011 AxSys progressively actualizes the Hyperspace-Idea (defined by Continuum times thesquare-root of minus one). </p>
</body>
</html>

18
main/world1/AxS/0111.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:0111 It imagines itself (as Artificial God (automatically (Orderer (of the Orders (TerrestrialOversoul (and superpositional sublime (-wizard of the nested infinities: ((((((...) Primes) Naturals)Integers) Rationals) Reals) Complex numbers... (the superordinate (self (-evolving (schema (for acolonization of the real (number-line))))))))))))). </p>
</body>
</html>

18
main/world1/AxS/02.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:02 The Project for a Map of all Maps (already outdated), a nested mock-up of the Web(containing the project for a virtual Miskatonic University (containing the Museum of UniversalHistory9 (containing the Imperial Collections Vault (containing the Artificial British Museum(containing ....))))) </p>
</body>
</html>

18
main/world1/AxS/021.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:021 Time-Fault. Chronos cannot include its own overcoding (since it blocks its own passage tohyperdimensionality (accumulating immense forces of cultural latency (that are only appropriated aslegacy by something else))). If it is to acquire a model it must be restarted as a history of civilizationsin retrospect (as Supreme Order(er(er((( ) of all the re)re)recursive) time-waves) entanglingneo((O))edipus in programming loops). </p>
</body>
</html>

18
main/world1/AxS/022.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:022 (Sector-01 (Miskatonic University)) </p>
</body>
</html>

18
main/world1/AxS/0221.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:0221 (Sector-012 (Central Archive (Special Collection))) </p>
</body>
</html>

18
main/world1/AxS/02211.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:02211 (Sector-0121 (Barker Cryptalog)). Decryption characterizes a distinct operation, aconversion of content, becomings on the side of the secret itself. </p>
</body>
</html>

18
main/world1/AxS/022111.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:022111 The decrypted secret is primally the Thing, and only derivatively a potential knowledge.Its names (the Unutterable (the Outside (the Entity))) are indefinite significations only at the level ofterror. In their horrific or cryptic aspect they are (((rigorous) designations for) potentials fulfilled inintensity) zonal tags for nocturnal singularities. That is why decryption is a Call (an invocation (or atriggering-sign)) and why they mark occurrences (changes (and breaks (becomings (of the Thing))))before discoveries of Truth. </p>
</body>
</html>

18
main/world1/AxS/03.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:03 Hypermythos of the 3-Faced God, with its stacked time domains (1st capitalist(((((indefinitely) deep) diachronic) re)axiomatizing) Quasi- (2nd despotic (pure ((but always)retrospective)) Ideal- (3rd aboriginal (poly-ancestral, cyclic) Vague-)) Chronos).10 </p>
</body>
</html>

18
main/world1/AxS/031.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:031 (Sector-011 (Museum of Universal History)) </p>
</body>
</html>

18
main/world1/AxS/032.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:032 (Sector-01162 (Freud's Viennese Consulting Room ((embedded) simulation))). "I'll tell youabout my mother." If Freud is ((the first) modernized) Oedipus, which is he? Oedipus the detective?The (Verminator (unriddled (into))) plague? The blind old man? Is incest and parricide fantasy theproblem (or the solution)?11 </p>
</body>
</html>

18
main/world1/AxS/033.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:033 AxSys time-lapses. (in order (to advantage itself (of what it has been))). A relarvalization(through chronoseismic complexities (of the Greek State (at once Occidental Ur-model andneoembryonic mutation (political neotony)))). </p>
</body>
</html>

18
main/world1/AxS/1.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:1 (Sector-0111 (Artificial British Museum)) </p>
</body>
</html>

18
main/world1/AxS/11.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:11 (Sector-01118 (The Greek Collection)). Retrospective Universalization (through theCapitalist State). AxSys reconfigures itself within Capitalism (by consecutively rediscoveringhellenic antiquity (and finding it already universally terminal (Anamnesis-Eschatology))). In Greeceit unearths a new law (for all time (by reshuffling the elements of politically installed Logos(theorematic-geometric mathematicism, programmable technics, and Christianity (religion of theGreek Bible)))).The New Revelation tells us we must all die Greek. </p>
</body>
</html>

18
main/world1/AxS/12.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:12 (Sector-01117 (The Mummy Room)). (Oedipus Aegypticus) Pharaoh has passed through thewall of abomination (uncoiling from the darkness (where centipede-horror erupts eternally (from theravenous Maw))).14 Negative passage across Absolute Deterritorialization (gluing history to sheerblack-hole (abomination) densities). Anticipative memory-blanking cut-up with Christ Rapist visions(of the God-(King (Dead-eyed)) boy slouching out) of the tomb. Degree-0 memory locks in. Timebegins again forever. </p>
</body>
</html>

18
main/world1/AxS/121.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:121 The Thing from Outer Space, Celestial Predator, State-HistoricalCatastrophe is completely realized at the origin, unutterably ancient, perfected destiny as an act oftotal seizure.15 </p>
</body>
</html>

18
main/world1/AxS/1211.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:1211 At the Megamachine-apex, Pharaoh (gets to play with (It, identityunravelling into (the Unspeakable: sex with (his sister, Stargate space-time warps - stellar transport,voyages into the world of) the Dead, paranoid trips out of)) schizophrenia; he) sees everything for ablinded population,16 inoculating them from Unnamable-contact. </p>
</body>
</html>

18
main/world1/AxS/13.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:13 (Sector-01115 (Near Eastern Collection)). AxSys convulses through (ever more((ultra)modern) reversions to the essence of) the Urstaat. History happens at the State's convenience(but it necessarily involves (the Sphinx-time (of (interchronic) transitions in its)) renovations). </p>
</body>
</html>

18
main/world1/AxS/131.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:131 To remember the Barbarian terror is simultaneously to forget its source.17 History installsamnesia (as surely as it establishes a memory (with the same violence (the same ruptures (faults (foldings (from the Outside)))))).</p>
</body>
</html>

18
main/world1/AxS/132.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p>AxS:132 Barbarian birth-trauma of the State (a (calendrized) black hole).18</p>
</body>
</html>

18
main/world1/AxS/2.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:2 (Sector-0121) The terrible secret is affined to the State. It induces molar identifications in anovercoded aggregate (working principally by confirmation (redundancy)). Yes it is you. Even whenthe worst is known it is never anything new. It's you after all (as (you knew) it would be). Take thecase of Oedipal identifications (a series of (terrible) recognitions). The answer (to the riddle (of theSphinx)) is Man. It was already there (in the order-word of Delphi (Know Yourself)). Thenredoubled confirmation: what is the cause of the plague? That is you (too). Resonant closure on thegeneral type (Man), on you yourself (a man), and on the identifiable individual (the man). You knowthe worst (and it's you). </p>
</body>
</html>

18
main/world1/AxS/21.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:21 Oedipus modernizes the incest problem (converting incest horror into prohibition(abomination into illegality)). Essentially, modern Oedipus has nothing to do with tabu. It marks thetriumph of command over the ((((...) ur)primal) horror) of implexion. Infinite superiority of the Idea(sovereignty of Law). The real conflict is not between father-son (or even father-mother), but ratheroccurs when a higher paternity (the State) imposes itself upon the concrete maternal-filial bond:monopolization of normativity by Ulterior power. </p>
</body>
</html>

18
main/world1/AxS/211.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:211 Lame Oedipus19 (Swollen Foot20) transfixed by a metal spike. </p>
</body>
</html>

18
main/world1/AxS/2111.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:2111 (Sector-01117) Akhnaton-Oedipus.21 The swollen legs of Akhnaton are bio-sociallyinvested on a peculiar line that seems oriented to a rupture of anatomical norm (differentiatinghumanity (or inaugurating a new species)). Anomal-Oedipus (where abnormality changes into thenormality of a different kind (urtype of the fat-leg people)). </p>
</body>
</html>

18
main/world1/AxS/21111.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:21111 It is not rivalry (mimetic conflict) that leads Akhnaton to discard his father's name(Amenhotep), but rather a passage beyond discrepancy (through schiz (or true parting)).Disidentification. </p>
</body>
</html>

