From 7dc50b2e22a3d1fc577aea05d4c8f74b36f32afe Mon Sep 17 00:00:00 2001 From: Tancre Date: Wed, 3 Jun 2020 04:53:47 +0200 Subject: [PATCH] axs --- code_base/bgs/1.html | 30 +++++ code_base/bgs/1_files/blizard.js | 148 ++++++++++++++++++++++++ code_base/bgs/2.html | 58 ++++++++++ code_base/bgs/2_files/blizard.js | 148 ++++++++++++++++++++++++ code_base/bgs/3.html | 58 ++++++++++ code_base/bgs/3_files/blizard.js | 148 ++++++++++++++++++++++++ code_base/bgs/4.html | 58 ++++++++++ code_base/bgs/4_files/blizard.js | 148 ++++++++++++++++++++++++ code_base/bgs/5.html | 58 ++++++++++ code_base/bgs/5_files/blizard.js | 148 ++++++++++++++++++++++++ code_base/bgs/6.html | 29 +++++ code_base/bgs/6_files/blizard.js | 148 ++++++++++++++++++++++++ code_base/bgs/7.html | 29 +++++ code_base/bgs/7_files/blizard.js | 148 ++++++++++++++++++++++++ code_base/pop_up_basics/pop.html | 9 ++ code_base/pop_up_basics/popo.html | 48 ++++++++ code_base/pop_up_basics/popo2.html | 45 +++++++ main/world1/AxS/000.html | 18 +++ main/world1/AxS/0001.html | 18 +++ main/world1/AxS/0002.html | 18 +++ main/world1/AxS/0003.html | 18 +++ main/world1/AxS/00031.html | 18 +++ main/world1/AxS/00032.html | 18 +++ main/world1/AxS/00033.html | 18 +++ main/world1/AxS/001.html | 18 +++ main/world1/AxS/00111.html | 18 +++ main/world1/AxS/002.html | 18 +++ main/world1/AxS/00211.html | 18 +++ main/world1/AxS/003.html | 18 +++ main/world1/AxS/0031.html | 18 +++ main/world1/AxS/0032.html | 18 +++ main/world1/AxS/01.html | 18 +++ main/world1/AxS/011.html | 18 +++ main/world1/AxS/0111.html | 18 +++ main/world1/AxS/02.html | 18 +++ main/world1/AxS/021.html | 18 +++ main/world1/AxS/022.html | 18 +++ main/world1/AxS/0221.html | 18 +++ main/world1/AxS/02211.html | 18 +++ main/world1/AxS/022111.html | 18 +++ main/world1/AxS/03.html | 18 +++ main/world1/AxS/031.html | 18 +++ main/world1/AxS/032.html | 18 +++ main/world1/AxS/033.html | 18 +++ main/world1/AxS/1.html | 18 +++ main/world1/AxS/11.html | 18 +++ main/world1/AxS/12.html | 18 +++ main/world1/AxS/121.html | 18 +++ main/world1/AxS/1211.html | 18 +++ main/world1/AxS/13.html | 18 +++ main/world1/AxS/131.html | 18 +++ main/world1/AxS/132.html | 18 +++ main/world1/AxS/2.html | 18 +++ main/world1/AxS/21.html | 18 +++ main/world1/AxS/211.html | 18 +++ main/world1/AxS/2111.html | 18 +++ main/world1/AxS/21111.html | 18 +++ main/world1/AxS/22.html | 18 +++ main/world1/AxS/221.html | 18 +++ main/world1/AxS/2211.html | 18 +++ main/world1/AxS/221111.html | 18 +++ main/world1/AxS/2211111.html | 18 +++ main/world1/AxS/22111111.html | 18 +++ main/world1/AxS/222.html | 18 +++ main/world1/AxS/3.html | 18 +++ main/world1/AxS/31.html | 18 +++ main/world1/AxS/311.html | 18 +++ main/world1/AxS/32.html | 18 +++ main/world1/AxS/33.html | 18 +++ main/world1/AxS/AxS:0/index.html | 16 +++ main/world1/AxS/axs.txt | 33 ++++++ main/world1/AxS/index.html | 123 ++++++++++++++++++++ main/world1/Ixse.html | 32 ++--- main/world1/home/index.html | 3 +- main/world1/{html.html => islands.html} | 26 ++--- main/world1/sub.html | 2 + scripts/AxS_button/file_00.html | 19 +++ scripts/AxS_button/file_01.html | 19 +++ scripts/AxS_button/file_02.html | 19 +++ scripts/AxS_button/file_03.html | 19 +++ scripts/AxS_button/file_04.html | 19 +++ scripts/AxS_button/file_05.html | 19 +++ scripts/AxS_button/file_06.html | 19 +++ scripts/AxS_button/file_07.html | 19 +++ scripts/AxS_button/file_08.html | 19 +++ scripts/AxS_button/file_09.html | 19 +++ scripts/AxS_button/file_10.html | 19 +++ scripts/AxS_button/file_11.html | 19 +++ scripts/AxS_button/file_12.html | 19 +++ scripts/AxS_button/file_13.html | 19 +++ scripts/AxS_button/file_14.html | 19 +++ scripts/AxS_button/file_15.html | 19 +++ scripts/AxS_button/file_16.html | 19 +++ scripts/AxS_button/file_17.html | 19 +++ scripts/AxS_button/file_18.html | 19 +++ scripts/AxS_button/file_19.html | 19 +++ scripts/AxS_button/file_20.html | 19 +++ scripts/AxS_button/file_21.html | 19 +++ scripts/AxS_button/file_22.html | 19 +++ scripts/AxS_button/file_23.html | 19 +++ scripts/AxS_button/file_24.html | 19 +++ scripts/AxS_button/file_25.html | 19 +++ scripts/AxS_button/file_26.html | 19 +++ scripts/AxS_button/file_27.html | 19 +++ scripts/AxS_button/file_28.html | 19 +++ scripts/AxS_button/file_29.html | 19 +++ scripts/AxS_button/file_30.html | 19 +++ scripts/AxS_button/file_31.html | 19 +++ scripts/AxS_button/file_32.html | 19 +++ scripts/AxS_button/file_33.html | 19 +++ scripts/AxS_button/file_34.html | 19 +++ scripts/AxS_button/file_35.html | 19 +++ scripts/AxS_button/file_36.html | 19 +++ scripts/AxS_button/file_37.html | 19 +++ scripts/AxS_button/file_38.html | 19 +++ scripts/AxS_button/file_39.html | 19 +++ scripts/AxS_button/file_40.html | 19 +++ scripts/AxS_button/file_41.html | 19 +++ scripts/AxS_button/file_42.html | 19 +++ scripts/AxS_button/file_43.html | 19 +++ scripts/AxS_button/file_44.html | 19 +++ scripts/AxS_button/file_45.html | 19 +++ scripts/AxS_button/file_46.html | 19 +++ scripts/AxS_button/file_47.html | 19 +++ scripts/AxS_button/file_48.html | 19 +++ scripts/AxS_button/file_49.html | 19 +++ scripts/AxS_button/file_50.html | 19 +++ scripts/AxS_button/file_51.html | 19 +++ scripts/AxS_button/file_52.html | 19 +++ scripts/html_linear_series.py | 13 ++- scripts/style.css | 19 +++ scripts/texts/axs.txt | 53 +++++++++ text_base/AxS/000.html | 18 +++ text_base/AxS/0001.html | 18 +++ text_base/AxS/0002.html | 18 +++ text_base/AxS/0003.html | 18 +++ text_base/AxS/00031.html | 18 +++ text_base/AxS/00032.html | 18 +++ text_base/AxS/00033.html | 18 +++ text_base/AxS/001.html | 18 +++ text_base/AxS/00111.html | 18 +++ text_base/AxS/002.html | 18 +++ text_base/AxS/00211.html | 18 +++ text_base/AxS/003.html | 18 +++ text_base/AxS/0031.html | 18 +++ text_base/AxS/0032.html | 18 +++ text_base/AxS/01.html | 18 +++ text_base/AxS/011.html | 18 +++ text_base/AxS/0111.html | 18 +++ text_base/AxS/02.html | 18 +++ text_base/AxS/021.html | 18 +++ text_base/AxS/022.html | 18 +++ text_base/AxS/0221.html | 18 +++ text_base/AxS/02211.html | 18 +++ text_base/AxS/022111.html | 18 +++ text_base/AxS/03.html | 18 +++ text_base/AxS/031.html | 18 +++ text_base/AxS/032.html | 18 +++ text_base/AxS/033.html | 18 +++ text_base/AxS/1.html | 18 +++ text_base/AxS/11.html | 18 +++ text_base/AxS/12.html | 18 +++ text_base/AxS/121.html | 18 +++ text_base/AxS/1211.html | 18 +++ text_base/AxS/13.html | 18 +++ text_base/AxS/131.html | 18 +++ text_base/AxS/132.html | 18 +++ text_base/AxS/2.html | 18 +++ text_base/AxS/21.html | 18 +++ text_base/AxS/211.html | 18 +++ text_base/AxS/2111.html | 18 +++ text_base/AxS/21111.html | 18 +++ text_base/AxS/22.html | 18 +++ text_base/AxS/221.html | 18 +++ text_base/AxS/2211.html | 18 +++ text_base/AxS/221111.html | 18 +++ text_base/AxS/2211111.html | 18 +++ text_base/AxS/22111111.html | 18 +++ text_base/AxS/222.html | 18 +++ text_base/AxS/3.html | 18 +++ text_base/AxS/31.html | 18 +++ text_base/AxS/311.html | 18 +++ text_base/AxS/32.html | 18 +++ text_base/AxS/33.html | 18 +++ text_base/AxS/AxS:0/index.html | 16 +++ text_base/AxS/axs.txt | 33 ++++++ text_base/AxS/index.html | 123 ++++++++++++++++++++ text_base/index.html | 0 188 files changed, 4794 insertions(+), 35 deletions(-) create mode 100644 code_base/bgs/1.html create mode 100644 code_base/bgs/1_files/blizard.js create mode 100644 code_base/bgs/2.html create mode 100644 code_base/bgs/2_files/blizard.js create mode 100644 code_base/bgs/3.html create mode 100644 code_base/bgs/3_files/blizard.js create mode 100644 code_base/bgs/4.html create mode 100644 code_base/bgs/4_files/blizard.js create mode 100644 code_base/bgs/5.html create mode 100644 code_base/bgs/5_files/blizard.js create mode 100644 code_base/bgs/6.html create mode 100644 code_base/bgs/6_files/blizard.js create mode 100644 code_base/bgs/7.html create mode 100644 code_base/bgs/7_files/blizard.js create mode 100644 code_base/pop_up_basics/pop.html create mode 100644 code_base/pop_up_basics/popo.html create mode 100644 code_base/pop_up_basics/popo2.html create mode 100644 main/world1/AxS/000.html create mode 100644 main/world1/AxS/0001.html create mode 100644 main/world1/AxS/0002.html create mode 100644 main/world1/AxS/0003.html create mode 100644 main/world1/AxS/00031.html create mode 100644 main/world1/AxS/00032.html create mode 100644 main/world1/AxS/00033.html create mode 100644 main/world1/AxS/001.html create mode 100644 main/world1/AxS/00111.html create mode 100644 main/world1/AxS/002.html create mode 100644 main/world1/AxS/00211.html create mode 100644 main/world1/AxS/003.html create mode 100644 main/world1/AxS/0031.html create mode 100644 main/world1/AxS/0032.html create mode 100644 main/world1/AxS/01.html create mode 100644 main/world1/AxS/011.html create mode 100644 main/world1/AxS/0111.html create mode 100644 main/world1/AxS/02.html create mode 100644 main/world1/AxS/021.html create mode 100644 main/world1/AxS/022.html create mode 100644 main/world1/AxS/0221.html create mode 100644 main/world1/AxS/02211.html create mode 100644 main/world1/AxS/022111.html create mode 100644 main/world1/AxS/03.html create mode 100644 main/world1/AxS/031.html create mode 100644 main/world1/AxS/032.html create mode 100644 main/world1/AxS/033.html create mode 100644 main/world1/AxS/1.html create mode 100644 main/world1/AxS/11.html create mode 100644 main/world1/AxS/12.html create mode 100644 main/world1/AxS/121.html create mode 100644 main/world1/AxS/1211.html create mode 100644 main/world1/AxS/13.html create mode 100644 main/world1/AxS/131.html create mode 100644 main/world1/AxS/132.html create mode 100644 main/world1/AxS/2.html create mode 100644 main/world1/AxS/21.html create mode 100644 main/world1/AxS/211.html create mode 100644 main/world1/AxS/2111.html create mode 100644 main/world1/AxS/21111.html create mode 100644 main/world1/AxS/22.html create mode 100644 main/world1/AxS/221.html create mode 100644 main/world1/AxS/2211.html create mode 100644 main/world1/AxS/221111.html create mode 100644 main/world1/AxS/2211111.html create mode 100644 main/world1/AxS/22111111.html create mode 100644 main/world1/AxS/222.html create mode 100644 main/world1/AxS/3.html create mode 100644 main/world1/AxS/31.html create mode 100644 main/world1/AxS/311.html create mode 100644 main/world1/AxS/32.html create mode 100644 main/world1/AxS/33.html create mode 100644 main/world1/AxS/AxS:0/index.html create mode 100644 main/world1/AxS/axs.txt create mode 100644 main/world1/AxS/index.html rename main/world1/{html.html => islands.html} (99%) create mode 100644 scripts/AxS_button/file_00.html create mode 100644 scripts/AxS_button/file_01.html create mode 100644 scripts/AxS_button/file_02.html create mode 100644 scripts/AxS_button/file_03.html create mode 100644 scripts/AxS_button/file_04.html create mode 100644 scripts/AxS_button/file_05.html create mode 100644 scripts/AxS_button/file_06.html create mode 100644 scripts/AxS_button/file_07.html create mode 100644 scripts/AxS_button/file_08.html create mode 100644 scripts/AxS_button/file_09.html create mode 100644 scripts/AxS_button/file_10.html create mode 100644 scripts/AxS_button/file_11.html create mode 100644 scripts/AxS_button/file_12.html create mode 100644 scripts/AxS_button/file_13.html create mode 100644 scripts/AxS_button/file_14.html create mode 100644 scripts/AxS_button/file_15.html create mode 100644 scripts/AxS_button/file_16.html create mode 100644 scripts/AxS_button/file_17.html create mode 100644 scripts/AxS_button/file_18.html create mode 100644 scripts/AxS_button/file_19.html create mode 100644 scripts/AxS_button/file_20.html create mode 100644 scripts/AxS_button/file_21.html create mode 100644 scripts/AxS_button/file_22.html create mode 100644 scripts/AxS_button/file_23.html create mode 100644 scripts/AxS_button/file_24.html create mode 100644 scripts/AxS_button/file_25.html create mode 100644 scripts/AxS_button/file_26.html create mode 100644 scripts/AxS_button/file_27.html create mode 100644 scripts/AxS_button/file_28.html create mode 100644 scripts/AxS_button/file_29.html create mode 100644 scripts/AxS_button/file_30.html create mode 100644 scripts/AxS_button/file_31.html create mode 100644 scripts/AxS_button/file_32.html create mode 100644 scripts/AxS_button/file_33.html create mode 100644 scripts/AxS_button/file_34.html create mode 100644 scripts/AxS_button/file_35.html create mode 100644 scripts/AxS_button/file_36.html create mode 100644 scripts/AxS_button/file_37.html create mode 100644 scripts/AxS_button/file_38.html create mode 100644 scripts/AxS_button/file_39.html create mode 100644 scripts/AxS_button/file_40.html create mode 100644 scripts/AxS_button/file_41.html create mode 100644 scripts/AxS_button/file_42.html create mode 100644 scripts/AxS_button/file_43.html create mode 100644 scripts/AxS_button/file_44.html create mode 100644 scripts/AxS_button/file_45.html create mode 100644 scripts/AxS_button/file_46.html create mode 100644 scripts/AxS_button/file_47.html create mode 100644 scripts/AxS_button/file_48.html create mode 100644 scripts/AxS_button/file_49.html create mode 100644 scripts/AxS_button/file_50.html create mode 100644 scripts/AxS_button/file_51.html create mode 100644 scripts/AxS_button/file_52.html create mode 100644 scripts/style.css create mode 100644 scripts/texts/axs.txt create mode 100644 text_base/AxS/000.html create mode 100644 text_base/AxS/0001.html create mode 100644 text_base/AxS/0002.html create mode 100644 text_base/AxS/0003.html create mode 100644 text_base/AxS/00031.html create mode 100644 