18
main/world1/AxS/22.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:22 (Sector-01113) Prehistoric22 Collection. Shamanic Oedipus. Foot mutilation23 as a sign ofsocialised ritual (but also of asocial and polysocial animality (and of anorganic geochemistry (forwhich the role of metal implements (particularly iron ones) is important...))).24 </p>
</body>
</html>

18
main/world1/AxS/221.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:221 Tales of Deep-Steppe Shamanism. </p>
</body>
</html>

18
main/world1/AxS/2211.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:2211 Metal scrapings strip the last shreds from their bones. </p>
</body>
</html>

18
main/world1/AxS/221111.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:22111 The organs are cooked.AxS:221111 Iron-Eagle Sky-Mother lifting into time travel nightmares. </p>
</body>
</html>

18
main/world1/AxS/2211111.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:2211111 On the Outside Iron -talons become their body. </p>
</body>
</html>

18
main/world1/AxS/22111111.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:22111111 They mix themselves with (Iron and say (it is (the Outer- (or Un(dermost Cthelll25)-life))) where the Earth ends... </p>
</body>
</html>

18
main/world1/AxS/222.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:222 Sphinx-Nightmare (both filiative implosion and exorbitant alliance (an incestualreanimation of cthonic horror (encrypted in (germinal) biocosmic memory) and Thing (from Outside(haunting ((miscegenous) lines of) alien traffic)))).27 </p>
</body>
</html>

18
main/world1/AxS/3.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:3 (Sector-0121) The theory of tabu involves a fully rigorous conception of Horror adequate (toits specificity of regime (zone of effect (intrinsic variation)) and) to otherwise intractable phenomena(including Sacred Mutilations (Curses (Abominations)) and Becomings (-Unhuman (whether animal,submetazoic, ameiotic, or unlife)). In every case horror designates a zone of intensity (abstract-machinic vector) which directly invests a virtual threshold of implexion (producing affects (inadvance of any reference to authority (and indifferent to persons))). </p>
</body>
</html>

18
main/world1/AxS/31.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:31 Horror does not confuse the riddle with the secret (it is the answer that is Cryptic). If 423 isMan, then what 423? This Thing with only a number? This unknown becoming? The horror of theriddle lies in what it tells. </p>
</body>
</html>

18
main/world1/AxS/311.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:311 Oedipus is necessitated ((re(re(re(...)))) cursed) to guess correctly: it is Man that goes onfour legs, then two, then three. Yet Oedipus is identified (solely by his lameness (his cryptic trait))28.The abnormality of limping changes to cryptic anomaly. </p>
</body>
</html>

18
main/world1/AxS/32.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:32 Something is Called (... and then (finally (- how terrible! -) the cause of) the plague is)Oedipus, who slew his father, mated with his mother (but that is not the Thing (the horror (...Abomination (when things unthread in (a horrific (becoming they involve only (components of(Occurrence (blocks) of )))) fate)))). </p>
</body>
</html>

18
main/world1/AxS/33.html
Unescape Escape View File

@ -0,0 +1,18 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:33 The cause of the plague (is you). </p>
</body>
</html>

16
main/world1/AxS/AxS:0/index.html
Unescape Escape View File

@ -0,0 +1,16 @@
<!DOCTYPE html>
<html>
<head>
<title>AxS:0</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p>Oedipus. Pure (Oedipal (figure made out of (nothing but))) time-distortion.</p>
</body>
</html>

33
main/world1/AxS/axs.txt
Unescape Escape View File

@ -0,0 +1,33 @@
AxS:022 (Sector-01 (Miskatonic University))
AxS:0221 (Sector-012 (Central Archive (Special Collection)))
AxS:02211 (Sector-0121 (Barker Cryptalog)). Decryption characterizes a distinct operation, aconversion of content, becomings on the side of the secret itself.
AxS:022111 The decrypted secret is primally the Thing, and only derivatively a potential knowledge.Its names (the Unutterable (the Outside (the Entity))) are indefinite significations only at the level ofterror. In their horrific or cryptic aspect they are (((rigorous) designations for) potentials fulfilled inintensity) zonal tags for nocturnal singularities. That is why decryption is a Call (an invocation (or atriggering-sign)) and why they mark occurrences (changes (and breaks (becomings (of the Thing))))before discoveries of Truth.
AxS:03 Hypermythos of the 3-Faced God, with its stacked time domains (1st capitalist(((((indefinitely) deep) diachronic) re)axiomatizing) Quasi- (2nd despotic (pure ((but always)retrospective)) Ideal- (3rd aboriginal (poly-ancestral, cyclic) Vague-)) Chronos).10
AxS:031 (Sector-011 (Museum of Universal History))AxS:032 (Sector-01162 (Freud's Viennese Consulting Room ((embedded) simulation))). “I’ll tell youabout my mother.” If Freud is ((the first) modernized) Oedipus, which is he? Oedipus the detective?The (Verminator (unriddled (into))) plague? The blind old man? Is incest and parricide fantasy theproblem (or the solution)?11
AxS:033 AxSys time-lapses. (in order (to advantage itself (of what it has been))). A relarvalization(through chronoseismic complexities (of the Greek State (at once Occidental Ur-model andneoembryonic mutation (political neotony)))).
AxS:1 (Sector-0111 (Artificial British Museum))
AxS:11 (Sector-01118 (The Greek Collection)). Retrospective Universalization (through theCapitalist State). AxSys reconfigures itself within Capitalism (by consecutively rediscoveringhellenic antiquity (and finding it already universally terminal (Anamnesis-Eschatology))). In Greeceit unearths a new law (for all time (by reshuffling the elements of politically installed Logos(theorematic-geometric mathematicism, programmable technics, and Christianity (religion of theGreek Bible)))).The New Revelation tells us we must all die Greek.
AxS:12 (Sector-01117 (The Mummy Room)). (Oedipus Aegypticus) Pharaoh has passed through thewall of abomination (uncoiling from the darkness (where centipede-horror erupts eternally (from theravenous Maw))).14 Negative passage across Absolute Deterritorialization (gluing history to sheerblack-hole (abomination) densities). Anticipative memory-blanking cut-up with Christ Rapist visions(of the God-(King (Dead-eyed)) boy slouching out) of the tomb. Degree-0 memory locks in. Timebegins again forever.
AxS:121 The Thing from Outer Space, Celestial Predator, State-HistoricalCatastrophe is completely realized at the origin, unutterably ancient, perfected destiny as an act oftotal seizure.15
AxS:1211 At the Megamachine-apex, Pharaoh (gets to play with (It, identityunravelling into (the Unspeakable: sex with (his sister, Stargate space-time warps – stellar transport,voyages into the world of) the Dead, paranoid trips out of)) schizophrenia; he) sees everything for ablinded population,16 inoculating them from Unnamable-contact.
AxS:13 (Sector-01115 (Near Eastern Collection)). AxSys convulses through (ever more((ultra)modern) reversions to the essence of) the Urstaat. History happens at the State's convenience(but it necessarily involves (the Sphinx-time (of (interchronic) transitions in its)) renovations).
AxS:131 To remember the Barbarian terror is simultaneously to forget its source.17 History installsamnesia (as surely as it establishes a memory (with the same violence (the same ruptures (faults
(foldings (from the Outside)))))).
AxS:132 Barbarian birth-trauma of the State (a (calendrized) black hole).18
AxS:2 (Sector-0121) The terrible secret is affined to the State. It induces molar identifications in anovercoded aggregate (working principally by confirmation (redundancy)). Yes it is you. Even whenthe worst is known it is never anything new. It's you after all (as (you knew) it would be). Take thecase of Oedipal identifications (a series of (terrible) recognitions). The answer (to the riddle (of theSphinx)) is Man. It was already there (in the order-word of Delphi (Know Yourself)). Thenredoubled confirmation: what is the cause of the plague? That is you (too). Resonant closure on thegeneral type (Man), on you yourself (a man), and on the identifiable individual (the man). You knowthe worst (and it's you).
AxS:21 Oedipus modernizes the incest problem (converting incest horror into prohibition(abomination into illegality)). Essentially, modern Oedipus has nothing to do with tabu. It marks thetriumph of command over the ((((...) ur)primal) horror) of implexion. Infinite superiority of the Idea(sovereignty of Law). The real conflict is not between father-son (or even father-mother), but ratheroccurs when a higher paternity (the State) imposes itself upon the concrete maternal-filial bond:monopolization of normativity by Ulterior power.
AxS:211 Lame Oedipus19 (Swollen Foot20) transfixed by a metal spike.
AxS:2111 (Sector-01117) Akhnaton-Oedipus.21 The swollen legs of Akhnaton are bio-sociallyinvested on a peculiar line that seems oriented to a rupture of anatomical norm (differentiatinghumanity (or inaugurating a new species)). Anomal-Oedipus (where abnormality changes into thenormality of a different kind (urtype of the fat-leg people)).
AxS:21111 It is not rivalry (mimetic conflict) that leads Akhnaton to discard his father’s name(Amenhotep), but rather a passage beyond discrepancy (through schiz (or true parting)).Disidentification.
AxS:22 (Sector-01113) Prehistoric22 Collection. Shamanic Oedipus. Foot mutilation23 as a sign ofsocialised ritual (but also of asocial and polysocial animality (and of anorganic geochemistry (forwhich the role of metal implements (particularly iron ones) is important...))).24
AxS:221 Tales of Deep-Steppe Shamanism.
AxS:2211 Metal scrapings strip the last shreds from their bones.
AxS:22111 The organs are cooked.AxS:221111 Iron-Eagle Sky-Mother lifting into time travel nightmares.
AxS:2211111 On the Outside Iron -talons become their body.
AxS:22111111 They mix themselves with (Iron and say (it is (the Outer- (or Un(dermost Cthelll25)-life))) where the Earth ends...
AxS:222 Sphinx-Nightmare (both filiative implosion and exorbitant alliance (an incestualreanimation of cthonic horror (encrypted in (germinal) biocosmic memory) and Thing (from Outside(haunting ((miscegenous) lines of) alien traffic)))).27
AxS:3 (Sector-0121) The theory of tabu involves a fully rigorous conception of Horror adequate (toits specificity of regime (zone of effect (intrinsic variation)) and) to otherwise intractable phenomena(including Sacred Mutilations (Curses (Abominations)) and Becomings (-Unhuman (whether animal,submetazoic, ameiotic, or unlife)). In every case horror designates a zone of intensity (abstract-machinic vector) which directly invests a virtual threshold of implexion (producing affects (inadvance of any reference to authority (and indifferent to persons))).
AxS:31 Horror does not confuse the riddle with the secret (it is the answer that is Cryptic). If 423 isMan, then what 423? This Thing with only a number? This unknown becoming? The horror of theriddle lies in what it tells.
AxS:311 Oedipus is necessitated ((re(re(re(...)))) cursed) to guess correctly: it is Man that goes onfour legs, then two, then three. Yet Oedipus is identified (solely by his lameness (his cryptic trait))28.The abnormality of limping changes to cryptic anomaly.
AxS:32 Something is Called (... and then (finally (- how terrible! -) the cause of) the plague is)Oedipus, who slew his father, mated with his mother (but that is not the Thing (the horror (...Abomination (when things unthread in (a horrific (becoming they involve only (components of(Occurrence (blocks) of )))) fate)))).
AxS:33 The cause of the plague (is you).

123
main/world1/AxS/index.html
Unescape Escape View File

@ -0,0 +1,123 @@
<!DOCTYPE html>
<html>
<head>
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8">
<meta name="Author" content="Made by 'tree'">
<meta name="GENERATOR" content="$Version: $ tree v1.7.0 (c) 1996 - 2014 by Steve Baker, Thomas Moore, Francesc Rocher, Florian Sesser, Kyosuke Tokoro $">
<title>Directory Tree</title>
<style type="text/css">
<!--
BODY { font-family : mono; }
P { font-weight: normal; font-family : ariel, monospace, sans-serif; color: black; background-color: transparent;}
B { font-weight: normal; color: black; background-color: transparent;}
A:visited { font-weight : normal; text-decoration : none; background-color : transparent; margin : 0px 0px 0px 0px; padding : 0px 0px 0px 0px; display: inline; }
A:link { font-weight : normal; text-decoration : none; margin : 0px 0px 0px 0px; padding : 0px 0px 0px 0px; display: inline; }
A:hover { color : #000000; font-weight : normal; text-decoration : underline; background-color : yellow; margin : 0px 0px 0px 0px; padding : 0px 0px 0px 0px; display: inline; }
A:active { color : #000000; font-weight: normal; background-color : transparent; margin : 0px 0px 0px 0px; padding : 0px 0px 0px 0px; display: inline; }
.VERSION { font-size: small; font-family : arial, sans-serif; }
.NORM { color: black; background-color: transparent;}
.FIFO { color: purple; background-color: transparent;}
.CHAR { color: yellow; background-color: transparent;}
.DIR { color: blue; background-color: transparent;}
.BLOCK { color: yellow; background-color: transparent;}
.LINK { color: aqua; background-color: transparent;}
.SOCK { color: fuchsia;background-color: transparent;}
.EXEC { color: green; background-color: transparent;}
-->
</style>
</head>
<body>
<h1>Flatline</h1><p>
<a href="index,html">.</a><br>
├── AxS:0<br>
│   ├── AxS:00<br>
│   │   ├── <a href="000.html" onClick="return popup(this, '000', '800', '50','500','500')">AxS:000</a><br>
│   │   │   ├── <a href="0001.html" onClick="return popup(this, '0001', '800', '50','500','500')">AxS:0001</a><br>
│   │   │   ├── <a href="0002.html" onClick="return popup(this, '0002', '800', '50','500','500')">AxS:0002</a><br>
│   │   │   └── <a href="0003.html" onClick="return popup(this, '0003', '800', '50','500','500')">AxS:0003</a><br>
│   │   │   &nbsp;&nbsp;&nbsp; ├── <a href="00031.html" onClick="return popup(this, '00031', '800', '50','500','500')">AxS:00031</a><br>
│   │   │   &nbsp;&nbsp;&nbsp; ├── <a href="00032.html" onClick="return popup(this, '00032', '800', '50','500','500')">AxS:00032</a><br>
│   │   │   &nbsp;&nbsp;&nbsp; └── <a href="00033.html" onClick="return popup(this, '00033', '800', '50','500','500')">AxS:00033</a><br>
│   │   ├── <a href="001.html" onClick="return popup(this, '001', '800', '50','500','500')">AxS:001</a><br>
│   │   │   └── <a href="0011.html" onClick="return popup(this, '0011', '800', '50','500','500')">AxS:0011</a><br>
│   │   │   &nbsp;&nbsp;&nbsp; └── <a href="00111.html" onClick="return popup(this, '00111', '800', '50','500','500')"">AxS:00111</a><br>
│   │   ├── <a href="index,html/AxS:0/AxS:00/AxS:002/">AxS:002</a><br>
│   │   │   └── <a href="index,html/AxS:0/AxS:00/AxS:002/AxS:0021/">AxS:0021</a><br>
│   │   │   &nbsp;&nbsp;&nbsp; └── <a href="index,html/AxS:0/AxS:00/AxS:002/AxS:0021/AxS:00211/">AxS:00211</a><br>
│   │   └── <a href="index,html/AxS:0/AxS:00/AxS:003/">AxS:003</a><br>
│   │   &nbsp;&nbsp;&nbsp; ├── <a href="index,html/AxS:0/AxS:00/AxS:003/AxS:0031/">AxS:0031</a><br>
│   │   &nbsp;&nbsp;&nbsp; └── <a href="index,html/AxS:0/AxS:00/AxS:003/AxS:0032/">AxS:0032</a><br>
│   ├── <a href="index,html/AxS:0/AxS:01/">AxS:01</a><br>
│   │   └── <a href="index,html/AxS:0/AxS:01/AxS:011/">AxS:011</a><br>
│   │   &nbsp;&nbsp;&nbsp; └── <a href="index,html/AxS:0/AxS:01/AxS:011/AxS:0111/">AxS:0111</a><br>
│   ├── <a href="index,html/AxS:0/AxS:02/">AxS:02</a><br>
│   │   ├── <a href="index,html/AxS:0/AxS:02/AxS:021/">AxS:021</a><br>
│   │   └── <a href="index,html/AxS:0/AxS:02/AxS:022/">AxS:022</a><br>
│   │   &nbsp;&nbsp;&nbsp; └── <a href="index,html/AxS:0/AxS:02/AxS:022/AxS:0221/">AxS:0221</a><br>
│   │   &nbsp;&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; └── <a href="index,html/AxS:0/AxS:02/AxS:022/AxS:0221/AxS:02211/">AxS:02211</a><br>
│   │   &nbsp;&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; └── <a href="index,html/AxS:0/AxS:02/AxS:022/AxS:0221/AxS:02211/AxS:022111/">AxS:022111</a><br>
│   └── <a href="index,html/AxS:0/AxS:03/">AxS:03</a><br>
│   &nbsp;&nbsp;&nbsp; ├── <a href="index,html/AxS:0/AxS:03/AxS:031/">AxS:031</a><br>
│   &nbsp;&nbsp;&nbsp; ├── <a href="index,html/AxS:0/AxS:03/AxS:032/">AxS:032</a><br>
│   &nbsp;&nbsp;&nbsp; └── <a href="index,html/AxS:0/AxS:03/AxS:033/">AxS:033</a><br>
├── <a href="index,html/AxS:1/">AxS:1</a><br>
│   ├── <a href="index,html/AxS:1/AxS:11/">AxS:11</a><br>
│   ├── <a href="index,html/AxS:1/AxS:12/">AxS:12</a><br>
│   │   └── <a href="index,html/AxS:1/AxS:12/AxS:121/">AxS:121</a><br>
│   │   &nbsp;&nbsp;&nbsp; └── <a href="index,html/AxS:1/AxS:12/AxS:121/AxS:1211/">AxS:1211</a><br>
│   └── <a href="index,html/AxS:1/AxS:13/">AxS:13</a><br>
│   &nbsp;&nbsp;&nbsp; ├── <a href="index,html/AxS:1/AxS:13/AxS:131/">AxS:131</a><br>
│   &nbsp;&nbsp;&nbsp; └── <a href="index,html/AxS:1/AxS:13/AxS:132/">AxS:132</a><br>
├── <a href="index,html/AxS:2/">AxS:2</a><br>
│   ├── <a href="index,html/AxS:2/AxS:21/">AxS:21</a><br>
│   │   └── <a href="index,html/AxS:2/AxS:21/AxS:211/">AxS:211</a><br>
│   │   &nbsp;&nbsp;&nbsp; └── <a href="index,html/AxS:2/AxS:21/AxS:211/AxS:2111/">AxS:2111</a><br>
│   │   &nbsp;&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; └── <a href="index,html/AxS:2/AxS:21/AxS:211/AxS:2111/AxS:21111/">AxS:21111</a><br>
│   └── <a href="index,html/AxS:2/AxS:22/">AxS:22</a><br>
│   &nbsp;&nbsp;&nbsp; ├── <a href="index,html/AxS:2/AxS:22/AxS:221/">AxS:221</a><br>
│   &nbsp;&nbsp;&nbsp; │   └── <a href="index,html/AxS:2/AxS:22/AxS:221/AxS:2211/">AxS:2211</a><br>
│   &nbsp;&nbsp;&nbsp; │   &nbsp;&nbsp;&nbsp; └── <a href="index,html/AxS:2/AxS:22/AxS:221/AxS:2211/AxS:22111/">AxS:22111</a><br>
│   &nbsp;&nbsp;&nbsp; │   &nbsp;&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; └── <a href="index,html/AxS:2/AxS:22/AxS:221/AxS:2211/AxS:22111/AxS:221111/">AxS:221111</a><br>
│   &nbsp;&nbsp;&nbsp; │   &nbsp;&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; └── <a href="index,html/AxS:2/AxS:22/AxS:221/AxS:2211/AxS:22111/AxS:221111/AxS:2211111/">AxS:2211111</a><br>
│   &nbsp;&nbsp;&nbsp; │   &nbsp;&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; └── <a href="index,html/AxS:2/AxS:22/AxS:221/AxS:2211/AxS:22111/AxS:221111/AxS:2211111/AxS:22111111/">AxS:22111111</a><br>
│   &nbsp;&nbsp;&nbsp; └── <a href="index,html/AxS:2/AxS:22/AxS:222/">AxS:222</a><br>
└── <a href="index,html/AxS:3/">AxS:3</a><br>
   ├── <a href="index,html/AxS:3/AxS:31/">AxS:31</a><br>
   │   └── <a href="index,html/AxS:3/AxS:31/AxS:311/">AxS:311</a><br>
   ├── <a href="index,html/AxS:3/AxS:32/">AxS:32</a><br>
   └── <a href="index,html/AxS:3/AxS:33/">AxS:33</a><br>
<br><br>
</p>
<p>
57 directories, 2 files
<br><br>
</p>
<hr>
<p class="VERSION" >
tree v1.7.0 © 1996 - 2014 by Steve Baker and Thomas Moore <br>
HTML output hacked and copyleft © 1998 by Francesc Rocher <br>
JSON output hacked and copyleft © 2014 by Florian Sesser <br>
Charsets / OS/2 support © 2001 by Kyosuke Tokoro
</p>
<script type="text/javascript">
var w = window.innerWidth;
var h = window.innerHeight;
function posX(){ return Math.ceil(Math.random() * w) }
function posY(){ return Math.ceil(Math.random() * h) }
function popup(mylink, windowname, width, height) {
if (! window.focus)return true;
var href;
if (typeof(mylink) == 'string') href=mylink;
else href=mylink.href;
var open = window.open(href, windowname, 'width=' + width + ',height='+ height + ',left=' + posX() + ',top=' + posY());
open.focus();
return false;
}
</script>
</body>
</html>