text_base/AxS/00032.html create mode 100644 text_base/AxS/00033.html create mode 100644 text_base/AxS/001.html create mode 100644 text_base/AxS/00111.html create mode 100644 text_base/AxS/002.html create mode 100644 text_base/AxS/00211.html create mode 100644 text_base/AxS/003.html create mode 100644 text_base/AxS/0031.html create mode 100644 text_base/AxS/0032.html create mode 100644 text_base/AxS/01.html create mode 100644 text_base/AxS/011.html create mode 100644 text_base/AxS/0111.html create mode 100644 text_base/AxS/02.html create mode 100644 text_base/AxS/021.html create mode 100644 text_base/AxS/022.html create mode 100644 text_base/AxS/0221.html create mode 100644 text_base/AxS/02211.html create mode 100644 text_base/AxS/022111.html create mode 100644 text_base/AxS/03.html create mode 100644 text_base/AxS/031.html create mode 100644 text_base/AxS/032.html create mode 100644 text_base/AxS/033.html create mode 100644 text_base/AxS/1.html create mode 100644 text_base/AxS/11.html create mode 100644 text_base/AxS/12.html create mode 100644 text_base/AxS/121.html create mode 100644 text_base/AxS/1211.html create mode 100644 text_base/AxS/13.html create mode 100644 text_base/AxS/131.html create mode 100644 text_base/AxS/132.html create mode 100644 text_base/AxS/2.html create mode 100644 text_base/AxS/21.html create mode 100644 text_base/AxS/211.html create mode 100644 text_base/AxS/2111.html create mode 100644 text_base/AxS/21111.html create mode 100644 text_base/AxS/22.html create mode 100644 text_base/AxS/221.html create mode 100644 text_base/AxS/2211.html create mode 100644 text_base/AxS/221111.html create mode 100644 text_base/AxS/2211111.html create mode 100644 text_base/AxS/22111111.html create mode 100644 text_base/AxS/222.html create mode 100644 text_base/AxS/3.html create mode 100644 text_base/AxS/31.html create mode 100644 text_base/AxS/311.html create mode 100644 text_base/AxS/32.html create mode 100644 text_base/AxS/33.html create mode 100644 text_base/AxS/AxS:0/index.html create mode 100644 text_base/AxS/axs.txt create mode 100644 text_base/AxS/index.html create mode 100644 text_base/index.html diff --git a/code_base/bgs/1.html b/code_base/bgs/1.html new file mode 100644 index 0000000..aece612 --- /dev/null +++ b/code_base/bgs/1.html @@ -0,0 +1,30 @@ + + + + + + + 01 + + + + + +
*x * * xx|_*| x|*x* x_ *_|x_ _ _*|_*_x__|x *x** x**_*|||x xx| *_||*_*__*__|* *x*xx* || x||x* *| |x*|*x*|_*|_*_ || *_**_|** **_*_*x* *||*xx| |*|||__*x_ x | _*x_|| *||xx *x|x_ _x|x _ _|x|*x_|*xx|x|x x x||_x*|__|*x *x_**|x_*|* | |_||*_x| *| ___| * x |* _x *||**_* **__*_ *_ __x|| x*_|_x*x xx*x_*x**_|*_|x*| *_ *|_|x_x| *| *__x_x | _|*_*xx x|_ |*|_ *|| x|||x__x_* **| xx*__x*__*_ | *x_*| x*x|x* | x |xx ||*|***x * _|_*_*_ |_xx*_||*_|*x*_ * xx*|xxx* __**|| _|*|_*|x __ x x__|*||*| **__ |_ _|_xx|| _ **_x*|_x _ | |_* x|x _ ||x ||_| _*__ x_| x*xx_ x___x_|x || *x|xx| _ ||||x_x__|x || x||x|*x| |_ *|** _* |*x_ x| xx|**xx__*x|_|*|||__|*| x*** x__x||||x_|x|_|*x*x |_*|_||x**_*|*__||**_x|** _ * x|x___ * * |xx*|_|* _|*| *xx| x_|_*_xx_|x__|_ *__x _* * *x_|**x|_*| _x*__x|* _x x_x**_x_|x |||x | _|___*|_|x__x x__** _|_| __* |***_|__ | | ||| _||_|**_ ___* xx|__|_**x ** |_*_*|x|_x*_*x| ||__ | x|*_x| xxxx_xx|* *|*x|x _ __ |x| * ** xx |*| *x*_xx**_ x*_ x_x_ |x| _*** _x* _*_|*| _** |_|x|x_| x x*_ *x* *|x*|x*|x_ *|__x|x |_| *||*| * |_x_|xx _*x*_xx |x| *_*x| *x_*_| ||**_ *||__ |_x _ |*x __ * | |x_*x _* *x| |x||*_|||xx x * |||x x*x| xx_|*x|___ *_|x_ ||x_|xx*| x*_**x|*|*_ _x*xx||_ || ***_xx__***x|__x_x* **_xxx *xx_ x ||x|* *|_x x|||*x_|*|*|x__ |*_xx |x_| _|*_x|x_x*_xxx*x* |*x*|_|||_| _*|x__x|*x||||*_*x__x**xx _|__**_x|||_ ** x_|_| _** _ x*x|_ x *_xxx_||_ x|x*_ _||*|||_|x*|x| _|_ _|x_x _ |_|_* |*_xx _|_x**__|x |__ **_** _**|| x* |*|x*_x**_x|xxx_|||__|*x|_| _* |x_*|**x|| ***| | |* x| *_| _ |_|*|| **_x *||x*x _|x *|_ *_x |___ xx_xx_||x|x* _| x**x*|** || _| | __||_* _|_ |_ * |*_* _ _*||** *** |x*__*||x| _*|| *_ x|*_** _ x*_x*x_x|*_* __*|x|| x__||| |__x_ *_* _*x|x*x x_x |* x__* x* x *|x_**__x |x|x*x||xx _|* *xx | __*_*_x*x||*x_*x*_**|* _|*||x__| x_x | x_|x_ * ||* ||* *|x* *_ __*| _ x*|**_x *_*_|||*| _**__ * _* |_ _*_xxx x*__ _*|_*x|_xx*__ |x | ||| __|*__x_ *_x* ** ||x|*|x*|x|*xxx|_* xx ||xx||_*_|_ |*_ |*xxx__x*x**x|x_|| *x|x|| ** x* _**|| *x**_x|*_|*_*||x*|_ *x_ * * * _x|x xx|_|__* *x|_*||* _ |* _x_|___* ||*||*__ _|_ _ **|_* |*|x_*_| | *x **||* _x _xxx xx||_* __|* x_x_***x_| |* *|x* **||_|_x*__x _|_|**_ *___x _|*__x* x| x x x||||_ xx **x_x_ |x *x |* x** _ x|_|* |__| x*x|*|*x*|_x___|x_ x|*|_*_x_|||x| ___ ||_ x* |x |_||_x_ _**_ ** __x _ _x|x__ | _ |x|*x_*_*|_|*_*|*_ _*__x|x** _|||_ *_x* |_** _xx*x_**_|x|x | | | |x_ |||x_ _|___x ** *x|x xx_ x| |_ | |_*x|*x|x*x *x* ||*|x* x|| | * x_ _*|__| xx_ *_*x* *_|_*||_*xxx_x|| *_xx|x _*|__**_ x|x*x*_| ||xx* x _**x_*_x|| ||*|_|_ x || _ |xx| *|||x__xx*_| |** _||x_x*xxxx_| **|__|_ x| _ _ x _**xx|_ |* __|x_xx*|*|*|*_*_x|xxx_|xx _** ||**x* *_x**|x||** __| *_ _ |xxx|xx_ x____* |_ | **|* x__x|_x_ xx_ x x_|*|xx|xx|_ *** x*x_| x_ xx_ x _ _*x_|| *| x| _| __**|_xx_ x*__*x|___*_*x_*x*_x ***||*x_x*x|*_| x|*_*x|||___* __x||xxxxxx|_xx*x_|_|_ _| *xx|*_x||x_x*|x||__|xx |x**|*| ______x_x|**xx_||| **x||xx_*_ _* xx*x ||_|_|**||||xx_x_x|_||*| *xxx*__x*** *xx|x**x_*x_|x| _ _xx***x*x |_xxx _* _ x*|_xx*|**xx|_x*|_x_**x*|||* x___|* _ * x x||__ xx|**| x|x|*|_x*x__|*x||_|* __x*|_ _x**xx|*|*||x|xxx*|_* x *x_*_xx|x| |_*_|*x|x_| **x* *|_|**xx__ _| **_ x * x *x* __* |||_|*|*__*_|x_||_*_x_ x_ _xx|_xx _*_||* _ _*_ |*|*|** xx|x**x||x_ x* x* |*|__ x *|*| ||xx|*__x* _ |__| || x||*|_ * |*x*_**x x* _*_xx *_ |* _*xx *x* |x|| x_ ___x * **x|__| x_|_ _*x||* x__*x***_|_* x___|_| __x_ _ || x |_|__ x **xx|| *_|___**x__ x|_**** *x |x** * ** x__ |_ |_x|x|**|_|xx *xx_x*x | *x_xx ***||___|||x|xx|_*** |*|x |x**x|_||_ x* x|_*_*|x_ _ x_*_*xx|xxx **|*x ||_|x*_||x_* _ *____* |_x_ * * * |x*||_***__ *|_* _ x ___ |_x__x x x_* |||* _* *_ xx_| |*|_xx*_*___ *| _ |_* x*x | ** __xx|x *_ x _* _x xx*| *x*x*xx** |x _*| *_x _**x|x x_*|x | *x*_x|*_x*|x_*xx|x x*x*_ * _*|x* x_ x | * x|*|_ _x| *|__** *|__ __xx*_ x_xx* |_ * |*_ xx* x|x_|_xx*|x *||_ __|| * *x _|_|x*xx***||| *|| x|_*|* *_| |*|_x* _xx|*x|x|*x | |x_x_|*_|_*_*_||__xx| *|xx _|* *_xx_* |*_|*|*_| |*|** _ _| _***x|* x || * xx *x * _xxx*_x*| _* _|x xxx|x _ | |*|_x|_xxx |** |x| __ x**x_|x|**xx _* *x_x*x *_|x x _x_||__** xx_xxx* ||x___**x_ _x x*_ _* x _x| _|xx|_ _x| x | *__x|*| _*x*_|x || xx x_ *_*| x |_*|** x * _xx|**x |*x x | x||*|**___x_|x ||** _|x* *| _*||x|| _****_**_x*|||_ |_||* *x_xx|x*__|x |x|* *_ |*_ x*_x|_ _x_*x|_ x|__x || * _||_ *xx * _xx|x|_| |*|_x x _ |x |**_|*|| *|x *|xx_* xx_| |xx **_| |_|_ |___*|x*x*_x||xx_*x _x** ||x||*_|x * x__*|x|| || |xx_x x__x| _x x_x|*_*_||_ x || *|*x|*|x| ____x|x| *xx* x|x|xx| |_| |** *_|_*||_** *| **| xx| _x* _*__ |xx|_* xxx__*x_* __*xxx *||___x***__x| _ x*_ |_ *__*_**| x*xx_x_|*| |_|*xxx_*_**_ x||| | | _ *_ _*||x _|xx| | x* |_*||_* *_| _*|* x*x|_x*|__* x_x| _x* *||xx __ | x* |x_| * *_x x x _|_* x|*x*xxx |*** |x _ xx*|_ |_||x_|*****|__*_*_*_x_|||*_ x_** x_| xx|| | *x_||*** *_ _ | **_*x*_x| xx| ||x|*** __x|||_* xx__||__ xx x*|xxx _*___|*__*|** |_x*xx | _|_|||x*|__*___x* x*x**_xx _x_*|_ |x_x_**_ *| *_x|*| ___|x x|*__x*_x* _x|_|x|x*|x |_ |x_|* * |__||_|*_x_*_ |_*__ _*xxxx_ xxx_*||_| __|**x_ *||* **_*x|*_xxx* *___ ||**|_xxxxx||**||_x_| * | _|_x*x| *x*|_*_xxx*x |*x_|_ |x*|__**__** | ||_x*x|*_ xx*|*_ *x|x *** *x* _|| _|_|x *|_*_x__ __|||*_|_ __x| | _||| **_x**_ x _|_*x* **x _*xx *__*| x * __* x x__*xx**_ * _*_*x*||_ x_xx*x_||xxxx|x_ * *x_ |__* ** |x*x*x*x_xx_x|_*__ |*_|xxx|* _*||x*_*_ ___x_|* _x_ | |*| |**_ ***|x|*xx* _* __*|*x_x**_ _xx_|x*xx* ___*||||_ *x* _|*_ *_*__ *_* _xx| *|x|*x|x _ * _* xx ** _ * **_ _ *___ x* _ *x *x _*x** x| _*| *|x*x |_x | || x x *_ _*** |_ *_| __*_||*|_x||x* ||__| *|| ** *__||*|x_x _*||**_| *x| _ __ **__*_ *_| __*_ x _ |_ |*x ||** |** _|*|__ *___* |x*|x *_* __ x |* ___*_**** |x* __x ||**x__ x |x|||* x|x_x_|||** _*xx*|_ _ x*|_*__** |x||_xx x| x|*** _|xx*_ __*_ _|x__x|_* _***x|_x* *_|_x*|x_ xx__ ||_ *|_|_xxx|x _ _*_x|x_ * _*x* x*xx* * ||x**_ _ _||x_|___||_x|x*_||_x _|**| *| x**_||_||||_|**x x| _||_x*| _*__|_ x ||__xx ||xx|x* * xx**_*_xx*x|_*_*x *|_||x|*xx_ * x|_xxxxx_x|_*x*x*x|**| _|*x| x*|_|**||**_| x**x_x|xx_|| xx|*||||_x_* x| ____ ||*_x*xx x_ * x_|| _ ||*x * _*_||_x_x__* x|_x|x_|x * _xx*|x_x* x**_|xx__ *x*x*_ x||_*x _**||x*__|x * |_ *xxx|x|x _x_* _|||__ _xx** |_ x*x* x_x_|x|* _ ** __ __||_x_ *_| x x||x _ | ||* _x_*_ x *x_x|x*_*_x |x_ _*x_*_xx_*_x_** || x_ || xx * *__x**|x_*x | * _||x* xx**_ __ |x _ x_|*xx* xxx_*|_*xx_ ** x_x* *x *x_| || * * x| *_*x x * _|_ *x_xx||_* _*_ _ |*xxx_*x|*|__x*|* |x|x_ | _x_*__ x x*_|__ ||* |_ x|x||x|*_x*|*_| x_*|_**_ _x |_|x**__x* * **_**||**** _ | __|||_|* xxxxxx_**| x* *|**|x x_x|_*| **__xxx|* *_x|x|**x_ xxxx *x_|xx***** xx __|_x_x | |___| *x**** _ *x*|xx___x** |||__x|_x|x|_ *|* _||_ _xx x * _* |x_|| __**|__*x *||x|x||*__|_| |||_ _**xx_x ** xx*x|**_| * |x|_ _*__xxx|*_|_xx*x*x *___x| |* x|_* **|_**|*__xx x_|x*x x_**__|xxx*xx _xx**xx**| ||||xx x_x_*x|_ _x*x*__|xx_x* x*** _*_ |x |*x_||*| |_||_| x_*_x| _* |xx|x|_x**|*|* *_x_|* *xx*|*| ||*|*| x___ *__ x*_| xx *__* x|_|x* x x| |* |__*xxxx_xx_x *_*_*|*x_x_| * _ |x _**__| |* _*|__x_x_* xx |_x__ |x*x*x * _| x_***_*|*xxx |x*|xx_|_x||* x|*|x|x **__*||_* | *|*xx _* _x_|| |*x_x_x xx_| x|*_ __||__xxx_ _ |* x* x||_*| *_**_*||_ x|_x* *|*||**x*_x| *_|* **_*|x* _*x||x||**_x* _*_||_xx| |*_xx* _*|xx_*xx xx|_*x_x_*_ _ _|_x||*|__||*x * |_x||***_x**_** _*_x x||* _|**|__ ___*|__ |xx |_ x| x_x**|x_x x|x|_|x** |*_x|*_*xx **|x|*x__ xx_x|**_x* **x** *|| |x *x__ x_||*_ |x| __*|*|x x *___|**x*x * ||_ |*xx_* _x |x*_|_xx_|**x* |*| |_xx_ *_** xxx*|*x || xx *|x*| |x|* __*|xx_ x_xx*|x| |xx |x|__x*x_ xx _*x x||_*_x_|x*| _x_**|x*||** *_ x* *|*x**x ____**|x*x||*x__*****|* *|x| _ _*__x*_ __*| *|*_x*_xx xxxx_x**| |_|x _*| * *x**|*x * _x_ |_x * xxx| _*_|_ |_***__x* ||x|_| |*__xx|x x|||_*||**x | ** ||| x*__x_xx * __|*||| __**** xxx|x* x|_ __*_**| *_xx*x|x_*_x_ |x *|* xx*x x_ * |_|_x|****| *|xx_ *|x|*|*|x_ |* x_xxx xx_|xx| *|xx||xxxx**|_*xx_ |x*|*_x||x_x*x*x *_ _ x*|x _x**_||xxx x *|_|_* * _* x*|x|_*_ *_ __* _*x|_|_x*_|*x*x *x|__*_| xx|_ *xx*_ * | * x|x_*xxx* * _ ** x|*xx_|_|_| xx __** * _ *|*| |___xx||*x * x*x| ||_x___|x |xxxxx*|x||*__|* | || |* x_**_ | x **|_*__ _ __x | x| |xx|_ |x _| _|__*x**x||*___|**_|* _xx__* |x|||x____x_ _ ** xx* |_x||** _|**|*_ |* x *x_ |**_|__||x|* *|x_** _|x|x _||_* x**|__*|*_x|_|__| _ x*_|x___xxx|_ _*_*_x*|___xx x|_x|| *x _*x _* _x*x_|* |*__x| |_ *|_*_x |x|x|x _** |_ x_* x |_|_x|| x_ _ ***x**_* _|x_ *| x _** x_x**| x |*_|x_ _*| x****_*x|x |**|xx**x x |*xx*x*xx|_ _*_* *** _*_x* |_ _x_****||__x__*__| x_* * _*_ _ _*_x xxxxx_ |_x *|_*x|xx _ _|_||_*||__*x_|__ xxx_x *xx *|_* *|***|*_|_ * *_*x*_xxx*x||**|x* x|_ x | _x|_*|x* |**xx|*x _|_x x x_*xx |*|_ |||x||x xxx**x|** x____*| |*|_xx*****|x _| *x_ **_* x*_x__x*x|*x _*_ **_**xxx *_*|** _| *_*x____|x x|_ *||_ _*_| _x||x_x || _*_|xx_x|_|| |* || _x__*| *x|* _|x*xx____x** |_|xxx_ *_||_ **|_ x*|xxx*_** |*xx|* *_*xx
+ + \ No newline at end of file diff --git a/code_base/bgs/1_files/blizard.js b/code_base/bgs/1_files/blizard.js new file mode 100644 index 0000000..97305a1 --- /dev/null +++ b/code_base/bgs/1_files/blizard.js @@ -0,0 +1,148 @@ +//blizard.js version 0.5.1 BETA by Rohan Samra-O'Neill +/* +uses the atomo.css library created by Rohan Samra-O'Neill +*/ +"use strict"; +//inspired by jquery and p5.js :), thanks to p5.js and the processing team for featuring blizard.js on there site +var sl = {}; +var id; +var storage; +//just a little message to anyone who goes onto a website that uses blizard.js +console.info("This project uses blizard.js for more info go to https://github.com/Slitherlizard/blizard.js"); +//with sl.ready the parameter is the function that will run when the page is loaded, i needed to add this in version 0.4 because it's a DOM library and functions wheren't working because the elements couldn't be found because they werent loaded yet +sl.ready = function(sel) { + window.onload = function() { + // basically just runs whatever function that the selector is equal to + window.setTimeout(sel, 0); + } + + +} +//with sl.print the first parameter is the id of the element you want to change the second is the text you want to change it to +sl.print = function (sel, txt) { + + + document.getElementById(sel).innerHTML = txt; + +}; +//with sl.hide the parameter is the id of the element you want to hide +sl.hide = function (sel) { + id = document.getElementById(sel); + id.style.display = "none"; + }; + //with sl.show the parameter is the id of the element you want to show + sl.show = function (sel) { + id = document.getElementById(sel); + id.style.display = "block"; + }; + //with sl.col the first parameter is the id of the element you want to change the color of, the second parameter is the color you want to change it to + sl.col = function(sel, col) { + document.getElementById(sel).style.color = col; + } + //with sl.family the first parameter is the id of the element you want to change the font-family of, the second parameter is the font family you want to change it to + sl.family = function(sel, sel2) { + document.getElementById(sel).style.fontFamily = sel2; + } + //with sl.size the first parameter is the id of the element you want to change the size of, the second parameter is the size you want to change it to these are the sizes you can use +/* +xx-small +x-small +small +medium +large +x-large +xx-large +smaller +larger +*/ + +sl.size = function(sel, sel2) { + document.getElementById(sel).style.fontSize = sel2; +} +//with sl.wait the first