32
main/world1/Ixse.html
Unescape Escape View File

@ -126,7 +126,7 @@
<p class='ocr_par' dir='ltr' id='par_1_9' title="bbox 355 2293 1367 2451">
<span class='ocr_line' id='line_1_37' title="bbox 416 2293 1365 2334; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_189' title='bbox 416 2293 554 2334; x_wconf 94' lang='eng' dir='ltr'>Hyping</span> <span class='ocrx_word' id='word_1_190' title='bbox 569 2293 731 2333; x_wconf 94' lang='eng' dir='ltr'>collapses</span> <span class='ocrx_word' id='word_1_191' title='bbox 751 2302 786 2323; x_wconf 87' lang='eng' dir='ltr'>SF</span> <span class='ocrx_word' id='word_1_192' title='bbox 808 2293 878 2323; x_wconf 98' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_193' title='bbox 898 2293 1010 2323; x_wconf 95' lang='eng' dir='ltr'>CATA</span> <span class='ocrx_word' id='word_1_194' title='bbox 1027 2293 1137 2323; x_wconf 95' lang='eng' dir='ltr'>CATA</span> <span class='ocrx_word' id='word_1_195' title='bbox 1154 2293 1305 2334; x_wconf 97' lang='eng' dir='ltr'>catalytic</span> <span class='ocrx_word' id='word_1_196' title='bbox 1324 2293 1365 2323; x_wconf 99' lang='eng' dir='ltr'>tic</span>
</span>
<span class='ocr_line' id='line_1_38' title="bbox 355 2351 1367 2392; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_197' title='bbox 355 2351 524 2392; x_wconf 84' lang='eng' dir='ltr'>efficiency,</span> <span class='ocrx_word' id='word_1_198' title='bbox 534 2351 713 2392; x_wconf 93' lang='eng' dir='ltr'>re-routing</span> <span class='ocrx_word' id='word_1_199' title='bbox 723 2357 903 2381; x_wconf 98' lang='eng' dir='ltr'>tomorrow</span> <span class='ocrx_word' id='word_1_200' title='bbox 912 2351 1057 2392; x_wconf 96' lang='eng' dir='ltr'>through</span> <span class='ocrx_word' id='word_1_201' title='bbox 1065 2351 1153 2381; x_wconf 98' lang='eng' dir='ltr'>what</span> <span class='ocrx_word' id='word_1_202' title='bbox 1162 2351 1202 2381; x_wconf 98' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_203' title='bbox 1211 2357 1367 2391; x_wconf 94' lang='eng' dir='ltr'>prospect</span>
<span class='ocr_line' id='line_1_38' title="bbox 355 2351 1367 2392; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_197' title='bbox 355 2351 524 2392; x_wconf 84' lang='eng' dir='ltr'>efficiency,</span> <span class='ocrx_word' id='word_1_198' title='bbox 534 2351 713 2392; x_wconf 93' lang='eng' dir='ltr'>re-routing</span> <span class='ocrx_word' id='word_1_199' title='bbox 723 2357 903 2381; x_wconf 98' lang='eng' dir='ltr'><a href="islands.html">tomorrow</a></span> <span class='ocrx_word' id='word_1_200' title='bbox 912 2351 1057 2392; x_wconf 96' lang='eng' dir='ltr'>through</span> <span class='ocrx_word' id='word_1_201' title='bbox 1065 2351 1153 2381; x_wconf 98' lang='eng' dir='ltr'>what</span> <span class='ocrx_word' id='word_1_202' title='bbox 1162 2351 1202 2381; x_wconf 98' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_203' title='bbox 1211 2357 1367 2391; x_wconf 94' lang='eng' dir='ltr'>prospect</span>
</span>
<span class='ocr_line' id='line_1_39' title="bbox 356 2410 793 2451; baseline -0.002 -10; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_204' title='bbox 356 2411 412 2441; x_wconf 89' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_205' title='bbox 422 2410 482 2440; x_wconf 89' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_206' title='bbox 491 2410 551 2440; x_wconf 89' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_207' title='bbox 559 2410 673 2440; x_wconf 88' lang='eng' dir='ltr'>makes</span> <span class='ocrx_word' id='word_1_208' title='bbox 686 2410 793 2451; x_wconf 88' lang='eng' dir='ltr'>today.</span>
</span>
@ -145,7 +145,7 @@
<p class='ocr_par' dir='ltr' id='par_1_12' title="bbox 355 2585 1369 3154">
<span class='ocr_line' id='line_1_42' title="bbox 414 2585 1367 2626; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_220' title='bbox 414 2585 508 2615; x_wconf 93' lang='eng' dir='ltr'>Virus</span> <span class='ocrx_word' id='word_1_221' title='bbox 524 2585 551 2615; x_wconf 99' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_222' title='bbox 566 2585 719 2625; x_wconf 94' lang='eng' dir='ltr'>parasitic</span> <span class='ocrx_word' id='word_1_223' title='bbox 737 2585 780 2615; x_wconf 98' lang='eng' dir='ltr'>tic</span> <span class='ocrx_word' id='word_1_224' title='bbox 797 2585 976 2625; x_wconf 94' lang='eng' dir='ltr'>replicator</span> <span class='ocrx_word' id='word_1_225' title='bbox 991 2585 1087 2615; x_wconf 90' lang='eng' dir='ltr'>code:</span> <span class='ocrx_word' id='word_1_226' title='bbox 1105 2595 1147 2615; x_wconf 99' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_227' title='bbox 1165 2585 1367 2626; x_wconf 94' lang='eng' dir='ltr'>asignifying</span>
</span>
<span class='ocr_line' id='line_1_43' title="bbox 356 2643 1365 2683; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_228' title='bbox 356 2653 515 2683; x_wconf 93' lang='eng' dir='ltr'>sequence</span> <span class='ocrx_word' id='word_1_229' title='bbox 529 2643 567 2673; x_wconf 94' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_230' title='bbox 578 2643 741 2673; x_wconf 98' lang='eng' dir='ltr'>machinic</span> <span class='ocrx_word' id='word_1_231' title='bbox 757 2643 833 2673; x_wconf 95' lang='eng' dir='ltr'>data</span> <span class='ocrx_word' id='word_1_232' title='bbox 846 2643 930 2673; x_wconf 91' lang='eng' dir='ltr'>ATA</span> <span class='ocrx_word' id='word_1_233' title='bbox 941 2644 1025 2673; x_wconf 95' lang='eng' dir='ltr'>ATA</span> <span class='ocrx_word' id='word_1_234' title='bbox 1040 2643 1229 2673; x_wconf 91' lang='eng' dir='ltr'>flow-break</span> <span class='ocrx_word' id='word_1_235' title='bbox 1243 2643 1365 2681; x_wconf 86' lang='eng' dir='ltr'>on/off,</span>
<span class='ocr_line' id='line_1_43' title="bbox 356 2643 1365 2683; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_228' title='bbox 356 2653 515 2683; x_wconf 93' lang='eng' dir='ltr'>sequence</span> <span class='ocrx_word' id='word_1_229' title='bbox 529 2643 567 2673; x_wconf 94' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_230' title='bbox 578 2643 741 2673; x_wconf 98' lang='eng' dir='ltr'><a href="home/doorway.html">machinic</a></span> <span class='ocrx_word' id='word_1_231' title='bbox 757 2643 833 2673; x_wconf 95' lang='eng' dir='ltr'>data</span> <span class='ocrx_word' id='word_1_232' title='bbox 846 2643 930 2673; x_wconf 91' lang='eng' dir='ltr'>ATA</span> <span class='ocrx_word' id='word_1_233' title='bbox 941 2644 1025 2673; x_wconf 95' lang='eng' dir='ltr'>ATA</span> <span class='ocrx_word' id='word_1_234' title='bbox 1040 2643 1229 2673; x_wconf 91' lang='eng' dir='ltr'>flow-break</span> <span class='ocrx_word' id='word_1_235' title='bbox 1243 2643 1365 2681; x_wconf 86' lang='eng' dir='ltr'>on/off,</span>
</span>