parameter is where you call the function you want to run, the second parameter is the amount of milliseconds you want towait to call that function +sl.wait = function(sel, sel2) { + window.setTimeout(sel, sel2); + +} + +// with sl.setlocalstorage the first parameter is the name of your localstorge item so that you can refer to it later, the second parameter is the value of your item. +sl.setlocalstorage = function(sel, sel2) { + localStorage.setItem(sel, sel2); +} +// with sl.printlocalstorage the first parameter is the name of the localstorge item you want to print the value of, the second parameter is the id of the element you want to print the item's value to. + +sl.printlocalstorage = function(sel, sel2) { + + + + + document.getElementById(sel).innerHTML = localStorage.getItem(sel2); + +} +// with sl.click the first parameter is the id of the element you want to add an onclick attribute to, the second parameter is the function that will be ran when that element gets clicked +sl.click = function(sel, sel2) { +document.getElementById(sel).onclick = function() { window.setTimeout(sel2, 0); }; +} +// with sl.id the first parameter is the id of the element you want to change the id of, the second parameter is the new id of that element +sl.id = function(sel, sel1) { + document.getElementById(sel).id = sel1; +} +//from line 92 - 124 i think i liked inporting other librarys too much +//just loads the atomo.css library for styles +sl.atomo = function () { + var head = document.getElementsByTagName('HEAD')[0]; + + // Create new link Element + var link = document.createElement('link'); + + // set the attributes for link element + link.rel = 'stylesheet'; + + link.type = 'text/css'; + //load atomo.css library + link.href = "http://atomo.ueuo.com/atomo.css"; + + // Append link element to HTML head + head.appendChild(link); +} +/*sl.import does not work yet :( + +sl.import = function(sel) { + var head = document.getElementsByTagName('HEAD')[0]; + + // Create new link Element + var link = document.createElement('link'); + + // set the attributes for link element + link.rel = 'stylesheet'; + + link.type = 'text/css'; + + link.href = sel; + + // Append link element to HTML head + head.appendChild(link); +} +*/ + +//I have wanted to add this since version 0.0.1 but didn't know how but now i do know how so i'll add it. + +//with sl.createElement() the first parameteris the element you want to create like P be sure to wright it in capital letters and the second parameter is the element you want to append it to the third parameter is the id you would like to give that element +sl.createElement = function (sel, sel1, sel2) { + var father = document.getElementsByTagName(sel1)[0]; + + // Create new Element + var elem = document.createElement(sel); +//give the element an id + elem.id = sel2; + + + + // Append link element to HTML head + father.appendChild(elem); +} +sl.changeBackgroundColor = function(sel, sel1) { + document.getElementById(sel).style.backgroundColor = sel1; +} + + diff --git a/code_base/bgs/2.html b/code_base/bgs/2.html new file mode 100644 index 0000000..1c3290e --- /dev/null +++ b/code_base/bgs/2.html @@ -0,0 +1,58 @@ + + + + + + + 01 + + + + + + + +
|_ |___*_|xx|*_|| *__ |_ _ |xx x|*x|* *_|* *||x|_x_ __||*| x x_|| |x||x_* _** x*x_**_xx* x*_|*_|_ * |** _|*_ * * _x_|** x x*x|x| |* _** _*** x * | *_ * |_|x|*** * ||*|*_x__|_ x _ |xx_ | ****|| __xx___||*_*_ x |x|_*_| ||* __| | _**x *|__* _*x |xx_|***_|*x**_x*_x**_|_*||_ x_|__*x_*|*_**__||xxx||* x__***_ * xx_xx|*x* x*x*|_xx* *__ x**_||* _x|**_** x| *|**__* xxx_x *_|* *__ *| ||xx*| xxx| _*|*x** _ xx*x_|| |_|_ **x*| x* *_***_*||_|x|_x* _x|| |**|x_***| _||_x*_xxx__x ** x_ *|x| x | | |x *_x x**xx* | |___ *|*x |x ** x |*|**_ x|x**|_xx x|_xx_|_x_x*x_| |_xx_x*|*_*x|*|x*x_|x||x|| *_| ||_x_ xx|_*||__|_|_x**_ *_ |_|||_| *|_ x_ x||x|_|_xxxxx_*x_ |_ *|_ |_| *x_* |__x| x_* | ||*x|x|*__ *x_x*** |* _|*|*x___*|**x*|x*| x*x xx_x_ |_*__*_|* x* _x| **_*| *x** xx|x *_|* |*|| xxx *_* _|_ |*|| *_**x_ x_xx*_|_|x_|_ |_ _*_*xx*_x_||x|*xx x|x_ xx x* | x|x**_ **x**_|| _*x_|_*|_*|x_||x*xx _|||_ *x__x_ *||*_*__** _|** _x_|_ _*x_ |_*| | x||x x _*| |x _|* **x|x x |x *__|__x |_ _ ||* *_*x *|_ _|x| |*| _x* xx_|x*_|_*||_||____|__ _*| x___** x_ * x_x|x| *x x_ _||x __*x _* ||xx|_||*x x_x|_ _*x*_x*_*xx |** |_ *_x** ___*||x_xx |*__x x_*__x|_x __||___| |_ __ x| ||| x*|*_*|* _ _* x|*|xx* x*|_| x*|_ x ****x**|x|__| *|x_| x |x _ | _*x_|*_||_ _xx|_x* *_x*x|x* | x *_x__ |*||| _| |** |__||*|*__ |*_* | ***__x ____ x||_ *|*|x|| |*|| |x*xx_**|x x |x|*|*_*||*x|||*x|**x||*_|*|_x _||x*_|| |x*x_** **x*|x_|*x_*_x| _ __|_x|_ *xx|*|*x_ _xx x|*x*|*__|x__x |*x* x_||||_ x|_xxx|x||*xx_ x| *xx| xx* x|_ x |**xxx*x_ _ |xx ||||* | *|*_x *_| __||_ *| ||_*_ __xx*_||x x|_ * * x*xx_ ||_|xx*| x*x* _*||*|*xx*_x|_|x** *||||x x _|_||__|***x**|| _|x_|_||x* |x* _ |*_*|_||**__*x| |*__*x|*|* * _* *x__x _*xxx|**x _|*** _|* | _ |x*__|_ _xx *|*|x __x xxx*|* *|xx_|x_*x|_x||x_ | *|_|x x* _|_x||x***x|_ x x _x_x| * |||_* *_x|* xx_|x x|x xx _**xxx| *_x *x _*_|*x||x*___x_xxx* x|*xx*_| *|_x_***xx||| |x __xx |** x_x_ x* __|*x_x*_|xx x_*_ x *|*_*xxx| *_*|*x_*|__ x |* _| ***|*_xx_|_|| _x **_ *|* *x_ *x| | |_ |_*x|*_x|*_*|*|_*x *___*|_*x *_x_*__ |x*x__| x|_xx_xxx_x* _*x _ _*x_ *xx_x_ *x |_|| _ |x|_*||x|**|x* x|_|_|_*|_*|*x_*x*xx_** *| *_*|_ x_* *| xxx_ |___|x| | xxx*x___x*|___| xxx|*x|** |_| | x|*| xxxx|*| x*| __ _||| *|x xx***x_x_| |x* _|*_x x*___x|||*|| | x *x xx ** _****__ *||_x__x *x|*x*||||**_ __* *_ xx_*xxxx* _* | _*_ **_|__| x_|*_*|x x _| *_ _| *|x |* **xx __ |_xx * |*_ _x*_x * _**_||**x_*|||_ ___|x ** ||_xx_|*xx**||***__* |x *x*x *xx_x||x_*****_|*x_ _||*| |xx *xx||x_x __x|x_*_x x_*x *| _ _x*| |x|||**x_|| _ x x___|* ||*| |_x _x** |*_ | x|_|* * | |x_x ||_ x*|_ *| __ x ****|_ *|x_|x__*x ___*|_*x * *xx |*| * x _|*|_xx_x _x *_ || *____||__****_xx* _|__ x___x _***|x |_*|| |x|xxx|_|***x_ **_*_|__|_ |_*|_x*_x*__*x|**_ _*_xx||xx |__ _| _|x __xxx*x*| * _|| x |x* |* |x_| | _ _*** x x x| |_x||__|| x||x xxxx *_** |_| x* **xx|_x||x x | x__x*|**|xx_|| * |xxx|_ __| x x| x| _x**|_ _x *_ * xx*| * _ * **_***x|* |* *|__x _ |*| *x ||**_x* ||___ ||_|x|_*x ||| |_ *|**|_ _*_* *x_*x_ |x **||| * x__** x*x_ |__* x_ | ** __xx_|*x* *|_x*xx *|__ x __|_ _xx___ |_xxx|*x_x x** _xx|__|_*_*x x_|xx**|*x*| x|**x | x_xx___*x _*_|*_x| |x* x **xx** x*** x||_ _x*** x_xx**_ _*x*_xx |_*xx|*_*x|x x*|_x x_ * |*__* ___*x*x*_||xxx _* |x _x x_*xx| _*x _| _x| __*_* __*_| xx x||*xx|**_ x* _|*x|*||x|_x _| * __x _ _|**||| _*_ |___| || x_*|_*|x|x x_x_xx___|x*x_|x||| |_ xxx|**_x*|x|x_x*_|x | x _| | *_*_x__x_x xx*|*_ _*_|x _x__x_xxx*__x || ||| |_xx_| |_*xx| |_x|| |x|* __x_x _ x_*_*| xx*x|xx|*_||_* | __x |*|x*|x|* x_** _ |_| x*| *|_||*|___|_ |||_|__*x_*_||x*_||x_ _**_ *x_|*x_x_|**| __|* x |xx*| *xx ** x*| ||xx*_| _x |*xx|x x ** x _|_||xxx_x_ xxx_|| _||* | xx_ * ****x|x_* xx |x _x|___ *_ _| | | |x _|*__* | *|_*_x*x|_| x* |___|_*| x *||x __| *x __x * x||x** x__|x x||x _** *_|__|*|||*|x||x_* |xxx|_*| *x_x*x* x_ ____|_*x| |* x|xx |_*x *||_ x x_|| | _*x|_x**_ *__xx*||_|||x__x*|x| || | _*| ****|*__**|xx_||||_ |x__*_*x*x_ xx**| x x****_ *|x**|x__** _|xxx||x x_|_|x_* x_* *_|**|x_ x*x_||*_x _ x_xxx_ ***** |**_ x_*xx*|x|_x*_| _x_|*x__|*_|| |_ _xxx x|*_* ___|_|xxx*_|*x *x| _x*|_ xx****|_x*x ||__|x_x_|x_x*||x_* _ _x |*|_|*_* x_ *__x_|__*xx ****_ *|x | ||_|*_x_ _** | __ | | |*_|xx* x__||_|x_x ||| |_x|_ |x __x| x_ |*_ |||_x_|xx_*|*| ||__*** *****__ x|_ xx|_| |x _ *x* | |*__ * _|*x|_x| __* |x| *| x*_ | **_* *| _* ||*xx*_x_||x*x xx *x_x*xx|x _ _|*_ ||*x |xx__x*_ * * x*_ **|x x|||x |_x|x*|* xx ***x___ |x*_**|* | _x *x|*|*x| |___ ||** | || _*x*|*| |x *|||_ |x_ ** | |x _*|__ x___ *_ _|*_ x****|x_*x x_*x _*x |x_** |*___| |*xx|__x x __||**_*|_ **x_***|x_ **|_ ||||xx__* |***| x_x| xx ***x_x _* *||| _ _*|*x|x** *| _|_|*x* x ___|xx_x|_x||_ x| | _*||__x _|x_ _||*x__ _| _x_|* **____ |*__ __ _|x | *| |_x|_x*|| _x x*x_x** * x *x *x*_*x|* | |_xxx__|**|x|_*|* || ** xx_|x|||* _x*|*x|**_ || x|x| | | |*|___x* x |* |x|x *x _*_ __**| *_|| * x|| |__*_|*x** x| ___ xx x**|*_*__|*__ _|**__ *|*x *| **|__*| x |_|x *xx_*xx*x|x_* x x_*x**x|x|__|_x** x||___*** __xxx|_**|*|_**_xx_| _|xx*x___* *x* x_|__*| *_ *|||* *xx___*__*x*x _|* |* x_|xx_ |x| | ___*x_x|*x|_*|_*__* x|*_xx |*|*_x| ||* x **** * xx||**| x*x || *xx**_x*||xx*xx*|_*|__x*|xx|_x| x__*_ |_ _*|_ *||x_ *|x|x* _xx x || _* |x*_ _||xx|**_x__*x_xxx**_*_| _ *_x* x*|x_ |x *_| *||_xx*|_ x|*x_*||** x_|x| *x|*| __ * x x _ * _ ***| | *|| ** xx _|*| *|x**x|x__ |x||* x| * |*_| x|x* _*_|_|_ |* x| _x _*||*_ *_x x_xxx* *_*||*_x_*_ _______* *xx x *x | _|**_|_*x*|_x_*_ **|x**_ |*|*_|_ |x* *_ *| |*x__ *_ **__| x_x___**x||x|_* x___x |x _**x_x**___*x *|* *| *_* _|xx__x||** | | |x__|| *x**x_*| *** x|x _ _*_*|_*_x*__x_** *** |x|*__ _|_ *_x| * *__xx | |*|x|*_ x_x_*x |**_x*x| *_x__x_*_| _ *_ *||| x * _x|_|xx* *| _* *_***x xx _*_*_*x*_*|_||*_ _*||*|x_ |x| xx * _|*_|* x |x x|*_ xx |*x| **|| | _ x |_|x x*x__| _*|__x*|x|*x x|*_| ||||_x**_|| *_||_x*_x__| ||x x_x__| | * xxx|| * x ___||* _**_*_|*_|_ | x__| x|_x_*|_*| x |x _ ** _* _ *x*x **|__*|_**_ _| *|*x |_|_x*xx*xx | x*x _x _x *|x_*xx _|_ _ |**_||__| _ x* * x* |_||_| *|||_xx * **| |_*x|_*||_*||| | *x|x x*x *x x_**_*|x___|_*| x__* x_* x |_x||| _x||x | _***|_ x *x x x|xx| x* *_*x_||_|xx __*x| |x***x_x|*| _x __ x| **|*xx|x*_* _ _x**|_** x ** ***| x|*x*__ x_|||| | x_|||xx*_*_xx__ _* | _ *_*| x|x___ _x *_x |_**_x x| _* _||_*|_x *x_xx**x__x|x__ xxx _ _ | x||| __*|_**_*x_||x*|*x|_ x* __ | ****| _*_| _**| xx_* _ x_x*_x _||**_| |___| |_x _ x*|x| xx |x|__* _xx*xxx__|_|x| _** *__x*xx*__**|_x*x_ |x *|x |_x _ x *_ _*x _* x x_x* _xx| ||_ _ x|x| _xx|x *_x_ __xx|*_||* _||| |* x|_** xx|** |____*x|xxx |x_x _|xx*x_|| |** *x _x| *|*_*x_**x |*x|_x|*|_ x| _ || _x| |xxx||_x ***|_|_|x x |*|**x__ x_*__|x|**|_||_x || xx xx* || x_x_xx_x |x|_|* xxx*|_|* *_|*|_*x* x |*x*|xxxx* _*_x xx *** x| x_|__x_ |||_ |x__x_*| x|xx_ _| | *x||x*_*|* |_x | _*x_x*xx|*|* |*| * x* |*| _x_* x_ ||_|||_xx|* ||*||x |||xx * *|x*****_|xx*_| | *****x *x||_ | ||_x| |||x x __ ***x|xxx_ xx_*** * *||x* __|| |* x * |*xx |**_ x|_| |_|*x *_|**_*x*|*_|* x_x *_*|x___***|*_|x_x x|__ x |*| x _ ||x*__ x x*|xx_ x__ *x||*| xx**__x|__*_***x x_| |x __*_ *x |* ||* x**|x|*_ *xx**x|*|*__x* _|||_ __x ||**|_*|*x ||__x|*x_*|x||___x|_* x_*_|||x* |* |_| **|_ x* x*|_*| *_ x||xx|x|_||_ x ___x __* _ |*x|_*x_*| | *x* _*_ |x* x __*| x* x _x_|x|x | _||*x _|* ||x_*|**|x_*__ | __* _| **|*| * *| *| _|_*xx x_ * |* x_ * x_ *x* _x|_x _ |x|| |x x|x|x_||||*|_x|x|x|_*|_x x _*_|*_*x**x**_x *** ** x* * _||xx** xx*_x|__*__x x|x*xx_|_x|*_ _x|* xx x|_|x _|_*___x*|*|x*| |* x|* _x_*x_ * | x ||*_x _ _| x|_||*__||__ **_*x_ |*_ |x*| |x|x_|*xx|x ||x |*x*x _ _ |*_|x*_*|_||* __xx*|||xxx*|_*x_*x_x_ |x *_x*xx_*| ___ |xx**_|||_x_ * _** x|** *x_*xx *|| * *__x *xxx| xx|x_xx____ x|x|xx|_x * x x_ xx**xx_|*||*_x*xx | _||_*|_x_ ||_*|_|x _*_|||*_xx_ _|*x* __x **__| x||x|*||xx_ x __x*_*|xx**x| || x*|** |_ *|x|_| |||** |x|xxx||xxxxx *x__ x*** * |*|x *_** __ |||_ *x ||x_* _*xx || |x x*_x|* _|**x__||** |_** _|*| x_** _x_** |x_x_ ||x*x**_ __* ||*| x_|* x|*_x *_| *| _x_|*||_ __*_|_ x_*_* _xxxx _x x_*|x|_* _*xx_* |xx|*x_ _ _|xxxx|_xx_ *|*x||__ * _xxx__|*x_|_**|** x*x _|x__xx_x|x__x*__*|x _|*| ** x| |_ *x*__|_ x* _*_*| | x_ *_x _ ||* x |x|_*_*_* _* ___ x_x|x_*_x|x*_*__ xx_x*_*** x*x*_ xx**|_**x|x|xx __x**x* |x_*|*_*x x*_x*_*| |xx __ _*_|x*x|x*x_|*x_| **|_xx|x_|_|||xx xx*x**|_|_*|x|| |*_xxx_||xx_*|___x_x x* x||x | * _x*|*** _||*| * _*xx| * _|x* x|x|*| x *x*x_ x*_|_* *x*_| |xx||_|x*x|**x* |x*|_ * *_* _*x**x*|| *x x| *x|* |x|x x*x|* *||| **** **xx| |_*||||x *x|__ |*x|*x*_ xx_x**x** __* |__*_x_* *x|_ _*_| _| * _*__*|*|* |* _*__|_x|*****x_xx x*| _ | | x_|x_x|* _xx x||xx|x|x_ *x |x |_|_ |x|x |__| * xxxx*x |_x |_ ||_x *x |x |*|_x xx| x _||| **| _|x*|x *_ ** *| |_*|_x_*| *x |_ _ x_| | *x|* x_|* x x**_____**xx*__xx*x_ x|*** *| _*x* x _****|__ x|*x_||_ |*| x * | x** ***_ ** _ |x*_|x* xx|**|* |x|*x |_ _**| xx xxx* _*|*x*|