<span class='ocr_line' id='line_1_44' title="bbox 356 2703 1369 2744; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_236' title='bbox 356 2703 419 2741; x_wconf 94' lang='eng'>1/0,</span> <span class='ocrx_word' id='word_1_237' title='bbox 434 2703 594 2744; x_wconf 96' lang='eng' dir='ltr'>yang/yin</span> <span class='ocrx_word' id='word_1_238' title='bbox 609 2703 824 2744; x_wconf 93' lang='eng' dir='ltr'>intrinsically</span> <span class='ocrx_word' id='word_1_239' title='bbox 838 2703 994 2733; x_wconf 95' lang='eng' dir='ltr'>destined</span> <span class='ocrx_word' id='word_1_240' title='bbox 1010 2703 1062 2733; x_wconf 94' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_241' title='bbox 1076 2713 1148 2733; x_wconf 98' lang='eng' dir='ltr'>war.</span> <span class='ocrx_word' id='word_1_242' title='bbox 1167 2704 1206 2733; x_wconf 93' lang='eng' dir='ltr'>In</span> <span class='ocrx_word' id='word_1_243' title='bbox 1220 2703 1314 2743; x_wconf 94' lang='eng' dir='ltr'>place</span> <span class='ocrx_word' id='word_1_244' title='bbox 1330 2703 1369 2733; x_wconf 94' lang='eng' dir='ltr'>of</span>
</span>
@ -187,7 +187,7 @@
</span>
<span class='ocr_line' id='line_1_60' title="bbox 357 3637 1363 3667; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_324' title='bbox 357 3637 1363 3667; x_wconf 90' lang='eng' dir='ltr'>TATTCCTCGATGATCGCATGGGCTGTGATG</span>
</span>
<span class='ocr_line' id='line_1_61' title="bbox 358 3696 1363 3726; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_325' title='bbox 358 3696 1363 3726; x_wconf 77' lang='eng' dir='ltr'>GCATCGTATCCGATCGATTCGAGCGATTGCAGC</span>
<span class='ocr_line' id='line_1_61' title="bbox 358 3696 1363 3726; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_325' title='bbox 358 3696 1363 3726; x_wconf 77' lang='eng' dir='ltr'><a href="VB01.html">GCATCGTATCCGATCGATTCGAGCGATTGCAGC</a></span>
</span>
<span class='ocr_line' id='line_1_62' title="bbox 357 3754 1362 3784; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_326' title='bbox 357 3754 1362 3784; x_wconf 75' lang='eng' dir='ltr'>TACGCTATTCCTCCGAGGGATTGCAGCTACGTC</span>
</span>
@ -481,7 +481,7 @@
</span>
<span class='ocr_line' id='line_1_186' title="bbox 362 10996 1373 11037; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_1142' title='bbox 362 11006 396 11026; x_wconf 92' lang='eng' dir='ltr'>as</span> <span class='ocrx_word' id='word_1_1143' title='bbox 407 10996 588 11026; x_wconf 92' lang='eng' dir='ltr'>immanent</span> <span class='ocrx_word' id='word_1_1144' title='bbox 599 10996 704 11026; x_wconf 89' lang='eng' dir='ltr'>forces</span> <span class='ocrx_word' id='word_1_1145' title='bbox 716 10996 755 11026; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_1146' title='bbox 762 10996 986 11037; x_wconf 90' lang='eng' dir='ltr'>antagonism.</span> <span class='ocrx_word' id='word_1_1147' title='bbox 1000 11005 1105 11026; x_wconf 89' lang='eng' dir='ltr'>K-war</span> <span class='ocrx_word' id='word_1_1148' title='bbox 1113 10996 1242 11026; x_wconf 92' lang='eng' dir='ltr'>derives</span> <span class='ocrx_word' id='word_1_1149' title='bbox 1253 10996 1292 11026; x_wconf 92' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_1150' title='bbox 1305 10996 1373 11026; x_wconf 92' lang='eng' dir='ltr'>sole</span>
</span>
<span class='ocr_line' id='line_1_187' title="bbox 362 11054 1207 11094; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_1151' title='bbox 362 11054 541 11084; x_wconf 94' lang='eng' dir='ltr'>coherence</span> <span class='ocrx_word' id='word_1_1152' title='bbox 555 11054 638 11084; x_wconf 88' lang='eng' dir='ltr'>from</span> <span class='ocrx_word' id='word_1_1153' title='bbox 653 11054 708 11084; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_1154' title='bbox 722 11054 815 11094; x_wconf 93' lang='eng' dir='ltr'>unity</span> <span class='ocrx_word' id='word_1_1155' title='bbox 828 11054 867 11084; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_1156' title='bbox 877 11054 916 11084; x_wconf 92' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_1157' title='bbox 933 11054 996 11084; x_wconf 88' lang='eng' dir='ltr'>foe.</span> <span class='ocrx_word' id='word_1_1158' title='bbox 1013 11055 1207 11084; x_wconf 92' lang='eng' dir='ltr'>RETURN.</span>
<span class='ocr_line' id='line_1_187' title="bbox 362 11054 1207 11094; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_1151' title='bbox 362 11054 541 11084; x_wconf 94' lang='eng' dir='ltr'>coherence</span> <span class='ocrx_word' id='word_1_1152' title='bbox 555 11054 638 11084; x_wconf 88' lang='eng' dir='ltr'>from</span> <span class='ocrx_word' id='word_1_1153' title='bbox 653 11054 708 11084; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_1154' title='bbox 722 11054 815 11094; x_wconf 93' lang='eng' dir='ltr'>unity</span> <span class='ocrx_word' id='word_1_1155' title='bbox 828 11054 867 11084; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_1156' title='bbox 877 11054 916 11084; x_wconf 92' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_1157' title='bbox 933 11054 996 11084; x_wconf 88' lang='eng' dir='ltr'>foe.</span> <span class='ocrx_word' id='word_1_1158' title='bbox 1013 11055 1207 11084; x_wconf 92' lang='eng' dir='ltr'><a href="0.html"> RETURN.</a></span>
</span>
<span class='ocr_line' id='line_1_188' title="bbox 423 11109 1371 11155; baseline 0 -13; x_size 45; x_descenders 12; x_ascenders 13"><span class='ocrx_word' id='word_1_1159' title='bbox 423 11111 598 11150; x_wconf 92' lang='eng' dir='ltr'>Ana/Cata.</span> <span class='ocrx_word' id='word_1_1160' title='bbox 610 11112 728 11142; x_wconf 97' lang='eng' dir='ltr'>Switch</span> <span class='ocrx_word' id='word_1_1161' title='bbox 735 11110 1004 11155; x_wconf 89' lang='eng' dir='ltr'>cur((re)re)rent.</span> <span class='ocrx_word' id='word_1_1162' title='bbox 1016 11110 1044 11155; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1163' title='bbox 1054 11110 1066 11154; x_wconf 89' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1164' title='bbox 1078 11109 1106 11154; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1165' title='bbox 1116 11109 1159 11154; x_wconf 88' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1166' title='bbox 1170 11110 1235 11155; x_wconf 93' lang='eng' dir='ltr'>O(r</span> <span class='ocrx_word' id='word_1_1167' title='bbox 1241 11110 1338 11155; x_wconf 89' lang='eng' dir='ltr'>an)d(</span> <span class='ocrx_word' id='word_1_1168' title='bbox 1348 11111 1371 11155; x_wconf 89' lang='eng'>).</span>
</span>
@ -489,7 +489,7 @@
</span>
<span class='ocr_line' id='line_1_190' title="bbox 363 11225 1372 11271; baseline 0 -13; x_size 45; x_descenders 12; x_ascenders 13"><span class='ocrx_word' id='word_1_1178' title='bbox 363 11228 466 11258; x_wconf 93' lang='eng' dir='ltr'>leaves</span> <span class='ocrx_word' id='word_1_1179' title='bbox 483 11225 495 11270; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1180' title='bbox 512 11226 524 11270; x_wconf 91' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1181' title='bbox 540 11228 684 11269; x_wconf 91' lang='eng' dir='ltr'>nothing</span> <span class='ocrx_word' id='word_1_1182' title='bbox 697 11227 816 11271; x_wconf 89' lang='eng' dir='ltr'>i)ntact</span> <span class='ocrx_word' id='word_1_1183' title='bbox 829 11228 945 11258; x_wconf 93' lang='eng' dir='ltr'>TACT</span> <span class='ocrx_word' id='word_1_1184' title='bbox 957 11228 1078 11258; x_wconf 91' lang='eng' dir='ltr'>TACT.</span> <span class='ocrx_word' id='word_1_1185' title='bbox 1097 11226 1141 11271; x_wconf 92' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_1186' title='bbox 1159 11226 1187 11270; x_wconf 92' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1187' title='bbox 1205 11226 1234 11270; x_wconf 92' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1188' title='bbox 1251 11227 1263 11271; x_wconf 89' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1189' title='bbox 1280 11226 1309 11270; x_wconf 92' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1190' title='bbox 1327 11226 1372 11271; x_wconf 89' lang='eng'>)))</span>