+ + \ No newline at end of file diff --git a/code_base/bgs/2_files/blizard.js b/code_base/bgs/2_files/blizard.js new file mode 100644 index 0000000..97305a1 --- /dev/null +++ b/code_base/bgs/2_files/blizard.js @@ -0,0 +1,148 @@ +//blizard.js version 0.5.1 BETA by Rohan Samra-O'Neill +/* +uses the atomo.css library created by Rohan Samra-O'Neill +*/ +"use strict"; +//inspired by jquery and p5.js :), thanks to p5.js and the processing team for featuring blizard.js on there site +var sl = {}; +var id; +var storage; +//just a little message to anyone who goes onto a website that uses blizard.js +console.info("This project uses blizard.js for more info go to https://github.com/Slitherlizard/blizard.js"); +//with sl.ready the parameter is the function that will run when the page is loaded, i needed to add this in version 0.4 because it's a DOM library and functions wheren't working because the elements couldn't be found because they werent loaded yet +sl.ready = function(sel) { + window.onload = function() { + // basically just runs whatever function that the selector is equal to + window.setTimeout(sel, 0); + } + + +} +//with sl.print the first parameter is the id of the element you want to change the second is the text you want to change it to +sl.print = function (sel, txt) { + + + document.getElementById(sel).innerHTML = txt; + +}; +//with sl.hide the parameter is the id of the element you want to hide +sl.hide = function (sel) { + id = document.getElementById(sel); + id.style.display = "none"; + }; + //with sl.show the parameter is the id of the element you want to show + sl.show = function (sel) { + id = document.getElementById(sel); + id.style.display = "block"; + }; + //with sl.col the first parameter is the id of the element you want to change the color of, the second parameter is the color you want to change it to + sl.col = function(sel, col) { + document.getElementById(sel).style.color = col; + } + //with sl.family the first parameter is the id of the element you want to change the font-family of, the second parameter is the font family you want to change it to + sl.family = function(sel, sel2) { + document.getElementById(sel).style.fontFamily = sel2; + } + //with sl.size the first parameter is the id of the element you want to change the size of, the second parameter is the size you want to change it to these are the sizes you can use +/* +xx-small +x-small +small +medium +large +x-large +xx-large +smaller +larger +*/ + +sl.size = function(sel, sel2) { + document.getElementById(sel).style.fontSize = sel2; +} +//with sl.wait the first parameter is where you call the function you want to run, the second parameter is the amount of milliseconds you want towait to call that function +sl.wait = function(sel, sel2) { + window.setTimeout(sel, sel2); + +} + +// with sl.setlocalstorage the first parameter is the name of your localstorge item so that you can refer to it later, the second parameter is the value of your item. +sl.setlocalstorage = function(sel, sel2) { + localStorage.setItem(sel, sel2); +} +// with sl.printlocalstorage the first parameter is the name of the localstorge item you want to print the value of, the second parameter is the id of the element you want to print the item's value to. + +sl.printlocalstorage = function(sel, sel2) { + + + + + document.getElementById(sel).innerHTML = localStorage.getItem(sel2); + +} +// with sl.click the first parameter is the id of the element you want to add an onclick attribute to, the second parameter is the function that will be ran when that element gets clicked +sl.click = function(sel, sel2) { +document.getElementById(sel).onclick = function() { window.setTimeout(sel2, 0); }; +} +// with sl.id the first parameter is the id of the element you want to change the id of, the second parameter is the new id of that element +sl.id = function(sel, sel1) { + document.getElementById(sel).id = sel1; +} +//from line 92 - 124 i think i liked inporting other librarys too much +//just loads the atomo.css library for styles +sl.atomo = function () { + var head = document.getElementsByTagName('HEAD')[0]; + + // Create new link Element + var link = document.createElement('link'); + + // set the attributes for link element + link.rel = 'stylesheet'; + + link.type = 'text/css'; + //load atomo.css library + link.href = "http://atomo.ueuo.com/atomo.css"; + + // Append link element to HTML head + head.appendChild(link); +} +/*sl.import does not work yet :( + +sl.import = function(sel) { + var head = document.getElementsByTagName('HEAD')[0]; + + // Create new link Element + var link = document.createElement('link'); + + // set the attributes for link element + link.rel = 'stylesheet'; + + link.type = 'text/css'; + + link.href = sel; + + // Append link element to HTML head + head.appendChild(link); +} +*/ + +//I have wanted to add this since version 0.0.1 but didn't know how but now i do know how so i'll add it. + +//with sl.createElement() the first parameteris the element you want to create like P be sure to wright it in capital letters and the second parameter is the element you want to append it to the third parameter is the id you would like to give that element +sl.createElement = function (sel, sel1, sel2) { + var father = document.getElementsByTagName(sel1)[0]; + + // Create new Element + var elem = document.createElement(sel); +//give the element an id + elem.id = sel2; + + + + // Append link element to HTML head + father.appendChild(elem); +} +sl.changeBackgroundColor = function(sel, sel1) { + document.getElementById(sel).style.backgroundColor = sel1; +} + + diff --git a/code_base/bgs/3.html b/code_base/bgs/3.html new file mode 100644 index 0000000..597c4a4 --- /dev/null +++ b/code_base/bgs/3.html @@ -0,0 +1,58 @@ + + + + + + + 01 + + + + + + + +
*xx*||**|| x x_||*x*x*|||_|x _|_ x_|_||*__*_xx x*x* _x_*x|_*|x x*xx||_||* *||*_|xx___ _ *__|x*__x x_ x*x_ __| x_|* x*xx_x*| *||x| *|*|| |xx|x *_ __x x x||*x**|__| xx|||__|_*_*x**_|*_* |x_ xx| _*x||_|x x* _x xx*|xx|_|_* *x_*_**_x|x |* _**__|_|__x|*x* x x* *||_xx| x___*_ |x*x*_ _*x|_x x* |**x_x_xx ** x| *|_| |x_ |*x_|x _***xxx_|x* x_ *|_* _*x |x**|x *_x|x||_||xx|_x*_*_x _|_x*x| ||_**|_*x |*|xxx x*_|x|xx* |_**| *|_****| |_|x*xxxx_ |*|*_x|x |*x| x|_* | |* |*_|x_ _ |* x|_**|*x_ x*_x x* x*|_ x|* ||x* xxx*_x_x**xx __ *|*| ***_*_x|_x*_|_|_xx *x x*x| x * x|_x| |*_x_* |* *x |_|| |x_|_*_x__*x |_ x||_**x_x| *|x__|x__||| xx*_** *x _*** |_|*x x*|| __x|||_x_x_* | x _|_x|_ xx|_||x__x*__ _ |__ xx* _xx__*_ x_x *_x_|*_ | _ _x |__*|* *| _x__|_ *__|*_*|_ _ _ x * x__*|_| _|_* x *_ * | **|x_* ||| x__*x| x x* | *||__* * ** |****__xx||| ||*x_x|x||*x|*|| x _|* *xx *xxx*x**xxx _xx__**_ x||*_x*x_||xx | |*| x*x*** x x* x*||*|xx_| *x_|x**_|*___ xx*_|xx_ | ___ x__|xx*_*_ _ *| _ ||__ _|x*|| *|||* xxx_ *|* *xx*_xx_ |x*__x*| *||*_x|x _**||x|x|x* _x _x|_x** x_**|xx_x x*|_ x|** *__x_x *_** | *_ | ** x*xx_ *_*|* _*__ *|x|x*_*|*_*|* *_||x*xx_x x**_ x_x| x _| | *|*_x xx*x x**x*** x|x*|x*_x |___**** _|x*x__x*||x||x*__*| xx x****x |*|*__*x_*__ | __ |_ *||| *| *|__||**_| xx | x*x|x||_** * * |*x_x x__ |x *|x_|_x_ *x***x_ x ||_||_*xx||_x x |* x_ x_x|||||_ * *|x| x | | __ xx__x_x _ ||**x* _||x |*_*x |||___* _ *xx **|_ x_* _| _*x*x|*|_*|__**_* x|x| *x___ x |_ x|__ *_ *x* __|_|** xx|| ** |x_ _ |_| x| _x__ x x_x xx ||_x** |**x||x_x_x|x*_ |x|*____|xx_x_ |x| _|xx| x *| * |x *| |**_|x | ***xx| __* xx* x* |_x x|x*|x_xx*|_xxxx|_x_*|x*xxx ||xx*_ | _x*__x_|*x*x|_*|__ _*x*xx_* * * *_x| _xx*x*|* *__| x |**_ x *_ _ x* __||x_* * _x *x* *x_||* **|x_* *_x | * x|x*__ || ** _*|| * _ *x|x __ |_*_* **| *xx*_| |x* x _*x *__* _ x_*****_|| *_|||_||x*__x _|**x* *| x|*|_|*|***|x*x |x x*|**| |x_| *_*|_x|x_ *x|x_|___x| _x__ * x*|x_*_ * |_ |xxxx*_|_** _ | xx_xx _*|x*x x||* x*_ __x|x* |*x|| ___||*___*|x_x xxxxx|*x x*x _|* x*|x|x |**x x_*_ ||_|x |*|*_*_||* ||xx|*xx*_xxx_ *_*| _*xxx__* _ |* x**x||_ ____x _* *x***_x|* |** x* x_|*|_|x|x|||* |* _| xx| *|*x|**|* _|xx|*||x x|*x_xx_xxx |x_x** **x*_* * x*x *x* ***_xx_ _* |x_ x_xx* _* _**_x_ __*|_x__x_x|x * |xxx|*_| x|*xx**x_|_xx_*|x x *__ ||_x _**x__||__x*| xx|*x_x __x| x_|x |*x_*|x|||x_*x|x*x_*xx_**x _*xx |*| x||* *__|*| *__|* |*_*|*|x*xx _x x|_| ___x_| x _*_x* _* _|xx*||_x *_| _ x _x_|_ *_x|xx_**__xx_***xx*x |_*|* x**| || | __*|*_||__*x|_xx x___ |x _*x*x* _ _xx_x*_|_x_ | | *_xx*_*|_**x| x|__* *_ x |_*|x x __|_* **|||*_ __x *x _xx|*|*** x*|* x |_**_ | |xx*_* x_xx**__*__x|x| _xx _ _ |_|_xx__ |_ xx*|| |x_||_x*_ x_*_ __x|x _|*x _x_*_ || *|_ x_|*xx|x__ x|__x|_ || |xx*_|_ __* xxxxxx |_ ||x*_|_ *_|** _ x x* _|*__ *_x__xx*x *|x* _xxx *_ *_ x | ||*x|x***x*x| | _ _**x*x||| **|x|* *xx |_ *| * __x*|*x_|x*_|**x|_**x*| * x**|*x_ | |_ || _ x*x *_**_|x|x**| | || x_|x_ *__ |* x_|_ *x _ * *x**| _ _*|_ xx |*|_x |___|___|*_ **_x|* |__x**_xx _|_ _*|*_|_** x | *_| x * *|x*_xx__*_ | x __|x|__x* |_x_*x*|_ || x|x_ |_x|*xx||**_ **|x*|| ___ _ **x x|*_ x|*_ |*|xx _ *_ ||xx|_|_* x_||*x||x x|__**_|| xx*xx*x |x| *|x_x *x *x| _*|x_| || _ x*|| |*||** _|x*_ x _*_*||_|*_ ___*x**_*x_|_x _**x**x * * * _x|* *____||**x_x*|*|**x * xx ** x *_|x|**|x_ *|*x_*_ |_x_x_xx*____|x||| *_|*||xx _xx |*|xx_ ||*x_*|_| _x*|_x||*_xxxx_|*x_**_* *|_x***_x|*|_* x**xx *x _| *x___ x|x_*x|__ | *x_ _||_*x ___*x|x**_x|_ ||| || x | |x *_x|__ *_|*_| *|_*_x *x** *|x *__*x**|xx*_*xx xx|_ x|** x*|*|* _ x*_*x_**x x_|_ x__x|*| xx* * **_ *x* x__*xxx || x _x _|**_x| xx_*| x_x_x_*___ *|__| || |*x|*| ___||x_*__|*x|* *||x_x**| xx|_*xx|* |_x_** x* xxxx|_x|_ *x__ _ x |_ | _x_|xx__|_||__x_*||* _x_* * |||x_* _x | *xxx xxx |*x*x_ __*|_x|x||x*xxx x|__x*x* ___x |_||_*x|* **_*|_|*__* x _*|x_xx *_ *| _ x*| *| _*_|_*|__|*x_x_| |*x*__ _ ||x_x* *_xx|*||xx x _*_* ||x**|_|x || |x_ |**|xx |x_ |_*|_ | x ** x| _|*|* _||x|_*_ | |_|_ | **x_ |*x|** x ||*__*|| |_**__|* *|| *_ |x_x|__* ___x_ x|x|*|_*|**_ xx|*|*_| _* |_x *xx|x||x_|x__*__ |x*|*x|xx__|*_ _ |*_| _ *x _***x|_|xx*_____*|* __x*x|* *| *_ _*| x_| x_* x _*__||_|x|_|** x || * ||| | *x* x |* x*| x|||*x__ xx | ||_| *_* ||* *_ *x*x xx _*|_ x*|_x _ *| ***x|*|* x | |__*|_|__ x|_*_*|***| |x*x| x*x x _x|_x_x|__ ||* | _|*__ |_*| x **||*x _*| _*|x_|* xx* _ x|x*x **x *|* **x*_*x| _ ||x*x* |xxx_*xxx||_*x_|||x|_ *|**x* _*| * x*_ _x*|_x*x_ *x|_xx*x_ x__ xxxxx _x_x__x_x|_|_ __ _ x |x_*x_*_| || _ ||*x_ |*|x|| |_ ** __xx|*_ _*_** * *_|* _ **x||x*|| |__x| _****x__*x_ |*x||*_x * |xx*_| x_ x_||xx * xx|| *||__ |** |x_*______x *|** *x |xx|| |_ x* _ * _|| *__* _ *|* ** **xx x_|_ __ _ _| |_*||* x*x_x_*_xxx**____|__ xxx x*x | xxx _| _x|_x|| |*x|_x|_||_x* x|*xx |_xx*x* |** ||||_x _||*x*_ x| *x|*xxx *|_|| x||* |**__ _x*__* *|** | x**x_ *| |__*xx* |_x_x|**| _*xx* xxx_ _ _ x|_|x x||*xx *|_|xx**xx*x_|x_| xx* *x_|*|* |_||**xx* ||xx||x** _x * *xxx| x|*|x __ xx | __xx|x* _x|||*_ x_*x_| | x_x*|*__| *x|*xx*****x _x| || |||____ __ |x|||*_|_* |x |_ |_ x|x *x_|||_**x* |_x*xx *x_|x||xx_||| x||*x|xxx*|__*||**x | |_|*xx x*| || x*x _*x | x|x|**x|* x| _x x _ _ x||x|||_ _x_||x*x* *|_ *x| * *x_*x| _xx_x*_|___x|x**x*x_x|*|||||_x*|x**| * | * _* _*||xx xx| x xx|__| |*_*|*x|__**_x** |x**x __* |*||xx||_*_xx* _ x*_xx_x|_|_|_|x|_|_||__|x _|** x||*|x _ x ||x_ x_x_|_|x _*_x * | x_|*_ _ |_ _x*___ _ xx|___ x|_*x_|* xx _ |x* xx_ |*x| _| *x_x**__| x_|_*x |*xx*_x__*x |__|| ** *|*x_____|x|_* |x|||x||xx|x x|*_x _|*| |||_x|___ | _|_ _|**__ | x ||_ x_ x_ x| _ *_x|x_*x**xx__ | ||x |__xx**x*|*** __ *x|_ |xx_ **x**xx *x x*xx_| * *x__x*x_ *||x x | __|*****_x|xx*|**__xx _ _|*x*__ _x ||x_xx*| || xxx_x_|| | *_*| * __||_*_ __x*|x**x__x| x|*|*||*_|* x_|x||||x_||xx* _ |** _xx_ |_*x _|*x|_*xx**||x*_|_x* _||x|*_|xxxx||_x|x*x| | |x*x_|_|*__*x|*** _ ** | _|_*_x||_ x xx|xxx*_ * *x*xxxx*| xx *|x x_ x|_xxxx x||_xx xxx__ x_x _x ||*_|x|__**__ | * x__|x|_ *_|_| _|x * |xx_xx_ _ x_*xxx*|*_x*x* |x|x_ x__****|x__||x_ _** **** *_ |*|| ___x||**_x_ **_||x|_ _| _|*_***xxx_*x_x|||___ ||*x|*___x x_x*_ *| xx _||x |||x_*|_ x_ x| _ |_*_x|x|_*|__x**x_|x x xx|____|||**x|| _ _*x_x xx_x||x|*|x*x_***_ _ xx__* xx| | |_| *_|_*xxx||___x|*x _*_||x*xx |x| *|x |_*|_||xxxxx |___*x |xx_x**_* |*|x|*x___x_x ||x_x|___| x*_x_x *x*_ *x**x_* x__ ||*|* *_x**_x_ |x*x*x| __ |**|*|||**_x x| _*_x_|x__x*x* | * *|*_||_*_|_|| _ x_|__x *__xxx* x**_|*x __** x x*|| |x_|x*|*||x**_ x|_ x|__||x*x_**_ _x| xx |*_*_*||_x|xx|* __|_ x_ |*|x x *x|_| _ _** |_*x|xxx__x*__* _|x|_|x|x_|| ||_x*_|x||x|xx_|xxx|* x*xxx_*x*_x** x**xx*x _*_x|*_|*|**|_*_*x*xx|_ _ **_ _x| _ xx|**|_x_ |____ **_ x|* *_ x*||x| |_*x x_|_x xx _x_xx|_|_x*|_|x|_*_x*_x__xx | |x_|_ * *_||_|x |_ x|xxx|*_|x__x_ __x_|| _| x|_ *___ _x* *|* __ * x_ x * _*x|x*_ x|| *|_||xx|| |*_| x x*_ ___*_ *x x*x||_ | x x _| _* x|_*__ xx|x*xx * _** x*_| *** |xxxx _x|___|_*x*x |*x* | || x| _ x x||xx__x*x_ |||| _ | x** |*||*|_ __* | *xx|__x* *||__ _ _ __ *__*x_ __ x|x_x|_ x* *_| x*_x _**x* _ |_*x|x x* | *____ x_* **xxx x_| * _|_*|* __| x __|x|___ *|_x| x _x|* x|| x|___* _||x _x|__x| x_ x *_ |__ _** x|_||_* x| |x *_ |*xx *_|x_ xx|x*| x*____|xx * |x _*_ **_ *x *|x|**x x| * __ *_x*xx*|| **| |* |_|_*_***_*_*|x |_* ||x__*_*x**||x*xx_| | || * x |*|| * *xxx xx|x*xxx*x*x __|_| |_|x|__|x__*_x*|xx_xx*x*x _||_*x|*__*| *||| *x*_| ____xx*|_ xx x|x||__*_|| *x**x x x*_xx_ *__ x|* * *|_xxx _| *_| _||xx_ |x_* x x|___ *******_x x_*| ____**xx*x _x*x*|_*_ _x_||xx*| x**_ _| | x __x__ x***_**x x|__* x _ _ _ x x x* x***x| _| _| _x* * __ _*|*x|xx|*||_x *x* ___ |xxx|x* x |x*_ *|_xxx| |_x || |_x*_ xx|***xx_ xxx_x|__***xx*|x _||*xx____x_|*x_| |x*_xxx|| |*|* _x_|x|xx__xx_*|_x_|* x_ _x*|**___|x*x _**_*|*_ * |*** _| |xx_|xx_x | *xx|_*_| | *x||x|_*___xx_x**| _| |x x *|*xx* x*| *x||| *x _***x*_ || x*x_x||*x***_x|*_** *|** *|x|_x __ *____x _ *x x |||xx| **xx|x___|_| * x* x _ | x***___ _x_||_***||||*x__x___ x ****_|x*xxx|_ _|xxx_ |**|*|***x |*x* x __|| _|*|_ *x x|__*x*x*x xx |_| | x*_x_| *_ ___ |x|**_|| x* ___ *|_*|* _ _|xx||x**|*||_| xx ||x_| |x***|*|_*| * *xx_ ||_xx**||x_x*||*_xx ** xx__ *_x _**__x_*|* _|* * |x__| __ xxx ||*_|| _ ||x***___ x*x___ __xx__|*****|x*_* | _||__ *_xx |_x|xxx*x * |* ** *xx |** |*x* |x_|x_**|x*|_ xxx*_ _*x||xxx_|*xxx||xx|_ _*|__ ** _ x*|*_* _*x___*||**||**x*x* _*x|__ _*||xx_x _ _ x__*_x*xx_* | x***xx_||___|x**||x x_*x|**_* _***|__x||xx| _ _* | |x_x ** x||**__| _|* _*xx|_||_**| _x|_| * _* xxx|_x* x__ **x_|xx||*_*_ __ | |x|*x *x _| __|*_*| _*_ _||_* ___ ||_xx_*x*_ _ *xxxxx_* _ *|x|x x *|x_*| ||__*x*_*||x*_ _*_ *_ *|__*x_ * *xxx_||_*|||_| *x__ x||_|_|_ xx _|x*_x|x|xx|_*|** _ | _x |_x_*|__x|x **|x| | _|| | _ |***x_ *x_xx*|xx |x**||*_x* |__ x _*x |__| **||_| |_|x||*__x*__ ___*|* *x xx_x|x x|**| _ * xx ** xx**_x_x |* x_ |_xx_*|* _xx|* | _*| | *x|||*|*x__ x *|___* | |**| |xx_x*|xxx |
+ + \ No newline at end of file diff --git a/code_base/bgs/3_files/blizard.js b/code_base/bgs/3_files/blizard.js new file mode 100644 index 0000000..97305a1 --- /dev/null +++ b/code_base/bgs/3_files/blizard.js @@ -0,0 +1,148 @@ +//blizard.js version 0.5.1 BETA by Rohan Samra-O'Neill +/* +uses the atomo.css library created by Rohan Samra-O'Neill +*/ +"use strict"; +//inspired by jquery and p5.js :), thanks to p5.js and the processing team for featuring blizard.js on there site +var sl = {}; +var id; +var storage; +//just a little message to anyone who goes onto a website that uses blizard.js +console.info("This project uses blizard.js for more info go to https://github.com/Slitherlizard/blizard.js"); +//with sl.ready the parameter is the function that will run when the page is loaded, i needed to add this in version 0.4 because it's a DOM library and functions wheren't working because the elements couldn't be found because they werent loaded yet +sl.ready = function(sel) { + window.onload = function() { + // basically just runs whatever function that the selector is equal to + window.setTimeout(sel, 0); + } + + +} +//with sl.print the first parameter is the id of the element you want to change the second is the text you want to change it to +sl.print = function (sel, txt) { + + + document.getElementById(sel).innerHTML = txt; + +}; +//with sl.hide the parameter is the id of the element you want to hide +sl.hide = function (sel) { + id = document.getElementById(sel); + id.style.display = "none"; + }; + //with sl.show the parameter is the id of the element you want to show + sl.show = function (sel) { + id = document.getElementById(sel); + id.style.display = "block"; + }; + //with sl.col the first parameter is the id of the element you want to change the color of, the second parameter is the color you want to change it to + sl.col = function(sel, col) { + document.getElementById(sel).style.color = col; + } + //with sl.family the first parameter is the id of the element you want to change the font-family of, the second parameter is the font family you want to change it to + sl.family = function(sel, sel2) { + document.getElementById(sel).style.fontFamily = sel2; + } + //with sl.size the first parameter is the id of the element you want to change the size of, the second parameter is the size you want to change it to these are the sizes you can use +/* +xx-small +x-small +small +medium +large +x-large +xx-large +smaller +larger +*/ + +sl.size = function(sel, sel2) { + document.getElementById(sel).style.fontSize = sel2; +} +//with sl.wait the first parameter is where you call the function you want to run, the second parameter is the amount of milliseconds you want towait to call that function +sl.wait = function(sel, sel2) { + window.setTimeout(sel, sel2); + +} + +// with sl.setlocalstorage the first parameter is the name of your localstorge item so that you can refer to it later, the second parameter is the value of your item. +sl.setlocalstorage = function(sel, sel2) { + localStorage.setItem(sel, sel2); +} +// with sl.printlocalstorage the first parameter is the name of the localstorge item you want to print the value of, the second parameter is the id of the element you want to print the item's value to. + +sl.printlocalstorage = function(sel, sel2) { + + + + + document.getElementById(sel).innerHTML = localStorage.getItem(sel2); + +} +// with sl.click the first parameter is the id of the element you want to add an onclick attribute to, the second parameter is the function that will be ran when that element gets clicked +sl.click = function(sel, sel2) { +document.getElementById(sel).onclick = function() { window.setTimeout(sel2, 0); }; +} +// with sl.id the first parameter is the id of the element you want to change the id of, the second parameter is the new id of that element +sl.id = function(sel, sel1) { + document.getElementById(sel).id = sel1; +} +//from line 92 - 124 i think i liked inporting other librarys too much +//just loads the atomo.css library for styles +sl.atomo = function () { + var head = document.getElementsByTagName('HEAD')[0]; + + // Create new link Element + var link = document.createElement('link'); + + // set the attributes for link element + link.rel = 'stylesheet'; + + link.type = 'text/css'; + //load atomo.css library + link.href = "http://atomo.ueuo.com/atomo.css"; + + // Append link element to HTML head + head.appendChild(link); +} +/*sl.import does not work yet :( + +sl.import = function(sel) { + var head = document.getElementsByTagName('HEAD')[0]; + + // Create new link Element + var link = document.createElement('link'); + + // set the attributes for link element + link.rel = 'stylesheet'; + + link.type = 'text/css'; + + link.href = sel; + + // Append link element to HTML head + head.appendChild(link); +} +*/ + +//I have wanted to add this since version 0.0.1 but didn't know how but now i do know how so i'll add it. + +//with sl.createElement() the first parameteris the element you want to create like P be sure to wright it in capital letters and the second parameter is the element you want to append it to the third parameter is the id you would like to give that element +sl.createElement = function (sel, sel1, sel2) { + var father = document.getElementsByTagName(sel1)[0]; + + // Create new Element + var elem = document.createElement(sel); +//give the element an id + elem.id = sel2; + + + + // Append link element to HTML head + father.appendChild(elem); +} +sl.changeBackgroundColor = function(sel, sel1) { + document.getElementById(sel).style.backgroundColor = sel1; +} + + diff --git a/code_base/bgs/4.html b/code_base/bgs/4.html new file mode 100644 index 0000000..6d492e0 --- /dev/null +++ b/code_base/bgs/4.html @@ -0,0 +1,58 @@ + + + + + + + 01 + + + + + + + +
_ _ *__|x|*||x |* *_xx _**_|*x x |xx*_xx** * **_x___* |**_* _x*_*x__|xx|*** x**_| **_ *x*x* **|x||_* _ xx x _*|__| _ x|x** | |__x*_|_ __| _*__*|xx* * *| x * x x_*_x|xx __|_ *x*|** _ _ **| x |_|_x__|__***x *| _|_xx x x_*_x_x_||x _** *_||x_ |x||___|**_*|*_x*x*xx*_*___x ** _x__x_ ____xx||_ **xx_ *_*x_*__ ____ *_*|_ _ ** x* *x |x*x***xx |x_x *x*_|x_|xx*__* | x* __* x * xx*|x*|_ xx_*|*| *| x**_ |_ xx|*x_* x*| | xx|xx* _| _* |x |x||__** x| |*|x _ x __ | |x| ||*| x |_xx_|| * _|__|_ *_| _x|*x **x|x* x| *x||*** x | *_x* **x*_***x|_|_||xxxxxx * x_ _ *__x ||xx||**||**xxx x* x_x|_x x****x_ ** x*x_ x*_**|xx | _ *x|*|_|| |*x |_*||**_ _x|__*x**|x*x_ | *_|* x*xx xx| |**x*|x_x_*_ _ |_x*_|_ ___|x_| x_* _xx| *||*_x*__|_ |_****_*__|x| *x__x*_xx_* **|x_xx*|x||x_| *||x|_ x_||* _x*_ _ | *x|x|_ *_*|xx|__ x | |*x ||*|xxx_ __* |x| *x|*||_|x_ x_|_ *__xxx _** _| * ** _**||| |*x *| x** *** *|xx|xx*_x**|_|_*_*_ xx_x*__|x x ** _ x| x * *x* *|| *_|**|_ _xxx||x___ *x _ *x|x x| | *x||xx|* |_| |xx|**|* x||_ x **|| x|___*x_x |x x*xxx|**x|xx||*_*x *|xx |x__x***x _ x_| _xx_ | __ x|__||_ x_xx|****_|||*x *|*_ *x_| __x_x_| x_*||_|||x_*x*__|xxx **_xx _**|x*x_|xx|x xx|_x*_*xx*_*x x__*|| _ |x|_ * x*| _* * *|**x||***** x|x* * |*** **||*| |x _*|_ | _|*_|*_*_x _* _ _x x *|x*_ _|*_*| x_*x _*|x___|_ __*| x|** *||_|* |xx| |x_xx|x__||_x_|*||||x*xx| _*||x _|*x_x _x|*x_x | xx |**_** |_x |__x*_*x* || *| _| xx_x|*_ _ | _|x*x* | |* * |*_x |x *xx*_ |x_x*|_x |x_*x*x_|x* x*|xx*xx x_|_ _ |_|x*x _x * _ *_ **|* _| *x||| *_*x| xx***xx|*_* x* |_* x_x |x||**x xx_ * xx_x|x *x_x|x* _ *x _*___|**_* _x|*___x_|** xxx x*| x *|||__| |x|_ xx__** x*_* x||_ *x_* ||_ |x__xx|**x* |x***_x||_* _x_*x|*_*__*||_x_*|x*|__|| * x|_ ||*|**|_* _|_|*|_** | |x|_xx_|_x _|*x*|| | * x *|_ x*x|* _xx** |||x ||_x|x*_ _x |*x| *x_ |_*|x_ |** *x_*|_|xx_* x| ***_ _x* *|xx x_x| __*_|xx* _x___*|| |x|x|*xx_*__|*x |x| || *_*__ x|*| _ *xx *_ *||| _x|*__*|x____|x|xx *|_ |x*|x|_| x_ |**x_*| _*_| |_x*x|_ x*|x *x*_x_|x*_|_ __x ||_ |xxx*__ _|___||_****x_ __|_|*|x| | __x|x_*xx_*** _x_|_|* x *x|x|| x|_|*|_|xx|x_ _|*|x_ x*_||*_* _| | _x*|||||_*|___x*x |_*x*|_ |* x x* __xx*_||__x*x _ _||* _|*x*_ x_**x*_ __*x|***xx|| x|*_*_||x __x| *|x__x_* _** || _ x* *x* **_| * x||_ x | x | ||| xx_|*x__ xx_||x__ |__**_*x__xx_*xx*|x|x_|* x_x| _ |xx xx x_*| |_*_ *|*x x*x_*x|*x* x****|* x x* _x* | |* | _xx* ** __ *x*x *_|||x |x*||_xx|*x|**x x_****x* _x_ |_*|**x* |___|xx*x | x __***x_|* |x_x __* |*_x *_ x_x**x|*|_x****x_| || x||*_ xx*_*|*xx_||_*__xx *x_*_ || _x*|*_* _|_x_* | x|_ **xx*_ x|***| *|**_|*|* |*x_||_x _|x*x *x*_ |** _ *x x_||__xx||||x*|_* x_| _x*** | |* *_ *||_|_* __*_*_ x_ |x_|**_x ***x||___* x |__ x_*x|| _ _*|* _ *x x |_ x | **_|*_||xx__xx__ x_xx___x|___x_ x x*** |_xx _ |* *||__x *x*|_|_ x *x* *x_*__|_*|*||x*_ *x __*|_** *x*||_x|_*x_ x* *||x|_ _ * _|**x**_***__*x|*_*x*__x* |x __|_*_x| _| x_| ||*__ _| * xx |* _|_**|*|x|_x _**__|x*|_| *_* x| |** _ |**_ _*x **__|| |*x*| **_x __ x* x_ *x**x**|x _*x_xx_*** *__x|* _x*| ||_||_ *_*_*x*___*||| |_ x*x*_* x_|**__ *x_xx _ _*x_| *|_x x|| |*| x__*** ___*x|__*_ |*|*_|**x* ||_*_|**_*__ * *_**x_xx || *x__|__x|*|x |x |*x xx x *x|x |*x |***|__x|_ |_|_x_*|_||_*|xx_**x_||*_x|x__**_x |_ x |x_x_x x_** _*|| | x *||x*__|*xxx*xx|x*x*x_ x*_ *_|_|*__x___|_||_x_* | *_ |__|x_*_| _|x*_|__|x x* *|_*|**x _ _xx| |x*_x||*|xx*| _ __* xx* | | _ x**|xxx*|*_x *x**x _*||*|* *|*|x x|x__ _| **__||||*|x|||*| * ** x**|x x* |*x |*||*_*|xx _ |*xx____ *__x|*_x_* |* *x*x*| || x **x__x|___x***||* x | x*x|||xx*xx**_* x**x | *x _xx||* _|xx | |*||**x| _x|**x * * __ |_***_*__x||x_* *||x||x_x* x|_x||* x*x_ x || x_ x*_xx| *_||x x _|* _|x x | x_|__ _* _**_ _* | _* * _*| * |*x*xx x*x _ |_x___*| | *| |__ *||*||_ *_ _|x*|*_ | |*_x __| _x |_xxx__*|_ |x|x_||x**__*_|||_x||*x** **_||_ |x x_ |*___*x __x**x_* _x*_x* * _xx _ **_ ** x|*_ *|||__x*__| x|*_|_*x|_x* | __| * ||**x* **_x x__xx_x*x___*x xx| x_xx*_ | x _x| **||_x |x| x|__*xx __x|_|||x* _ _xx_ x||_* *xx ***||xx*|*|| |_ *x|x_|x|x_x*|*| |||*_*| x||x|_x_ xx| ***x_*_*|x_|_x_| |**_x_ | ||||*_|_x *| _ |_**x | _xx_ x***x_|_| |_* |*|*| xx* *x_*x _x_x|_| x |_*|_ *__*_* *| x|||||| |*x*_|*xx |_ ||*| * *_*x_x_ x_ |_ x __ _x_____| |*_x x*|*| | |**x| x**| **x|xx|**x || *_*x_*__ _ _ _ *|| x|x__ x|__| **|| | x_*x |_ ||* __ x__x_* |*|_|*|x _* |x*|xxx_* *_|xx*xx||| **_x|| _* *x |* |x|x*|_xx x_*xx*| x_ _|x x|*| _|*x_xx___x|| | |x*|*|*_ *|| _x*xx||* x * _ x*|*|___*||_ __*_x_|*x|*|*x ____| |*|*_ ||*_*x*xx_**_*||_|_*|___x | x* |_|x | _||*x___x|_||*_x*__x **_| *| *|x|xx*__*|*|**_**x x|__ ___x__|x||xx *_x x|x_ *__xx |xx |x**|_ || xx_*_x | **_ *_* |_****|****x_*|x | *x | *|*|x _*__|___x_ *_x_* x** |x x__|_ xx _ xx *_||x *_ |__*x_ |||_*x__** |x_||x___x* |||_*|_|* | *x |x x|*_|x _x_**_**x__ ||_x*|x*|_**|x_| ___ |____|__ *_*|_ x|x_*_x |x**____x| _ _x**xxxxx|*|_xx*_|**x_*| _*x|*|x x|| ***|x|_*___|_x*x*_* _*x*|x _| _|x_ |x__x| x|*x_ * |x_* |** * |x_x___x __| | x|x*|**||_|||*x_xx** |x_|xx|** _* *xxx|_ x|_ ||x|xxxx_x_||x__x|_ __*x_|xx||_| *x ** _ *_x| * _*|xx__|* |||_ |x *x_|x x||x|__ | |_ ** x**x*x_ | x x *|** **_|_xx | x*_ _|**|x__*x*| |_* __|x x x__ ||* _ x_ | **xx||* _*x|*x** | * **_ x_ |x* x_x x |||**x_* |*_ __ *x_ x|x_* *__x|_xx x_|__x_x*x_xx _**x|| * x||*||x*|*_||_ x*x_ x***|xx___| *x_*x _|__ x**_*| *| *xx x|*|||||| *x x_ _x_| x|*x*xx_x|* * |_|_ _| x*|__ _*| ___ *xxx* _x|__ x_x _x _*|_|*x| ||_x _ *_ _ * ___x| _xx xx_* * *x|*xx_||x _x| |*_ *x x||*|x|x*x *x_| x_xx *__ _x |*x*x ****x_| x|__x|*xx_*|x*|*|**|_x____x| x*_ *_**x*_|x *_| x __| _|_ |x *x_| | xx__ xx _ |* _ x__ __ _| |**_x| *x*|_x_ _x |x _x x| x ** *|x*||*_ x| xxxx*|_*_|_||x _ _* | xx* ||_*|x ||x_|__ _x |** *___*x_ |x*|_x _x|*_ *** _|x*xxx ||x|_ xx*_x__x|_|*x| *|_ _|*x x*|| | _|x*x x||*x * _x* *xx*|_|x__ *x** x x _*x|_|_ x |***|_* x__||x x|_*x*__x_| __ x||x_ x *x_**x***||_ x **|_| _ *| x*x*||x_ _x|_x |*_*|__| x* *x_ | _ _xx |_ x_*|xx|* * x |x___* _ *x|*_*_ xx_|xx*xx ||*|** |_*x|*x *xxx*_x|* _x|*|__xx||** _| |_*x||*|x|**|*| *| x*_ __||*x x*|_ xx| |xx* |_x|_* *| *_x|x_ _|*||| x| *x*__| * |xxx*|| x *|| __x_*x_|x | || x* x_x|** **x** *_* x|x*__ __| *x*__ | |* *| _ *_ x |x|| x_ **| x*xx**xx *x | _|x|_**_|x| x_*_****||*|xx __|x* *| * ***_| * ||_*|*_ x|** **x _ *x*x* x x_**x|_x|x_ __ _ |_|*xx|_|*xx|x___|_*_|_| *| xxx_ * * xx x _xx*_|xx||x_ xx_**_ |x * *___ ||x*_x**_|*|***xxx__|x_|*|__*||| |__|* x__*_ __|x| |__x |||_|| _*|_| |_*|xx*| *|* x*||_x|__x| _*_ x x _ *|_*xx||*xxx_****x__*|_* |x|x_| _x*_|** ___x|_ _||||_x x *_x*_x_|| * | x__| |_x*x x|_*x_ _x**|x_ x*_|*|__| _|_x_ *|*|| __|_*_ *x*|xx_x|x*| _|x_ ||*x*|_*|x | ||||____ ||xx_|x*| x||_||||| _x|||* *|*x_** |x|_ *| _|xx x||* xx_|x**xx_ *x*| x__|| ____|x* * |xx|*x_ _| * x|| *xx |x _* ||x*xxx * x_ x ||* x_ _x _|x*|| xx*x*x* *| _| | x*x*xxx*xx_ _x_ x_x *x_**|_**| *_*| _x||xx* xxx __xx_x*x__ *|||*_* |_x_ |*__ __* x |*_| |_ *x x**|x xx**xx*x x _*|*|| *|_x*x* _x__x |_***__|x x||__ xxx__*xx_|**xx* *_x|*| *x|_|xxx |* |*|xx*|*_*xx* _xxx|x|x_x_ x_ | x*x_ |_|| **xx __xx* __x|*xx| *x*_*|_ *_|* _*| xx__* x_x **x*xx___*_**__ *x_*_* |** *x *||x*_ * _x_* * __*x ||x**|__ | *x__x|**_ _xx|*_|_ x|||_x |x* xx*|*x* |_*x__xx**x_|x _ *xxx|_| |_|xx_|x * | **|x_xx*xx*|*|_ x xx_*x|_*x_ * * *_xx_| | |*xx__x *_*x_**| _*|_ *_*_xx x_|x_x_*x | x _*x _ ||* x|*||* * xx_ *_x||*_*x_x | *|_ ||x|_ _x **|_|| _xx __*|xx_|____ _ | _** _ _|**__|__|_ |** xxx __|| xx|*_ __x* x|_x|x__|_*|x|| _*_|_ __*x_ __x*xx xx** xx x _x_ _x|*|| _x* |xx|* x***_|_*_x|__x* *_ _|x__x*|*x_ _ * xx* |x*x x * __ _x|_xx* * x * _xx*x*_ _***|_xxx ||||_ |x| *_|x x|_* x__ | *_ _ *_*|*|_**x| *|x_xx**_*x||**_ x|x*_*_xx*|||_x*|_ x * * *____ |x|*|xx|*x__*_xx |_ *| * x_ |*xx|_xx_x*||_| *_x|x| _x*_x_* _*x|_ _| |* *xx__|_|x_x|_ x*_||_ _*x_x||_|*_*_* *___| |_x xxx_**__| *x| x|_ x *| _|||x* x*_||_x||x x| x* _ * x*_x_|xxx_ *|*_x|_|x* _x_*x*x*x*____*x __* **_ ** __* *_ |_|||x | *|_*| _|*|x**x |_x_ xx|x| *| |_||x_xx *|* ** * x|x |* x_*xx |* |xx_|*x *x|_*__ xx_|* xx _xxx|| |_x|* | *_|_** x* |***|*_ |_*|x||*_|x *_|xx x| xxx_*_ * x|_x|_ _|*| xx**__ x|x _** * * |_* *_|| x||x__*xxx |*x x|*|* |x* x xx|x*_*_* || _x_ *_x_ x*|*_xx* _x xx|| x |xx|*| _x_| x_| x|x |x _* _|__**|_x||x_ *|_|_|xx_ xx| | _ _x_*_|_|**_* _ x *_**_xxx _ x*xx_|| * | __|||*|*_xx|__*_xxx _x|xx| _ *|*|| *x *x|x_|xx |_|xxx|||x *_||xx**||*x__|_ *|__ _*x*||x||**|_ x __*_ _ *_*_ *x** ** * _|x __ x __x x *|x** _|x_ x _x **__|_|*__ |_x|__* x _|| _|_*x*||x*|**|x|*||**| *|||x_|_*xx *x_|_|*x_ |x |x_*x_*x*||_**| _|__x__x *|| |_ x__x|x *_|x*| |_ x|||****||* *_x** _x x|_ ||* x|* |*xx *___*x__*|*|| * **_x||*__ x | _|_ _*x| ||xxx*_*x|x**_*_|* __x** _ |*x|****x**_*x|* |_| _**||x *|_x ||_xx_*xx*x**_ x x | x_*xx|*x** * __x |*_x| x* _ **|| ||_ _|_ x| _ x****|x | * | * *|**|x |xx_ | _*x_||_x *x