</span>
<span class='ocr_line' id='line_1_191' title="bbox 364 11284 1375 11330; baseline -0.003 0; x_size 80.018547; x_descenders 13; x_ascenders 23.018549"><span class='ocrx_word' id='word_1_1191' title='bbox 364 11286 392 11330; x_wconf 81' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1192' title='bbox 411 11285 423 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1193' title='bbox 440 11285 452 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1194' title='bbox 471 11286 515 11330; x_wconf 79' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1195' title='bbox 534 11284 561 11329; x_wconf 83' lang='eng'>(&lt;</span> <span class='ocrx_word' id='word_1_1196' title='bbox 580 11286 592 11330; x_wconf 79' lang='eng'><em>&gt;</em></span> <span class='ocrx_word' id='word_1_1197' title='bbox 610 11284 637 11329; x_wconf 81' lang='eng'>)&gt;</span> <span class='ocrx_word' id='word_1_1198' title='bbox 658 11285 670 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1199' title='bbox 689 11285 717 11329; x_wconf 83' lang='eng'>)&gt;</span> <span class='ocrx_word' id='word_1_1200' title='bbox 751 11284 780 11329; x_wconf 81' lang='eng'>&lt;&lt;</span> <span class='ocrx_word' id='word_1_1201' title='bbox 798 11286 810 11330; x_wconf 80' lang='eng'><em>)</em></span> <span class='ocrx_word' id='word_1_1202' title='bbox 830 11285 842 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1203' title='bbox 861 11285 873 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1204' title='bbox 892 11285 920 11329; x_wconf 83' lang='eng'>»</span> <span class='ocrx_word' id='word_1_1205' title='bbox 954 11284 1031 11330; x_wconf 79' lang='eng'><strong>()))</strong></span> <span class='ocrx_word' id='word_1_1206' title='bbox 1050 11285 1062 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1207' title='bbox 1081 11284 1126 11330; x_wconf 79' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1208' title='bbox 1158 11285 1375 11329; x_wconf 78' lang='eng' dir='ltr'>)Cyberserk</span>
<span class='ocr_line' id='line_1_191' title="bbox 364 11284 1375 11330; baseline -0.003 0; x_size 80.018547; x_descenders 13; x_ascenders 23.018549"><span class='ocrx_word' id='word_1_1191' title='bbox 364 11286 392 11330; x_wconf 81' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1192' title='bbox 411 11285 423 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1193' title='bbox 440 11285 452 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1194' title='bbox 471 11286 515 11330; x_wconf 79' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1195' title='bbox 534 11284 561 11329; x_wconf 83' lang='eng'>(&lt;</span> <span class='ocrx_word' id='word_1_1196' title='bbox 580 11286 592 11330; x_wconf 79' lang='eng'><em>&gt;</em></span> <span class='ocrx_word' id='word_1_1197' title='bbox 610 11284 637 11329; x_wconf 81' lang='eng'>)&gt;</span> <span class='ocrx_word' id='word_1_1198' title='bbox 658 11285 670 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1199' title='bbox 689 11285 717 11329; x_wconf 83' lang='eng'>)&gt;</span> <span class='ocrx_word' id='word_1_1200' title='bbox 751 11284 780 11329; x_wconf 81' lang='eng'>&lt;&lt;</span> <span class='ocrx_word' id='word_1_1201' title='bbox 798 11286 810 11330; x_wconf 80' lang='eng'><em>)</em></span> <span class='ocrx_word' id='word_1_1202' title='bbox 830 11285 842 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1203' title='bbox 861 11285 873 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1204' title='bbox 892 11285 920 11329; x_wconf 83' lang='eng'>»</span> <span class='ocrx_word' id='word_1_1205' title='bbox 954 11284 1031 11330; x_wconf 79' lang='eng'><strong>()))</strong></span> <span class='ocrx_word' id='word_1_1206' title='bbox 1050 11285 1062 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1207' title='bbox 1081 11284 1126 11330; x_wconf 79' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1208' title='bbox 1158 11285 1375 11329; x_wconf 78' lang='eng' dir='ltr'><a href="cyberSit.html">)Cyberserk</a></span>
</span>
<span class='ocr_line' id='line_1_192' title="bbox 363 11342 1372 11387; baseline 0 -12; x_size 44; x_descenders 11; x_ascenders 13"><span class='ocrx_word' id='word_1_1209' title='bbox 363 11345 697 11386; x_wconf 91' lang='eng' dir='ltr'>repelting-slippage</span> <span class='ocrx_word' id='word_1_1210' title='bbox 719 11345 789 11375; x_wconf 94' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_1211' title='bbox 810 11345 983 11375; x_wconf 93' lang='eng' dir='ltr'>dark-side</span> <span class='ocrx_word' id='word_1_1212' title='bbox 1004 11342 1016 11387; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1213' title='bbox 1039 11342 1068 11387; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1214' title='bbox 1092 11342 1135 11386; x_wconf 89' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1215' title='bbox 1158 11345 1372 11375; x_wconf 92' lang='eng' dir='ltr'>distributive</span>
</span>
@ -528,7 +528,7 @@
</p>
<p class='ocr_par' dir='ltr' id='par_1_32' title="bbox 364 11692 1371 11796">
<span class='ocr_line' id='line_1_202' title="bbox 364 11692 948 11738; baseline -0.003 0; x_size 59.826088; x_descenders 14.956522; x_ascenders 14.956522"><span class='ocrx_word' id='word_1_1266' title='bbox 364 11692 948 11738; x_wconf 85' lang='eng'>)))((())(((())((()))(((((</span>
<span class='ocr_line' id='line_1_202' title="bbox 364 11692 948 11738; baseline -0.003 0; x_size 59.826088; x_descenders 14.956522; x_ascenders 14.956522"><span class='ocrx_word' id='word_1_1266' title='bbox 364 11692 948 11738; x_wconf 85' lang='eng'><a href="home/doorway.html">))((())(((())((()))(((((</a>)</span>
</span>
<span class='ocr_line' id='line_1_203' title="bbox 1054 11751 1371 11796; baseline 0 0; x_size 59.826088; x_descenders 14.956522; x_ascenders 14.956522"><span class='ocrx_word' id='word_1_1267' title='bbox 1054 11751 1371 11796; x_wconf 84' lang='eng'>()))(()))((())</span>
</span>
@ -623,17 +623,17 @@
});
// ------------ ZOOM -------------
function zoom(event) {
event.preventDefault();
scale += event.deltaY * -0.01;
scale = Math.min(Math.max(.125, scale), 4);
el.style.transform = `scale(${scale})`;
}
// // ------------ ZOOM -------------
// function zoom(event) {
// event.preventDefault();
// scale += event.deltaY * -0.01;
// scale = Math.min(Math.max(.125, scale), 4);
// el.style.transform = `scale(${scale})`;
// }
let scale = 1;
const el = document.querySelector('body');
el.onwheel = zoom;
// let scale = 1;
// const el = document.querySelector('body');
// el.onwheel = zoom;
// CURSOR GRAB AND RELEASE