+ + \ No newline at end of file diff --git a/code_base/bgs/4_files/blizard.js b/code_base/bgs/4_files/blizard.js new file mode 100644 index 0000000..97305a1 --- /dev/null +++ b/code_base/bgs/4_files/blizard.js @@ -0,0 +1,148 @@ +//blizard.js version 0.5.1 BETA by Rohan Samra-O'Neill +/* +uses the atomo.css library created by Rohan Samra-O'Neill +*/ +"use strict"; +//inspired by jquery and p5.js :), thanks to p5.js and the processing team for featuring blizard.js on there site +var sl = {}; +var id; +var storage; +//just a little message to anyone who goes onto a website that uses blizard.js +console.info("This project uses blizard.js for more info go to https://github.com/Slitherlizard/blizard.js"); +//with sl.ready the parameter is the function that will run when the page is loaded, i needed to add this in version 0.4 because it's a DOM library and functions wheren't working because the elements couldn't be found because they werent loaded yet +sl.ready = function(sel) { + window.onload = function() { + // basically just runs whatever function that the selector is equal to + window.setTimeout(sel, 0); + } + + +} +//with sl.print the first parameter is the id of the element you want to change the second is the text you want to change it to +sl.print = function (sel, txt) { + + + document.getElementById(sel).innerHTML = txt; + +}; +//with sl.hide the parameter is the id of the element you want to hide +sl.hide = function (sel) { + id = document.getElementById(sel); + id.style.display = "none"; + }; + //with sl.show the parameter is the id of the element you want to show + sl.show = function (sel) { + id = document.getElementById(sel); + id.style.display = "block"; + }; + //with sl.col the first parameter is the id of the element you want to change the color of, the second parameter is the color you want to change it to + sl.col = function(sel, col) { + document.getElementById(sel).style.color = col; + } + //with sl.family the first parameter is the id of the element you want to change the font-family of, the second parameter is the font family you want to change it to + sl.family = function(sel, sel2) { + document.getElementById(sel).style.fontFamily = sel2; + } + //with sl.size the first parameter is the id of the element you want to change the size of, the second parameter is the size you want to change it to these are the sizes you can use +/* +xx-small +x-small +small +medium +large +x-large +xx-large +smaller +larger +*/ + +sl.size = function(sel, sel2) { + document.getElementById(sel).style.fontSize = sel2; +} +//with sl.wait the first parameter is where you call the function you want to run, the second parameter is the amount of milliseconds you want towait to call that function +sl.wait = function(sel, sel2) { + window.setTimeout(sel, sel2); + +} + +// with sl.setlocalstorage the first parameter is the name of your localstorge item so that you can refer to it later, the second parameter is the value of your item. +sl.setlocalstorage = function(sel, sel2) { + localStorage.setItem(sel, sel2); +} +// with sl.printlocalstorage the first parameter is the name of the localstorge item you want to print the value of, the second parameter is the id of the element you want to print the item's value to. + +sl.printlocalstorage = function(sel, sel2) { + + + + + document.getElementById(sel).innerHTML = localStorage.getItem(sel2); + +} +// with sl.click the first parameter is the id of the element you want to add an onclick attribute to, the second parameter is the function that will be ran when that element gets clicked +sl.click = function(sel, sel2) { +document.getElementById(sel).onclick = function() { window.setTimeout(sel2, 0); }; +} +// with sl.id the first parameter is the id of the element you want to change the id of, the second parameter is the new id of that element +sl.id = function(sel, sel1) { + document.getElementById(sel).id = sel1; +} +//from line 92 - 124 i think i liked inporting other librarys too much +//just loads the atomo.css library for styles +sl.atomo = function () { + var head = document.getElementsByTagName('HEAD')[0]; + + // Create new link Element + var link = document.createElement('link'); + + // set the attributes for link element + link.rel = 'stylesheet'; + + link.type = 'text/css'; + //load atomo.css library + link.href = "http://atomo.ueuo.com/atomo.css"; + + // Append link element to HTML head + head.appendChild(link); +} +/*sl.import does not work yet :( + +sl.import = function(sel) { + var head = document.getElementsByTagName('HEAD')[0]; + + // Create new link Element + var link = document.createElement('link'); + + // set the attributes for link element + link.rel = 'stylesheet'; + + link.type = 'text/css'; + + link.href = sel; + + // Append link element to HTML head + head.appendChild(link); +} +*/ + +//I have wanted to add this since version 0.0.1 but didn't know how but now i do know how so i'll add it. + +//with sl.createElement() the first parameteris the element you want to create like P be sure to wright it in capital letters and the second parameter is the element you want to append it to the third parameter is the id you would like to give that element +sl.createElement = function (sel, sel1, sel2) { + var father = document.getElementsByTagName(sel1)[0]; + + // Create new Element + var elem = document.createElement(sel); +//give the element an id + elem.id = sel2; + + + + // Append link element to HTML head + father.appendChild(elem); +} +sl.changeBackgroundColor = function(sel, sel1) { + document.getElementById(sel).style.backgroundColor = sel1; +} + + diff --git a/code_base/bgs/5.html b/code_base/bgs/5.html new file mode 100644 index 0000000..8b5aa50 --- /dev/null +++ b/code_base/bgs/5.html @@ -0,0 +1,58 @@ + + + + + + + 01 + + + + + + + +
|| x_xxxx|*x_ ||x |x_*|| *_x|_||xx|x x | ****|*_ _| xx x| | x___ |x x||*|x*x_|x***_ x|* ||x*_*__**x |*_ x*__x__ xx|x*x__ xx _|_|x|*x*x*_ _* *__ x|_x___xxx|__|xx*x *_xx|_| ***_ _ | x_*|*|___|* _x* __ _x| |*| * |*|*x|| _x|*||______ * *|* || | *_| |_|*|* |__x_ |x_ || **xxx x|x|* xx*_|_|_*xxx* ***x * ||___xx*xx* * | x| | |_ x_x *xxxx* **xx |_ *x xx* |**_x_|*_x| _*_x|x| *_|x x_x|xxx_|*x| _ |||_x _ |*||xx| _ |x_|_x_ *__|*|* |*** |_|__*|x*_*_*|**|_|*|_x __|*___x_x *__ x*x*x*x|_ |x xxx*xx*|_||*xx_xxx* *_** * x_ **||*|*x x |_x_ **_x|_*x __xx _ xx|***__|*x_| _ * *xx*__ |**_xx_* *x|_|| * x* *_* |_x* **__ |***|_* _x|**||_ x*_ _*x * |*|** __x*_*| |* *** *__ *_xx__*|*x|_x*x*_*_|* _||_x| * *_x _*|xx_* x_*|_x|_ *|*|x*| *_ x|*_|__x _ *_ _|x _||* **|xx||*x|x*|__|_**| |_**|_**_ x__xxx_ _ *x*xxx|* *_****| ___ _| *|*_x|x|* **__xx_x* **|* *x|_xxx *_| x*|x_x_x_ |_||x*|*||x|_**_***_*__ **|_|xx_xxx* |_ xx|||_||_x* *__x|*_*_x_x_xx _|_ ||_||_**_**_* _|x*_x|_ | xx* x x| x*x_ | _|_|x _ |_x *_|* || xxx_*x*x * |* * _ x|_|x__x*|*_* _*_*x_x| x_|x**x**||*x__ ** _*x _xx_*|*|xxx*| |x x_ |_ ||x|x|| _|x|* | |xx||_*||*** |*xxx |*x* x|__ *x_ **_|*_||_*|_|__* _| |__*x|_**x* x x |*x| _***_ *xxxx *x*x*_x_||*x|_x*|*|xxx||x_*_|_x|x ___ x ** _ _***_x| _x * _ |_ xx|xx_*| |* ||x|*x|_x__*x_*__***|||x_x|__xx|_*x_|* |_x___*x* x_***x |||| *|* | |_*| x xx*x| xx|*|x__ ___x*| *xxx*|xx*_ x|| x*x_x|| *x_ **x|__|__ | x*|*xx|x_x| *|* x_* *__|*x* x _x_ _*_ ___|x *x| *_x* *x _|___xxx|*x|*_**x_* x *| |*** x*_*x||||_|||__| x| * || *x*|xx _|*xx*|x*_ ||x __|x *|x |**_x|_* * _ x| _|**x__|x__|x_x*|*___*_ | xx*|_x_x x |__* _xx_x**_ |*x|_ *_x|_|_x x_|_*_|_||x_|_xx|*xxx| _|_|xx _|*_x|x_x|_||* **x_ *_|_||_*__x|* |x_ __* xx __x_ * _ _|x_*__ |||x |*__x___|_x*_*__** _*x| _ |_* *|x** x |_x|x*_ _*_ _|_x|||x|*|*| ** x|*x||**x|x*|xx| ___|** xx _*| *|__| _* x| |x __x_||*_**x_|x |*_*_**** x**|x*x|_ | _*_|*|__*| |x_| *_ *xx|*|**___|||| __ _x|* x|**_xx*| * |x_*___x _| _|* _* _ _* *x* x|_**_**x_||*x_xx_x _x| *xx*x*|x xx x**| *_ _* * x | | _ _|*|_ *_||** *_|__xx*|_x__ *_ ||||__ | | _x*xx _x*|__|_ _|_ x|||x |||xx _|x|x*xx|* * *|x_ *x__|*x* ***x*_x*|xx|x _* x|x|x*_*| _ |x__x_|xx*x*_x_*xxxx* _|| x x|| _____ _|*| || _ *||_*_x_x*_|__* |_*x _ |_ x *x **xxx *x* *__*_* _|__| _*|_x_ _ _xxx____x |xx_ *||_*_x*_x |**__ *x*xx x_|___***|***_*x|| |** _**x_*_* x xx*|x |*_xx| x_|x|**_|_x__ _*_ xx_|_*x|*|***_***| | || |x | _ xx* _*__|x* x*|**| x|||x_* **_x| __* |** x||_|_x| x ||xx__x____*|x*_|* * |xx__ *_||_| xxx ** |_* _ |* * _ *_ x*_*_* |x || *xx | *__ _||x*|*||x|**__**x_** | **|_ *_ _**|x_x*x **x *|| _*| | *x|x__*x_x xx_*|_| *x_ xx*x|** |_|x|x *|x|**_|*|x__ *|* _|_***|*|x** ||*_ *xx||* _ ||x|||__x x| *xx___* * _**x|_| |___* |x|x x__* xx__* **||_x *|xx|*|*x |*x **|*_x*x||* *x_| |*|*x*_|x||| *x |_x| x||| || |*| __*xxx|xx| | _*_|| x| |**|_ * * x|x_|x*_|*_ *__ x | *|_**|x __x| *_x_|*_xxx ||x_|| *_x_|*_* *_* *_ x*x **_ *xx*|___x|x__*|_ xx*_|__ *|_x| * __ _| x x_|x|**x xx* | *|__*|xx|x|xxxx* |_*_x|_ | xx* x|xx__ _ _*_ __*|x|xx| * x_ _*xx_ **|xx||*_|| _ *|_x_*_|*_ |x__**x| _x x*||||*_**|||| x_|x*||_* x |_*_x*xx_ | xx|| *|_ | *x _* * | x |__x*x* *_*_x__||_xx___x|_*_ ___| x*x||_x |_|_x|**x*|**|__| x *|x*x|_xx*_| * _ _* **|*_*|x ||* x_|*|**x_x _x| _ **x |* __**** x *x_*|_ |x|x_*x***xx|__ | *x*_ *** _*_|x||_ _ *_x _ ||_ x *_x__*x||x_*_| _* _|_x __| _ _** |*x* x| x|*_|*x_xx_x__ ***|x x|__|x*___x _* *_*_*|xxx**x_*|x_x *|_|x*_ x _x|x _x|||xx__ |*|x_ |||_|| _* x* x|_ *|x|x*|| *_x_ _*xx***| *|x _x x | *x**_|x xx **xx*_x*||* ___ *|||**|_|__ |*|x _|x***xx_| * |x x*x*x|| _x||x x_x |_ *_| _ |*_*_ x* x|x_ x __|*x| |xx |*|*x|** __ **___xx_xx|*x *|x *x|_ _*|*___x x_|*|xx_ xx_x*x **| x**_x_*|* x*x |xx||**** * _* * *___|_|*| |**__|x_||xx*xx**_*|| |_||_ |x| *_x*|x*x|*x|*|_****| ***x|_* _* *x_ ___|_x||_*x|*x ||xxx_x_x ___x | * xx_ *||___x** | _x|*|_|_|_xxx || |x_|x**__xx|*_* __ _ *| |x |xx_x*|_xx||||_*x *||** _| **x |*** x*x*|x| _|**_|__ * |***x| |_x*|**xx|xx*|*_* |_***||| ***_*_ |* *_x* *x |_*|xx__ *x|||*_xx|_x**_x * _ x|x*x|x *|x |xx| ||_xx* x_x| _*_x_ * ** || |*|***| xxx_xx*x_ ||* __||* *|_ _x|*_**|_* x _x |*x** |* * x*| || x**x__ | | x *__x | |xx_*_||__*|_ *_x xxx| x **x|*|xxxxx|*|*_ ___ |x*_xx|xx** ||_ **_xxxx* xxxx | __ |x|*|_ x*|* _*_*xx *|_ _ _ x__ |_x_x*_ _ |__ x_ _* _|| _|*x||x|_** **_ *_x x*|_*_*_x*|_| |xx*_|_|| x*x|*||_* *|* *__|* _|| |___xx_ *__x||*x|_|x_| _*_ _x*x_ x_x_ _ ** *__xx_ *xx _|||x*_ *_**__x_|_*_*x__*__ x|__x*|x _x__ xx||_**x_ x ||| _|* *_ __|x_|*xxx |**|_ ** x|x _x||_| xxx** | |* x____*__ x |**|_ ***_x*_* |x||_* _| x _*xxx x|x|_|x x|_ | x |_ | _x||*||x|_x _x__|x xx _*||xxx |*__ *| *x|*___xx*||||_*__|_||xx_| x*x_*_*xx*x|*x x_| | _* _|x| *| | *___|x||_ |_||* |* x|_* x * _x *x _ ____| xx_x* |xxx_*x _*_x|x||_ |x* x*x|**___ _xx |_*_ * *x| x|* *|*_**_x * _|*| ||xxx|*||_||x_*x_|*_ |*x__xx __ |x**x*_**x_*| *_x _||*|*x*| *** _ x ||_x |x_x*x* ***_x|*xx _|_x*x* x | |* _ _x* *x_x|x**_ _| | _ xx __| *|x x | *x|*|xx __*x_x*x*|x*x _| * || x*x *_ |_*_x|x_xx*x_ | | * ***__x|*xx |_||x_x**|_ *x _xx |x*|x_ |x__|xx|_**|x x |x |*|_x*_ |*___||x |x *_xxx|x| ** _ * _*x| __ |xx**| __ x x x_*x___x_ | _*x_*|_ _x** *|*x_*** |x*x_|x|x|_*_x_* x_ | || _||x |** xx*__x| _|**|_*x *x_|_ x*x* _* *xx__*_x_x*x*xxx | **x_** **xx *|||_x_*_ *x*_ x |x *****x x_ | *|***__ xx_x| _*x_x|| |x*x_ |* ** x*x _xxx x_x*|x_|x *|*_ _*_|_|x*|_* * x*xx**|xx*|_|*||x_***| | |_|x_|x*x*_x***_ _**|xx || x|_x*x| xx_x* _|x ****_|x||*_x* _| *_*x_ xx*__ x__ _* x|*|___*x_|_*|| _|*|_*|* || _***x |x_| x| x *||_*x _|* x* *_ *_|x| *x xx| * _x__* x_|xx|x__x_|*_|*_x *|x x|x*xxx * x|_ ** x||*x|x |x|xxxx x||x *|_x **x** *|_ _|| *xx|| ||__ |x _** _||| **_|*|*_* _|||xx_x**|*_|xx|_* xxx_ x_ *_ *x** |_ x * |_|*x**xx*_x|_*|xx**x xx |_x||_x*x|*x__*_| _*_| | |x_ |*_x **x**_|_|_* |x*|xx x|*|_|||_|x*x |_|*_*__| *xxx |_*_|_x|x*_||_x*x _* x * _| || |x |x*__*xx x xx|_* _ *_x** *****x*_*x*|x|x x x |* x*_*|__x_ x |*|* ||_x_**x* |*__x * _*|* || __x**__*x*| _x *_*x*|* ** _|__|*_* _||x||__| |x _ _x ||*x x**|x ||* _||||__ *xx| |*|x|*|_*_|_|||**__| ||_x **_ | *__xxx*x|_ *|x*_|*|_x|* |*x*x|* || *|*x *x _||_ x_ _ |__| _|*|x * |x_____|_ x x| **x||*|_ __ * x__****| *|x_ x*xx x || _x_||_ _x_x*x*_x_x *_|||_x|__| _| |x*x x_| * x*x||*_ x _| ** *_x x*_ *xx** _ _ x_x* _x*|*_*| *_ * _x*||| *_*x__x | ||_xx**x *xx*_x_|*x||x*x|_| |x *|* _xxx_|*|**x*x|__x| * **xx* __ ** |_x _|__x| **_ |x_*|xxx__***_x*xx|_* *x_ *** ||x| |_*__|_|x| _ x|x * | ||x| |_*_***|*x_xx*| x_x* *_*__ _x * x * *__ * |x|x | ___x*||* *||_|*|x*_| *x|_||x*|||xxx|_ _x|* _x_x| ** |_xxx_* *||*x||__x_x|*x|| |x _| ___|*| x_|x|*_**x_|x*_x_ |x**_xx**_xx*x |xx|*|_ * _*|x |x*|xx _|x|x *x| |____x|_ _|**|_x*x**|| x**_||_|*|xx *|x __||_xx ||* __|x *x_|x_|_x |xxxxx|** | |*x _|x|x|x*|| x*_| _ |xxx_x ||**x| *_* |*__ |*|**|x xx** *|_ | __*x_x||*xx |* x|**|_* x**_*x |x_*x*| * ||**_ _*_x* _xx**** *xx _x_x_|*_x**x _* |* _|xx|x_||* |_*_* _*|x **|*|x|x*__* |**_x x_|x_*|__|x **x|__xx |||_|* *| |* _x| *x _|**| _|x|_|| **x _xx|*|_ |*||x|| | x|x|x****__|* *|x ||x***|_ x|x ||_*|**_x_x *_ x|*x| x x _ _x||xx xx_xx*_x x||| xx_ * *|* _*|xxx*||x___*_*x *|x*__*|_x xx_x* _ _xx_ _*xx|_*__|xx *|||xx_x |**x _ x | x*x_x*x__xx_*x xx__x**_ _x_*|*_|_||||** _|x*_|x_x|*_x_x|_ xx* |x*x*_ x**x| * x_*||x_*_** _|_x|**x _xx*_||x|x|_|x__ _x| *| *** x|**_*xx|x__*x *_ _xx || _ ** xx x| xx|x*| x *_|x*_*x *x*|_| |_|x* *| *|*xx|_* _| *|*_|x_*___x*x|_**x *x*__x|xx x__ *| xx_ *x | _||__*x _| x|* x*||x*x x**||x |*|** _| *|x* |_ x |||*_x* |_ *x x x|*|||_x|_x||||_||* **xx*x|*x_ *xx x| |*_ ||x_x* |||x|_ x_ _**x* x*|||_ *x |x _x*_x _ * *__||_|_ x|x* *_ _x_*x |*|*x *|** x *x_ | *_x *x_ __x*|_*xx_* _x_xxxx x **x_|*||_ x*_*__ _|_ _|*x|x _ x |xx__x*xx x _||||_**|_x x____ *x*x*|_*_|*x_|_xx_ _x* *x