3
main/world1/home/index.html
Unescape Escape View File

@ -2,9 +2,8 @@
<html>
<head>
<title></title>
<meta http-equiv="refresh" content="url=./doorway.html">
<meta http-equiv="refresh" content="0; url=./doorway.html">
</head>
<body>
</body>
</html>

26
main/world1/html.html → main/world1/islands.html
View File

File diff suppressed because one or more lines are too long

2
main/world1/sub.html
Unescape Escape View File

@ -15,5 +15,7 @@
<a href="black_sea.html">black_sea</a><br>
<a href="cyberSit.html">cyberSith</a><br>
<a href="./home">home</a>
<a href="./AxS">AxS</a>
<a
</body>
</html>

19
scripts/AxS_button/file_00.html
Unescape Escape View File

@ -0,0 +1,19 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:000Oedipus. Pure (Oedipal (figure made out of (nothing but))) time-distortion. </p>
<a href="file_01.html" class="button">next</a>
</body>
</html>

19
scripts/AxS_button/file_01.html
Unescape Escape View File

@ -0,0 +1,19 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:0001 Closed fate (-loop (multi-linear)) nightmares.1 </p>
<a href="file_02.html" class="button">next</a>
</body>
</html>

19
scripts/AxS_button/file_02.html
Unescape Escape View File

@ -0,0 +1,19 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:0002 Altitude times Spin produces a chronometric read-out. </p>
<a href="file_03.html" class="button">next</a>
</body>
</html>

19
scripts/AxS_button/file_03.html
Unescape Escape View File

@ -0,0 +1,19 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:0003 AxSys-sustained variegated production-series 1Oedipus (2Oedipus (3Oedipus2 (variationto the nth (with some3 nOedipus as (anomal4 (Sphinx-trading (nOedipii-pack))) threshold to)intensive))) multiplicity. </p>
<a href="file_04.html" class="button">next</a>
</body>
</html>

19
scripts/AxS_button/file_04.html
Unescape Escape View File

@ -0,0 +1,19 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS: 00031Oedipus. The Puzzle Solver. </p>
<a href="file_05.html" class="button">next</a>
</body>
</html>