xx||*x | |* ||xxx *x _x _**x_x||_x* |xx**x*x_xx*_*_*_|_*_x||*x ** x__ xxx_ x_ _x**x*x | |* _ _x |x|x|||x_||_***__|_x_ _| *x_ __ __||_ x _x |* ||*_*_ |**x|* x_x|x x_ xx|*|x_* *|*x*|| __*_|*_xx|xxx* |___xx*x *__x||*_| x*|* _|** |___xx* __x| | x__|| * *_x x _|x *xx**_||x|_x *|x_||x x* _|*|*__x*_|*x ||*_ * |x||_x* _ x*xx|x*xx *x_|***x__|_|x_|x__*x*x|*|** x__|xx x* _*| _* xx_x*__|*_x_x x* x _x*xxx|***_x|*|x_x|| x x**x ***x * x| *| x*x|* * | x*_*xxx*x|_xx||*x___ _*x_x_|_x_|xx* xx||x|*_x***|* x_***x*x*|_ |**xx|**_ *x xx x_ |x|**_*|**| |*x* | _|x__||*|| x *x|*|_|*_**__*x*|*x*|x|*_|||_ *x|*_x*_xxx|*|***_x|x*xxxx*_* | | _**x_ x* |||_x*x* *x_*_x*|* |***_| x_|x* _ *_*x| *| |*x*_ x ||__*__x_x*x**|| |*||_*||| *|_ |*||*__xx_* |* _ x** _ *__ || |x |_|__ |***|*_||_|_* || |x_x_ x|*||x__ xxx*x* _x*|*|__| _* |x* * _|__** _xx*|_x *_**_ *_ __*_ x|_*x_ |* |_| x| _ _x*_*_x _ |** _| x_xx x* *x_ x x_ |x_ xx__x**x ||* **x_x|||* xx|x_x**xx x*x*_ | xx_|_ ___|*_x *_xx|__ | *|x*|_xxx||*_*_* _ x| xx |x_x| *_||_||_x_x* |* ** |____x __xx*_ x_|| **_ x_*|x*|**x*x _xx|****_*xx x__ | || * |x *|x|* __* *__**|_x_x_|| __|x_ |_x*_x|| *_*|x* |_|_x_*|xxx xx*x*x*_ x*x__x|x* | _*x||x***xx *x*_x**_ * x _ _|_xx|* |___| x*** | * x* _||xx|_xx |_ *x**|* x_ | | ** * x _ x * *x x|*x_**|| |xx_x*|x*x|xxxx_x *_x|*xx*| || _||x *__ *|__*x|*__|*x*x__ __ _ x*|*x| xx|*__x* x| ||| * x*|** |x||x_*_ *xx||x x__|x|x||*_x|xx**_|||x_x*|** _ * | xx_x|**x_x|*| *_x_x_ xxx||_ xx| *|*|xx|x _ __*_ _ |__|x|_| *__x___ *x*_ x**| _ *|_| |*x *_** _x_|||| *|* _*| * |* x_ * | _x_||**x__ |**___x*_xx ** |||* xx|xx| * ||*x*x_xx|_ _ | *| |*_ | _ x_*|*|x*_|*x*|*x*x_x* **_xxx*|x___*xx**|| _ *|*x| x*_ _x| _| _*x*|x***| xx*x|*| x*x_*x_x* __x | *|_ *_||_x*x_x|_|* |x*|_ __| |x* x *x|||x ||| *_* _| x _ _xx*** _|x| *_*|_|_x** | |* *_x__ ___x*_x*|_|xx x x|*x_x_ _ _* xx|x__xx x**xx|*||x |**|x_|*||_ _* x||*_ |x* *x _ xx*x *x|x|__|**x|x|x | *|_|*|*x x__ * *| _xx *|***__ || x*_|*_|x*_ ||*x| ||__* *x_*_ |x*xx**|||_|**_*_||* | __|*x_*|_|xx|_*__| x*_x** *** **__||| |x _|*_ _| * *x***x__* _*_x|_x |__**| || *xx*|||* | _**_x*xx* || xxxx| xx |_|_|x||x|**x _*|**|**x_ |*x _ |x*_x*x_| ||| x| _ x_|xx|_*_x_**|_** ||xx_|*|_*_| |*x |x|x||* *|_* _*x*_ _|x_ |x |*|x_x *_ x|xx_**x _|x_*x_xx*_|**x* _x||x *_x__ xx|__*|*|_||*_||x| x__***|||||*x _x_|x* |**|x| _x| x_x*x_|x|__x___*__x *|_| |_x|xx x *x*_ x_x|x x | x* ||x_||***xx x |*x*xx xx *xx_*_*_* |_*x _| _x** x|x_ **_ x_ xx__*| x* _x | _||x xx||||__x_* ||_**|x* | |_|*x_ | x xxx||__|***_|*_*x__**x* |_x* x x*|x_xx||x||| *_ **_|x*|_ *_|_|* * | _x***x_ |x_xx_|_x |*__x|*_|| * *| *_*_ x* *|** _| _|x _*|***|_|*x|||_ _* x *| x_ * __x|*xx x*_| _ * *|***|**__|| _ * x_ **x * _|_|*_||*|*__x|x* _x _*_ ___||_| ___*_ xx|x** x* *_ *_x***_*x| |xx_ x|x_|x_|x_ xx _x_ * _x* | x_xx*x__xx||x_x|_ *|| * x||*___*_ |*|_*___x |*__x *x| *|x_|____x__*||__x x__**x|_ *x _| _x*___xxx_|_x*_ _x_ x|x___***xx_xxx_|*|x _x|_ |_x x_*_*_x** ||x|_*xx_ *|_* _*x* ** xx*| _ |_xxx_x_*|__ x|_| _xx *x*|_*_x* *x_**xx x_ *_|x|*||x_|| |x|__*x* |x *| *_* *|*_|_ _ x x**_xx|x *|_ __x**|* _x x |*x| x*| *x**x_ x*____*__xx | _ **x|* __|x|_xx*xx_ x*_*x| *__xxx* | xx* ***|xx x|_ _|* _|_*x_** _x __|_*_ * x*x_||x xx| * |___x|x x *|| x_ _ x_*** __*x ___***x| x __ *x* |x**__x*|x_ *__*_x_xx**x* |* |*x|x__|xx__ **x|_| x|*_x _*_ xx||| *_*_ |**| *|*|_x__* ***x||_ || x*x _x| *xxxx * *x ||* *x|x|x |**|x | x _****| x* *__ |xx|| ____x|_x_x _xx__*_x|__x*_ x|| |**_* x|x _x*x *x**xx**x__ _ |**_* x| |**_*x| _x|x|**|*||_*x|__x|__*xx|*|| *_x |*_ *_**_x_xxx*_x_|*x| **_xxx***** x*__|***|x **|_* _| * |x * |_*x |* _|*xxx_|_*_*_|*|_ |*|*|_|||| |*_*|*|_ _x****_x_**_***x _x*_* **__x* _| x xx x*_ *| *___||* **___|*x*_x**_**x*xxx *|_*|||x**_|_ _|| *|* _|| *x*x_ |**| _ _*x|__ *||xx|*|xxxx|xx ** x|_|**x* * * _|x*| *_|x* *|| |__ ****x_|_ |_**|x|*_||__* *| *|x*||*x|x ** |*x||| x_ x*x_|xx* |x_*|__ _* *|*||*||__ _* x_ x*__|x|*_x x||||_|_ * x_*x*|x|*x__ x||_||_|x_x| x x_ * _* ||_xx x||x| x***|*_*|*|xx||_ _||*|x* x|_x _*|xx*x** |||_x_x_| * |x*x** _** _|xxx_| *__|x _||* *_x_*x|_|x_|_| x | ** *___*__*xx ***|* **** x|*|_*||___x _**|**|*| _x|_x*| *|| x*__| || || x |||*_x_x x |*|*_ x| _x* _|x*x** *|*___x|*| *|x||_ xx*| *x|x*|x* ***x_*_|_*x||*x| x|_*_x_x * x* |_* *____*_x_x*|* _ _| x* |_*x** |*|x_|_*|__x|x|__ x|*_x**|_ ||___|* *|*|_xx____| *|*|*x_**_*_* **x |_*x| _**xx*x _* *|_x _ **x_x* _|| |_* |___*_*|_* xxxxxx|x*_| | *|xx*xx_* |x__|| ||* ** |x |xx|x||xx**xx|*x | |_xxx |_ *x_x xx|x*x*_x__ _| x |x* *||*_|***| | *x|_x __ **| x_ _x|_ xx*** x_*|* *__ ||||_x |x |*|x|**|| _x|x*_*|| xx|* xx|* |x__*__ |* |||_|*_*_ x_*_||||| *|* _| * _*xx||*x _ |x*_ *x|_*| _*|* |x||x*|**_*__x x_| | _* _ _x _ |*_|_ x | |xxx*x__|__***| |_**x||xx___x x_ x|_ |x_x***x_**|* || x|_xx*|||_ *x*xx _*__ |x*x |_***_xxxx**__*x **____x_ **_x**|x|x *_|_xx*_| x_* * x||__* x * *|x**x| *__|| | *_|||| _*|x|*x xx *|**_ x_x___x_ _ *|x_| *_x x|| _x_x*|x|*_x_x x**|x*|_xx _|_ |**** _xx|x x|x| *_ ***_|x_*_ * * ||_ x_|_xx**||** x | |x_||*|_x*_| |* |x _| xx*__x* *__|xx* x* _x_ _xx*|*_ __*_||| x_ __|x|x_**__x__x* | *|_ _*_| x_x_||*|_|x* _xxx* x*||_*x|x___|__***x x|_* *x** x |x|*||_x* | xx|*|_|*x||***x*_ _*x|x_x__xx __***x**||*x _*|| _x** x|xx x_ ******x|x ||x_* **x |x_ __ * x_*xxx__x x x x_ __x___*|_ |*x* _x|x*xxx_*|| __ ***|x*|x || | xx|_ _x *| xx_* _| _ ||__ x_* __x _* x_xx|xx||xxx*x __**__* | *x* x _x***|*_x* x*x _*xx*||xxx*|_x_x|__ __x*x*x| x*xx* * _| |* xx|x*|*|* _|*||_ xx*x_|x|| | x_xx __x___x_x_|*x_x _|||x|_|_x| _ |*xx| |x* xx*x_ |*|_|__ x* x*||| _ x*x|_||xx_xx| _*__*_*| _ * *_*_|| _|x*_ x|_*|* x xx|x |* * x|||_ * |*_*||| * * _ x|*x|*|x_*x|xx|*_||_x|xx|x_|_|* x *_ |* |_x* *|_||x x* _x* __ _ *xxx|*_x_ *|* |*_x_ *x_* _x *_** _*xx *x |xx||*x| **|x| |_ |_ |x|x**_x *_*x_|**_x x _ xx**||x**x _ x*|_||x|xxx* **_ *_ *|_**| |_x|||x| * x | x|*|_x*x |*_*_x**_*|xx_||*_|x__*x** | _xx_||_xx||_*xx_x|xx*_xx_ *xx*x*x x_ * __ |_*_*x __|**||_*x___*__|__x _x| *__| __|_*|xx* x_| _*_|| | _* _ |x|x **_ |_| || **_x **|_xx* _ x x||| _* _| x |* ** _**_x_* |_|*__|| *_*_xxx x*x_*x_|_|x*_*___x *x| __*|xx|xxx _ x*| _|x **_* *_|| _*_x|x _ *_x*||_x| ***x___**x|x_x _x| |xx *|x* x*x|||x*_x|x|x |__*||*x_|*x*| * x*__x _|_*| _||* x* _|_ xx *_ *|||x_|**|x*xx_|_ xx_||x_|_ |_ **x|_ _ x*___*|xx_| | |*__ xx*x x x||x *x_ _xxx|x__x** **_|x_x__ | x_|* *|xx*|_* _x*|x|x||* x|x xx*|*|___xx*|*__x_* ||x*||x|__*|_|_*x*_x|****_||x | *| | xx ||__* x_x*_|x__x* xx_ _|** * *x|_ *|**_| x| x** *|xx *_x_ *_||_**|*x* xx x _ x_ x|x|_|*xxx **xx*_x_*__ x*x xx x|_ *_|x*| xx| x_|*xxxx|*|*__ x _|**xx*|x *|* x*_| *| xx| *xx ** _**x___ |_x_x_|*__x_x__*|x_ x**| ** x|**||||x x x*|x*_x*** x__ *__| *x _|x_x*| * _***|_|***|_|| _ *xx |x xxx_x*_x| xx*xxx| ***x|*x|||| x*_*_ *_*|*|_*|*_*x*|***x _ **|x *x_| * _*_|x_|xx| | *_*xx xx*x|*x _|x _ x|_|||_ ||_x|| _|*_ *|* *x|**__ ***| **|* *_|||_xx _| __x|*| |x*|_*x **_|xx _
+ + \ No newline at end of file diff --git a/code_base/bgs/5_files/blizard.js b/code_base/bgs/5_files/blizard.js new file mode 100644 index 0000000..97305a1 --- /dev/null +++ b/code_base/bgs/5_files/blizard.js @@ -0,0 +1,148 @@ +//blizard.js version 0.5.1 BETA by Rohan Samra-O'Neill +/* +uses the atomo.css library created by Rohan Samra-O'Neill +*/ +"use strict"; +//inspired by jquery and p5.js :), thanks to p5.js and the processing team for featuring blizard.js on there site +var sl = {}; +var id; +var storage; +//just a little message to anyone who goes onto a website that uses blizard.js +console.info("This project uses blizard.js for more info go to https://github.com/Slitherlizard/blizard.js"); +//with sl.ready the parameter is the function that will run when the page is loaded, i needed to add this in version 0.4 because it's a DOM library and functions wheren't working because the elements couldn't be found because they werent loaded yet +sl.ready = function(sel) { + window.onload = function() { + // basically just runs whatever function that the selector is equal to + window.setTimeout(sel, 0); + } + + +} +//with sl.print the first parameter is the id of the element you want to change the second is the text you want to change it to +sl.print = function (sel, txt) { + + + document.getElementById(sel).innerHTML = txt; + +}; +//with sl.hide the parameter is the id of the element you want to hide +sl.hide = function (sel) { + id = document.getElementById(sel); + id.style.display = "none"; + }; + //with sl.show the parameter is the id of the element you want to show + sl.show = function (sel) { + id = document.getElementById(sel); + id.style.display = "block"; + }; + //with sl.col the first parameter is the id of the element you want to change the color of, the second parameter is the color you want to change it to + sl.col = function(sel, col) { + document.getElementById(sel).style.color = col; + } + //with sl.family the first parameter is the id of the element you want to change the font-family of, the second parameter is the font family you want to change it to + sl.family = function(sel, sel2) { + document.getElementById(sel).style.fontFamily = sel2; + } + //with sl.size the first parameter is the id of the element you want to change the size of, the second parameter is the size you want to change it to these are the sizes you can use +/* +xx-small +x-small +small +medium +large +x-large +xx-large +smaller +larger +*/ + +sl.size = function(sel, sel2) { + document.getElementById(sel).style.fontSize = sel2; +} +//with sl.wait the first parameter is where you call the function you want to run, the second parameter is the amount of milliseconds you want towait to call that function +sl.wait = function(sel, sel2) { + window.setTimeout(sel, sel2); + +} + +// with sl.setlocalstorage the first parameter is the name of your localstorge item so that you can refer to it later, the second parameter is the value of your item. +sl.setlocalstorage = function(sel, sel2) { + localStorage.setItem(sel, sel2); +} +// with sl.printlocalstorage the first parameter is the name of the localstorge item you want to print the value of, the second parameter is the id of the element you want to print the item's value to. + +sl.printlocalstorage = function(sel, sel2) { + + + + + document.getElementById(sel).innerHTML = localStorage.getItem(sel2); + +} +// with sl.click the first parameter is the id of the element you want to add an onclick attribute to, the second parameter is the function that will be ran when that element gets clicked +sl.click = function(sel, sel2) { +document.getElementById(sel).onclick = function() { window.setTimeout(sel2, 0); }; +} +// with sl.id the first parameter is the id of the element you want to change the id of, the second parameter is the new id of that element +sl.id = function(sel, sel1) { + document.getElementById(sel).id = sel1; +} +//from line 92 - 124 i think i liked inporting other librarys too much +//just loads the atomo.css library for styles +sl.atomo = function () { + var head = document.getElementsByTagName('HEAD')[0]; + + // Create new link Element + var link = document.createElement('link'); + + // set the attributes for link element + link.rel = 'stylesheet'; + + link.type = 'text/css'; + //load atomo.css library + link.href = "http://atomo.ueuo.com/atomo.css"; + + // Append link element to HTML head + head.appendChild(link); +} +/*sl.import does not work yet :( + +sl.import = function(sel) { + var head = document.getElementsByTagName('HEAD')[0]; + + // Create new link Element + var link = document.createElement('link'); + + // set the attributes for link element + link.rel = 'stylesheet'; + + link.type = 'text/css'; + + link.href = sel; + + // Append link element to HTML head + head.appendChild(link); +} +*/ + +//I have wanted to add this since version 0.0.1 but didn't know how but now i do know how so i'll add it. + +//with sl.createElement() the first parameteris the element you want to create like P be sure to wright it in capital letters and the second parameter is the element you want to append it to the third parameter is the id you would like to give that element +sl.createElement = function (sel, sel1, sel2) { + var father = document.getElementsByTagName(sel1)[0]; + + // Create new Element + var elem = document.createElement(sel); +//give the element an id + elem.id = sel2; + + + + // Append link element to HTML head + father.appendChild(elem); +} +sl.changeBackgroundColor = function(sel, sel1) { + document.getElementById(sel).style.backgroundColor = sel1; +} + + diff --git a/code_base/bgs/6.html b/code_base/bgs/6.html new file mode 100644 index 0000000..111c834 --- /dev/null +++ b/code_base/bgs/6.html @@ -0,0 +1,29 @@ + + + + + + + 01 + + + + +