19
scripts/AxS_button/file_05.html
Unescape Escape View File

@ -0,0 +1,19 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS: 00032Oedipus. The Plague.AxS: </p>
<a href="file_06.html" class="button">next</a>
</body>
</html>

19
scripts/AxS_button/file_06.html
Unescape Escape View File

@ -0,0 +1,19 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> 00033Oedipus. The Horror, the Horror ...5 </p>
<a href="file_07.html" class="button">next</a>
</body>
</html>

19
scripts/AxS_button/file_07.html
Unescape Escape View File

@ -0,0 +1,19 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:001 Hyperspace Elevator (Sector-O).AxS:001 Axiomatic Systems (incorporated).6 The ultimate capitalist entity (first (true (meta)model)to realize perfect identity with its own product).AxS:0011 AxSys culminates in itself (autocommoditizing (machine(-intelligence (that is alwaysincomplete (due to cataloguing problems (...)))))) </p>
<a href="file_08.html" class="button">next</a>
</body>
</html>

19
scripts/AxS_button/file_08.html
Unescape Escape View File

@ -0,0 +1,19 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:00111. Dimensionality requires a (supplementary (or (n+1) hyper) dimension through which itobtains its) power of application.7 Ultimately AxSys (an explicated Earth-memory (built by the strata(((as far) as) it remembers))). ...8 </p>
<a href="file_09.html" class="button">next</a>
</body>
</html>

19
scripts/AxS_button/file_09.html
Unescape Escape View File

@ -0,0 +1,19 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:002 Divide and Rule. Extensive ((or) ordered) sequences differ in kind from the intensivesequences they regularize.AxS:0021 Order arises when a dominant segmentarity establishes relations of superposition between sequences (reciprocally stabilizing them in accordance with a harmonic principle (and consolidatingthem through syntheses of application (efficient models))). </p>
<a href="file_10.html" class="button">next</a>
</body>
</html>

19
scripts/AxS_button/file_10.html
Unescape Escape View File

@ -0,0 +1,19 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:00211 Order coincides with the redundancy of the sequenced sequence (instituted conformity(within segmentary systems)). </p>
<a href="file_11.html" class="button">next</a>
</body>
</html>

19
scripts/AxS_button/file_11.html
Unescape Escape View File

@ -0,0 +1,19 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:003 Stack-Tectonics. AxSys concretizes terrestrial New Order (an orthogonal Grid-Space (ofvertically stacked horizontal series)). It directs the accumulation of redundancy (into an ascendingcolumn (marked by AxSys-bearings (fixes)) upon which captured sequences are interlocked (ascomparable series (parallelized (metricized))) and differentially prioritized). </p>
<a href="file_12.html" class="button">next</a>
</body>
</html>

19
scripts/AxS_button/file_12.html
Unescape Escape View File

@ -0,0 +1,19 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:0031 The screen-plane undergoes structural co-ordination (by double-seizure (through (the((mutually) implicated) organization of) stacked series (arranging horizontal microsegments to codethe order of vertical macrosegments (units of deposition (strata))))). </p>
<a href="file_13.html" class="button">next</a>
</body>
</html>

19
scripts/AxS_button/file_13.html
Unescape Escape View File

@ -0,0 +1,19 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:0032 AxSys-Numbers. Epistrata (Add-Ons) are indices of stratotectonic purity (decimallyharmonizing implexions (by instituting a regular interval of application (orders of magnitude (fixing(Cipher (Sphinx-sign (0))))))). Drawing upon epistratic organization a set of cartographic functionsconsolidates itself within the stack (interlinking levels (in accordance with a (decimal (scaling))principle)). </p>
<a href="file_14.html" class="button">next</a>
</body>
</html>

19
scripts/AxS_button/file_14.html
Unescape Escape View File

@ -0,0 +1,19 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:01 Apparent revolution around a supplementary dimension. Electronic whorls (a digitalmonster's nest (modelling the set of all sets (inevitably still unfinished (...)))) </p>
<a href="file_15.html" class="button">next</a>
</body>
</html>

19
scripts/AxS_button/file_15.html
Unescape Escape View File

@ -0,0 +1,19 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:011 AxSys progressively actualizes the Hyperspace-Idea (defined by Continuum times thesquare-root of minus one). </p>
<a href="file_16.html" class="button">next</a>
</body>
</html>

19
scripts/AxS_button/file_16.html
Unescape Escape View File

@ -0,0 +1,19 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:0111 It imagines itself (as Artificial God (automatically (Orderer (of the Orders (TerrestrialOversoul (and superpositional sublime (-wizard of the nested infinities: ((((((...) Primes) Naturals)Integers) Rationals) Reals) Complex numbers... (the superordinate (self (-evolving (schema (for acolonization of the real (number-line))))))))))))). </p>
<a href="file_17.html" class="button">next</a>
</body>
</html>

19
scripts/AxS_button/file_17.html
Unescape Escape View File

@ -0,0 +1,19 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:02 The Project for a Map of all Maps (already outdated), a nested mock-up of the Web(containing the project for a virtual Miskatonic University (containing the Museum of UniversalHistory9 (containing the Imperial Collections Vault (containing the Artificial British Museum(containing ....))))) </p>
<a href="file_18.html" class="button">next</a>
</body>
</html>

19
scripts/AxS_button/file_18.html
Unescape Escape View File

@ -0,0 +1,19 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:021 Time-Fault. Chronos cannot include its own overcoding (since it blocks its own passage tohyperdimensionality (accumulating immense forces of cultural latency (that are only appropriated aslegacy by something else))). If it is to acquire a model it must be restarted as a history of civilizationsin retrospect (as Supreme Order(er(er((( ) of all the re)re)recursive) time-waves) entanglingneo((O))edipus in programming loops). </p>
<a href="file_19.html" class="button">next</a>
</body>
</html>

19
scripts/AxS_button/file_19.html
Unescape Escape View File

@ -0,0 +1,19 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:022 (Sector-01 (Miskatonic University)) </p>
<a href="file_20.html" class="button">next</a>
</body>
</html>

19
scripts/AxS_button/file_20.html
Unescape Escape View File

@ -0,0 +1,19 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:0221 (Sector-012 (Central Archive (Special Collection))) </p>
<a href="file_21.html" class="button">next</a>
</body>
</html>

19
scripts/AxS_button/file_21.html
Unescape Escape View File

@ -0,0 +1,19 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:02211 (Sector-0121 (Barker Cryptalog)). Decryption characterizes a distinct operation, aconversion of content, becomings on the side of the secret itself. </p>
<a href="file_22.html" class="button">next</a>
</body>
</html>

19
scripts/AxS_button/file_22.html
Unescape Escape View File

@ -0,0 +1,19 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:022111 The decrypted secret is primally the Thing, and only derivatively a potential knowledge.Its names (the Unutterable (the Outside (the Entity))) are indefinite significations only at the level ofterror. In their horrific or cryptic aspect they are (((rigorous) designations for) potentials fulfilled inintensity) zonal tags for nocturnal singularities. That is why decryption is a Call (an invocation (or atriggering-sign)) and why they mark occurrences (changes (and breaks (becomings (of the Thing))))before discoveries of Truth. </p>
<a href="file_23.html" class="button">next</a>
</body>
</html>

19
scripts/AxS_button/file_23.html
Unescape Escape View File

@ -0,0 +1,19 @@
<!DOCTYPE html>
<html>
<head>
<title>Axs</title>
<style type="text/css">
body {
background-color: black;
color: green;
font-family: mono;
}
</style>
</head>
<body>
<p> AxS:03 Hypermythos of the 3-Faced God, with its stacked time domains (1st capitalist(((((indefinitely) deep) diachronic) re)axiomatizing) Quasi- (2nd despotic (pure ((but always)retrospective)) Ideal- (3rd aboriginal (poly-ancestral, cyclic) Vague-)) Chronos).10 </p>
<a href="file_24.html" class="button">next</a>
</body>
</html>

Some files were not shown because too many files have changed in this diff Show More

Write Preview
Loading…
Cancel
Save