x|| x x|___*|x**| x_|**__x_xx||| ||||xx*|_*_* x|x_* *xxx *|x _x*xx||| |_|* * __***_x _x____*x xx x x x****x _*x*_xxx __*| x_|x* x_x _x _x | _ * _** ** *_*__* x|_ |_x |_* x **x*_*||*_x* *|_**_xx_ __| x*|x__ *xxxx x_|x*x_x**|||x x_* *x|_ |*| *x|x x||x*_ |x__ _x_ __*_*|_*x_|*x_x x _xxxxx*_xx |* _|_ *__| *__|x|__*_*_ || x* ||_ x *_|xx*x_*|*|*| ___ __ |* *| | *|*_|_ * _x_ * _x**||x___ x_xxx** *__x||||| |_xx |x**_x| ||x*x_ x|_||| x ***_ x x* _xx x**|||||_* *_*_|| *x*_*_ x_|_ xx|||** * **||_**| **| _ |** _|*xx_*_*x|x*x_ *xx_* _**_ _ x_ _|x**_*x_**_xx * _x|_xx|*|x|x*_|*_x||x |* |x*|*_*| _*x|_ __| x_* *|| | _**x_ _|__xxx|| |xx_|*x|x| _x**|x |xx *x |_ _*_*||_*_x ____| x****x__xx_x|_|_||x_x *| *||*|*x|x*||* **|** x* x|***|x* _***|*_ |*|*x x*|**|| |_*x|x_x *|**| xxx|_*|xx x _|* x* * *x|_|*_| xx_|*_x * _ x x_|_***_**|_x _x*||| ||__**|x*|xxx *x*x||_* |x** _ __|x| x___|x**x x*|_|_|__ x* | x_ ***_| *|x**x*x|__||x||* _x||__ _ * _*_ xx*|_x |*|*__*x_x x|_ |x|x|_ *x*x|*|_xx x x*x*x||x_ |** |* |* * *x x*x|__*_|| _*|| | ||_|| x _|_|* x ||xx|x_|x*|| *||_*|*|*_ xx|*_ _x** *___|* *|__*_*x _x**x **_||| x_*| *||_x||x*xx***_x|||| |||_ *||_ |_x__ ** *_|| x|x |**_| _ _ xxx*xx_*_*___ _ _*__| x |_x_ _xx |_x *_x *xx|x_*x x|__*** * _|*___*_ |||**| *||_ x_x|x ____x|*x**| x _xx_|*_x _|_*x *|_*|_|*|_|_|_* |_|x__ _|__ *|_|_** __x|xx *x_ *x| | * ___x|_ _* || **xx|| x||x x_ |_x _ |* x*|*_xx| x *|xx| __*_ | _ xx| |x*|_| x _*| *x |x||__* |*_*_|__ _** x x__x *_*_x_*x* **|**_| _|_* | | *||x|_ x*xx*| * *_ | x_|* |xx*x**| xxx| _x__ |x*_||x*|* |_| |**_ x___ |*| x *_x*x| * _**_xx|*| _ | *|_* x_ **xxx_*x_*_x xx * _x|*_ _| *__ x*_x**x|x_ xx*x**__**|*x ||*_|*||_x|xx|x|*|_x**_*_| *|**x_*|* x_ x xxx **_*|| *|_*_x*x*x* |x__ __| x_ |_ *** x*|_ |_|_x_| **_x * x*_**_*x|*x*xx_*||_x x_| _x x | __xxx*|**xx*|x x|__**_ |x|*_*x*_|x *__* x*|*|_x*|__| __|*|* _*_ *_|* x_ x _xx| _*|_* xx* __x**x|x xx*| |x_* | * x |*x_xx_xx||| |x*x* |__ __| |* *x*|**_x||_xxxx|xx* _|x* * ||_x_ |x | _||x xx__|x_x |** *| x|*_*|x| *_*_x *x|**xx|xx*x|__**|| *_x*_ |__*_||| xx_ *|x | _|xx | x xx_*||*|||*x** |_*x_ |* | _ | ||x_** x|x_*|x x | _*** x||x||*x_|_x*_|xx * **x* _ * x | *|x|xx| |xx x|x * * _ *xx*__ | _|*x* *|| * _x*x|_ _|xx**__| |xx _x__|xxx__*x_ *x* ____ _ x*x |__|x||x|x*x| |*_|x*xx_ |x__x|||*__x*___x_|* __|__x* _ |x *| *||__| |||_ _x*|**xx__| * |x x_xx||x **x|**x __ x_ |_ _|**_x _ _x**|x *x**_* |x*x x *_x_|*_* ****x || *_*xxx_|_xx_|_|_||x*__|*xx* *|_|_**|x ||_|||*x |*_*x*x*|xx _ xx* x x_|| xx|**x*x_ *|__ _ _| *_x* _* _x__*_|_|x*|x|||*_ x||x _ |_*** _x**_ _*_*_ *_*|* x__*x* _ _x*x_ *_* |__*|**_*xx**x| x _ _*__||**x*| x*|__ _x xx|* |x**x___x|__|__xx x x| *_x|_|_|*|| x* x |_* *|x_ | x|_x x*x_x*_ |x__x_| *xx x|_x*x|* *_*xx_*x_x _|*||* x*| | **_x|* |_| * * *|x___| __|* *__x*x |*xx*_** *x x ****__ |_|*_***__x* * ___ x*x_xxx* |*_*x||___*xx*xx|x x | *_ __x __*|*|**|||*x*| || x_x|x x x*_ _|_x x|__ x*x _x |x| ||*|*|*** _ **_**_x*x_*| *_x*_|__x| _| *_|| xx| *| ||_||x_ *x_*_ __x _| x*xx_ _* x x*_x _x|* _* *x_ x_|*_x _|_ || |*||__|| | | * || _ __| x x|||_***x_ *_ *_|_**|_ _ *|x|* x|x*|x_ *x__* x**_* _ | |* *x x*x xxx_ * *|x_*_|**| *_x* *_||x||*_|*x _|x*| x*||| xxx| *_| | x|xxx*||| xx|xx|_x***|*x_ __*x|| |_x |_ _x_||*_ ||x_|x||_||__| |**|_x| |**_ x| ||**_xx__x x_x|_x__x_|| __ _xx||_** ** |xx|x ** x*xx*x__*x|**|| |*_|**_|* |** x_ ||x_|x _**x _||_*x*x*_*x_ *_*** |*x_ x* *x|*__ _|_|x_x**|xx*_*x||*|x|*** _|| x_xx*|__x| * x x*|x*x __ ||x__ x*_xx*x_|*|_|x_x_ |_*|__ __x*x* _ _x*___x_x * _*_ _ x__|xx|*||___ _* x_*_||x|_ *|_||| ||xx _x_ |* *| x x ___|_ xx_ *x__ _xx***|***_*_*xx|x_xx|_| x* x|xx**x** _|x_ *||*_ xxx__x_ __ ___ _|* _|_|_*|*| |_x______|* *x_| _*|x| _x*x* | * x*_*|xx |x|_x **x **|x xx_ *__x_*x* x x_*||__*x *x|***_||_*||x|*xx *x * *|x|x||x|xx|*|_ _x_*| |*| |_|_ |*x|| *|_* _| x*_|x _x|x _*|* | _ x*x _ x| _|*_|_|||_*x| x x*|x*_x x _x _ |_x* __ x x_ x|| _*|x_ x_|*|_* *_x xx_x|| ___**_ _*x_xx * x_ _x x|*_|**___x|| xx*_|_*** *x|_x|*||* __ xx*xx x**x| x*_x*xx__|xx**x*||*_ _|_|x|_ _ *|x|*x *x*_ x|xx xx_x|x |xxx*x x x_|**|*** x*|xx *xx__ |__* *_|_ _|_ |x*|*|*| x|__xx **xx **x __| **xx|_*x * *|_ _ ||*|x*|x|_*|* || || | xx__***x_|||__x|x|x_*xx x ||* x__xx x|xx*|||| _**_ x_||* *****x* *| x *x | x_ |x |_xx _x xx_|_x|||xxxx_* * |x*xx|| _* ***|*_*|*|x *_|*_ _xx| _x_x_x xx*| _*____|* _*x| _x*_x _*|*x| x_|_|xx|*_ |x* __ |__x| *| |x|***_ _x| |*_x* x*x* | _ || _**x**| |xxx_xx|xx|x *||x*xxx|**_| |x_x_xx* _* x*x|x |**||| _ x|** |__ ||_*x|**_*| _*|__ xxxx_ |xx*|| |*x ||___ _x||_ x*_*__x* _x x|x |*xx||* |x*_|*_ _x | x|*x_x x x*x**x |x***||__* _| _| __ |_|x* * |_*__ | _xx*| **|*** _ ____*|| *|x** _ _ *x|*_|_| x_*x_x_| _**|*_ x _x*| _||x x_|x|_ **x_x||||x* |_|x|x*x_|_|* x *x | * x_*_*** |_ ___x_|||* x|_**|_x*x __xx_|***x xx_x*x||**| xx|__ |x*___xx_*x*|_*__x*| x | _|||* x** _x*_** __|_x *___|x|* ____xxx|_| _ |* _| ** _ _**_x*x *|_ x*_x*x|_|xx|x_ _*_||* x x*xx x|x||_ *_x* *___ __x *|| |**__ *_*x|_ || | x _|x | x_*| x*| *| _*x* | _x|*x|_ _||_|x||xx|| x |_*__x* |_xxx_x_| |||| x| |_|*|| _|_ |* *|x* **x|*_ *x _|xx_||*| x x *x_xx_|_*_***** __|*|*|*__|xx * x |x*|xx_xx__* _ *_|x* ||_ xxx*x_ | _|_|x*_ xx|*x__*_*__|_xx*x* *_x|** _ ***|x | *x _ |_ ___*x|**x _x| ||xxx|_*|x|__*x | ||_ x_|_x_ |_x|x |x_*_**|*_| ***|_ |*||x*| || *x|x_x_x|_*| _ |xx __ __|x|x|*|**__ * _|__|x |*_* xx_x*|x_ ||**|*_* *x|_** |__**_ x*x __ *|xx*x x |x*|| *| * x_ x|_ *| __|_ |*x||x _x*||___| x_ |_*x||_ xx*_* |_*xx_*x* *| *xx_*xx***___|*x*x_|_x_*__*x_* x*x|__*x_ _x_* x ___*_*|x*xx |x**_|xx__x__||__**x* _*_|* |_ ***x ||xx| *_ |*|x_ _*|_x | _*x_ *x * |*_ | |x_| x__*|__x| ||x*|* x_| *_*|| |||x| _x __ x_ x xx| _ x|_|*x_**x_*x _| **|x*| x**x_ |_x|*__*xx_ *_||**x|x**** _*x x |xx |xx| | *|||_ x_**_ |*|*x _ __**x_*x|| __|** |_x|x|| *_x||*| |__||_ x*_*___ * x*_x_____|*x|x*|x *___|* _**xx **||| | *|||__|xx*_|_x*|**x |__ x|||**||xx*|_*_|||x_|*_|__|__ _|_x_*x*|*__|x*|_* ||**||xx _x _*_|*_*|_|_x|x|_||_ __ *xxx_ ***_|*|| | x*xx_x_|_*|* * x_ xxx_x__*_*_*|x***|_ **|*xxx||*|*|_|x *| __|_x _*_|*_** |_ *_ * x_|x _||_x*|| | xxx_x|_|x|* _ |x|* _*x_| |x|*x|| || xx *| _| x| _||*__*x_*x|__||_| x_*|x|_ __ _ __|x*xx_| x*x|*_* x|||x_| * *x*|xx | _|||_| _ x*|xx * *_ |||_x*||**xxx|** _|_| x__*** *| |_|_| x||xx|_|x ||x| *_*|*_| |x|_ __*_ _x_*x*__* _*_*x_* | _ *_|| x||_*|**|x|_x **_ _| *|***_ _*_xxx__x_||_|x_x*|*x_ *x||* xx_x** x|_*** xxx*x||* x_x_*_*x|* ___xx_|*x x _x__ |x|| ||| |*x__ * x *||xx ||* x|*|_|x||_ _xxx| x* *x__ **x** x_*xxx* **|__x*|_||* x_*****x* x * x|||_| | |__x***_xx| _x_*_xx||x x_|*x x||x*|*x _| x_| x x_xx_*_x_ ||_ *|*_|*___* x** |x|| |xx|_|*|_ x__ *_|* x |_||__*|*x*|**xx__*_x* | x__|x_** x|xx**_|*||_x* _** |x_x x||__xx**|_|_|*_*xx _ *||x*_ *_x x*x*x**x*|||*|* |_xxx|*| | |||_ *x_|__ x |||xxx * *_| | |*x _| _x*_x||x x ||xx*xx__xxx*____|_ *x|x_|_*|_ ___||_xx**__x_x||_ *x|xx _|x*_|_*_ _x___|___*x_x_* *x*|_ x_* * x*_|x*_|x*_ _*x** _x *_* x | x_x_*_*|xxx _xx | x*_*__*x x||_*|__* | x_*x *_ _ _x_| _ x*| * x _xxx_x_*x _x|x xx**__|x*_| * |_x|_x*_x** x_|** x_ _*x _*_x _*| x_|x*_* _*x_*__x_*x * _ x_*_x| x _| *| _* x _* _* x |xx *_*_ _*_ | *x x_| * __x*| _* |x*|_ _*x x _ _** __ *_ | **|_*_xx__ |_ * |x| * | _**_x*|_||||x |_x*|_*x _*_|__*| |_ | x_|*_x x* |____x*x|* *x x||*_*_xx* x_ _*_**_*x**__x_* _|x_| ||x *_ |* * * _*_|x**| x|_ _*|*x _ _||*_|** xx |_*x||_*|xx|xxx___|_ |x*x || x||x*|x x x*_*|* *x x_xx| xx|*|_x| x|* *x**_x* _x** _*_ *|*|***|xx* *_ _xx_|x* x ||* __x**| x | *x _*x*|x*_x *|_*| |_** |xx _** |*| *|| x|*x|_*_x xx*|x*x_|||__*x||***x x|||_xx* x|x* *x***x|* _x| | |x*|x_xx *x||xx _x|x |*_|_| *xx_xx x** x_ ___|x| x |x*_ *xx_*|** ** _ *_x__ |_*_|_x _|xxx|___|x__x_xx _ _x_*_*| x*|* |*|_x_|*||x* |x|** _ * *_ *x*x_|*_*| __**x||x_*__xx*|_ *| xx* *||___*_**|x * |x__| *x_|*__x_*x|*___*x x| _*x_||__|**___|* *_*x_x|_*_ x*_ _x| |*_|*x |x__xx_ |*| _***| x |||_x_ _x x|xx __xx*|| *x ***|_| _| _|** **x|x*|*x* * |x*_*x|* _| ||x|| x x |_x*_|| xxx*|_x_*_|x_| _x|_*|||*_ _* |xx||_* **||x_ x*| _*xxx|||*|* x_|_x|*x _|_x|x*_|* _ *x**xxx*x _* x_x _x**xx xx_ |_ _x* xx _ * _x__xx x x__x*||||x*|*|*x||*|_ |x|___|x | _x _ *|*|_|__ |*|x*_*|||*__|_*_x * _|x*|x|* x* * *_x*| * | xxx|__* x|*_x _** |*|*|_*_x|_ | x|||*|xxxx *x _ x_*| ||* _|__ |x |*_x|*xxx xx*_ * _|| * _ x xxx| |xx xx**|_|_ * _x** _xx x|__ *|*x_* |_x_*| *x|*x**__ |xx|* * _|x_ _ ||_*x|_xx_x| *x* _**_x_*_* |xx_|x___x_|_x*|__x_ _* **_|_*xx*|* **|x** |*||__xx**xx|x x *_xx *xxx__| *_**_|*|x|||* *| |||||x|x|_*x| |* |_ |||x|_*| |_ *__xx|_xx|*__xx*_x_ _***| |*||__ _ x* *_*_ _|| _|x| _|x_*_|*| *x_|_**||***| *x _ | **_x| * _xx_*xx*xx__x_*|**_x_||||||x*||_|__ ||_x x| __ x*__|* |** xx|||||__| _|_xx|x* ** x|_*x*x||** __ _*x|__x_x_* |__|xxx_|_|_ ___*__|x_*|_ *x |x*x | ||||_ __xx_| | x*xx__ ___xx | * _xxx |*|| x_x|_x_|*x|xx_x *___ _|___|x*|_||_|_ |** | _ x x*__|x_|x| |*x_*x_ || _x||__x |_ _ * _*|x* _*x*_*x**|_||| _* |_| x| *x** _|_x| |x_*** x*|x|| |xx__*x*xx |x |||x||_*x *__|x |xx _ xx |x||||x_x _* *x*xx_ _|| __ **||_|___|_xx*||x* ||||*_ x| x_ * |*x__x_ ||x|_ xx| *xx **x*_|x_x_xx__*|_x* _ ||_|__ *_ x__|*x||__ |xx | |_||x xx_*|||_x*_|x*_|__x|x|__* |_ | __||*|*__ x* *_x_|*x*x*_ _x_|x*xx_x_||** ||_***xx | _|*_x*_x*__* *x |xx||_x x||_|_*x ___ *__***_xx x*||x |_*|*_ _**_ _|*||_* x*___ _|_ x|x| _ |** __|x*|** *||||**|_xx xx|_|_| x x*||* * _x|| |** |*_*__* _|**xx|_ __| ||*_**_ _x |x|x|*__ |* ** **x___|*x||xxxx *||_x__ *|*|||_x*x x x||xx* x xx x | _x__|*|*x*x|x_x_| _ xx|**|| x|x| *__x*| _xx_ xx|x **|x|*|_ x_x*| _x||x*_** |xx_*__xxxx|xx__*xx _| *x xx*_x**x**x_||**x*_ xxx|___|__*_x _xx_x_x** _**|_x_ |x*|||_x|xx***|| __ | x |x_xx * |||| __x x_|x|*_ __**x x***x*|xx*x|_|*_ ___xx**|_| x**|***x__x|xx _* _*_ *_ xxx*_** xxx*_x**x _|*x_ ***x_x_xx* x_|xx*x*x* |*___* xx x_***|__|x x_*_|_x |xx x* _x|**|* *__|_ x____| _|*| x|*x x_ * x|||xx_| xx|****| ||*|*** x_*| |_|x_x*x_ x x** _x**_ _xxx|_ *_*|* _x*x|*x_ x|_x_ *||_ x **__x|_|__|x|*|x__x |_ **_x| x* x_ * _* * x_*x x|*_ |_ |||||**_x*___| **|*| | x * x**|||* * *||||| _*_|x_*x_|xx**x*x|x| |*_xxx|*_x|**|*|* __ xx|*_ _|*|_*_* | *_x*|*x_||*x|x | _* |_x ***x*x* * _* x_|* |__x| _|xx__ x_**xx***|**|_*|**__ _** x_xx||_**x_||x_x|| x||____*_|x__ | *| __x| x*xx|x|x *xx* x| | x__x* x_|*x||_ * _|x __ |*|_| __|| _x*** x_x_ x |__|_ _x| *_* xx_**_x|_x|x ___|_x_x*|_ | x_*_*|_ ||||* _x*** ||x_|xx|x *_x| * _*_*|xx*_*xx_xxx |x** **|_|* _||*_| x* *_ x x |x__xx|_*x*_*|x |x*_xx*_|_* |x| x x**x*|x x *_|_|*** _**x _| x_ x* x|*||__ _* || xxx|x| _||*|**|_x x ||_| *||* x| x*|x*_**x*x**|__| *x_||*| x_|||*|_**|*_|*x __*x |x| *_ x| _ _x _|x*||_|_ ** x_| *x_| || |_||x| |_*_|_x|x*||*x||xx|*x*_|| x_*_x _* __|_**x*x*x _x|*xx* |* __* *|x_*_ __|x|_x*x* ||_| |___x| _x_|*__*_x_*x_*___ ___ |xx ** ||**__ **_x*_ _|x|** _* |x_xx|_|_*|* * *xx*||__* *x__|_*| x|x| | x*x| _ x|_**|x_|| *_x_xx|___ * x*x _ x*_|| * x__ x *xx | _|*_ __*x_* x* _| x|x_*|* __ *_x|*x* |||* *_|**||* x|*|_||_x|x * | x_|xx *_* x*_x __| * *x**_*x_ * |__*|**| | x| *** ||*x ||*x_||* _|x||*| |||x**|___*x _x ___* | x*x| x|__**|x*x|_|| |* xx |_x|*|*|x_*_ _xx _||x|** ** |_|_xx||x*x*_*x|| *_ | _*||x * _ **|_xx* ||_|x_ |xx** x |* **x_ | |* *|_ _*||x |x *x|*x|_ x || *||*x*x_* _**__| _***|*_|x_| ||_x* x x|_x*_ __ xx*x|* **xxx|*| __ xx_* _ _x_x**___ _|_ x_x x *||_ x* x_ xx *x**xx||_| |__| x _x _*x| |xx*x|||__ x||_x _ _***_||_x****| _*|_x__ xx * *|x_*x x_ | __x |*||x|xx_x_|| _x*|* | __ |xx*_|x||*_x*x| xx||x__| *_ _x_| *| *xx_|xx x__ |__*_ |*x|** x x*x_|***_x** **_ x_*_ | x|**|x|* |x _ * | |**_x_**x_x|xxx* *__ *|**xx|| xx|* *xx*_|x|** *|_*x|*_x_x *x|____x*|****|x|x*|||_ x|**_ * | * *_x* |_|_|__**_xx* xx*_x||| x|xx*xx*||x_|x x*|x|_x_x|*_ _*|__ *x|| |x *x*__ x|_**|__*_ __ x*xx*__* x|* |_ *_*_ **** |_*||*x_ x _*_*_||x|x___x*_|||x|*_| |_x*||_|x*x*x*||*|||_x*x_*** ___x_|x|_*x _ *x*xx__* |*x|* ** |xxx_ x * ___|x|* _ x_|_|xx**x_ x_x| |*x| |x* x__*__ _*x* x|_| _ x*|_*|x_*__* _**__ |x|_xxx** xx_|**xxx|*_| *|__|_*_| x|| *__* ||* x *_|| *|_|*|_x__x*_*x **__ x__* |xx| *x||x_*x||*_ *xx*** x**_ _|**__|** |*x *|___x_x||**||*_ |*x||xx* ___*|*|_|_xx **|* *_ *|xxxx**||x_x |x||*__x ***_x |__|* _ * *x| *|_ * | *| __* _ *|_ x ||_ *_| _|_x_*_* _ * _****|x*___x || *|_| *|x*x***| _*xx_ x*x_||x |x* ___*|x_*_ x_||x _| **x|*x| _ *|x|x x x_xx|_x_|x|| x_x _||** *_ x|_| *|_*|*xxx_x _|_ _*xx*| _| x_x_x _x_x|xx |x|x xx_*x*x|xx|*_ **| *|*_ xx** *_* _|||xx_|**|x_*x |*_xx** *|xx___ _|_|*x*x|*xx*x*|__|x**xxx **x x * x| _ |_| x*x |**_x_ |x|x *|* *x_** x|_|_|_x*|*|*_ * __ xx**_*|* * x||x|x_ xxx x||**** **|x *_| _**x |_* xx||| ||*x*| |x |*_* x_ *|xxx* _ _*xx__ | |_x_| __ *|x||*|_xx* _|* * **x |***| _x |x *_x __|x x*_*||_ |x xx*x | * * ||x_x _|_ || |*_||_*_| _ *__ _*|*|__x_*|xx*| ***||__x _*xx__xx*_*_x|*xxx** x*xx_ _| | xx**x *||x |_ **xx xx* |**xx x__*_**_x|_**_ *|**x__*x_* xx*_* ||x||xx*|x* *x xxx_ **_* _ _*_|_|_ *x_*x__ x _*_|_* _ ** |_*_* x*x|** *_*_* * x|x xxx_x _|***__xxx_x*__*x|*|_ |xx x_x_ x_x*_|||**|||x |* **x__||x | * *_|*||__ | _ * * xx|*_x|_*_ *x x*||xx_*x_ _*_|__ xx*|_ |x x|*x_||| *|_xx _*_ x_x__***xx||x__||x**|*_ | ** | _xx _||*_*_||x*| *x*x_ | |*_ _ x_ _|x|x__||x|xx_ *x** x* _*_xx__*x|*_|_|*x _| |x_| _*| x* x_*x |x __ *||*_*|_ |*_x* x*x_*_x_ _*x |_x|x|x_|x_|*xx_ x*****x|x| *|x *x *_|_||__ __x| |*_xx**xxxxx| x_**|_*x__x**x**|_|x|__xx*| *x* x__|x_ x x*x_*xxx_*__*_x|_|*x*_ x*| _xx**||||* |*x|_x * _ || _x|_ | * |xx x||x_|*|x**x_ __|x_ x_x* _* _|x| |xx|x*_|_x| * _ _ x*x_*x**x_|** ||xx _*|x||_*_|_|*xxx|_ *| | x_|***x|_** xx|x* *x|_||_*|_|_*x*| _*x| x||||__ __||* | *|*_x|||_ _x* ||*|__* *|* ___x *x __| |x _|x*x|x__*x_ x_|| x_*_|x|_|* *_* xx_ * |_ _x _|_|_*x|_ ||_|x_ * *|_***|** ||x*x|xx* _|||_*_x *___xx | x* |___xx *_*x|| * *|xx|_xx__*x ____***_*x|_x|* _x |__x*_* | x _ |*__ _|* | _x__ | | _*_x*x xx|*_| | x xx***_ __** xx____ xx__x||__ _ __ ||_x_x_* _ xx|* __x||x__*____* x|||x|x |* |_|__x_** x xx||x *|x| x_*_*|* x|x*x _|* xx__*|*x ___ |_|*|||*xx**_||| |x _*_| _x*_*| *_|_||x| **x|_ __*| * _xx*xxx_xx_xx _|x_|*x_|_ ||x| xx**_x*x|_xxx _|_| ___ *x*|* *x_xx|x___ _ _*x**x *x x|||*| x*xx*|**|**|** _|___*x*xx|xx|*|_x| *_|x**xx *| _ _ _*|_|||_ * xx|| x||**x|*|_| x*|**|_x ||| * **_*_x| **|** x| _| x|_ |***|_* ||__x_x*_x*|*_ *_x x* x x|_|x |*x|_|_ *__x*xx x___ _xxx*|x_xxx__ xxxx*| *_*||xx|x| __*|*x ____ x|** _*|*|__|x*x|*xx |* _ x | *x _x_**_xx_|*_* __ *x*_* _x| |_**x***|** x* x x*x *x_x* xxx x_|||* _**|x_x_x_|_ |_||*x|_ *_x_ _x*|*x*|_xx_| x| x|_* ** _x| |x *x**_|* xx*_|* xx*_x* |___*|_ *x_xxx*| | * **x|_ x__x x|**_ |*x*_xx_*||*x |_* |_|_x|||*__|xx_||*x_|x_x*x_|xx__*_ || |__xx|x* |*|_ **x_ *_x*|*|_x x__ |_|*|_x __|_x*_ _ | x| x**x**| x|| |* |x*_|*xxxx| |_| xx_|xx* x|* _||_| _x||__| x|x*__x|*_xx_** | x|_|x_x*||__xx x_*_ _*|*x_|**x___*x_ _*_*_* xx*| *|| x* _ x|| *|| ** __|*___*x_ x|x|||* x_xx| x *||__|_x *x_*x| | *_ x_ *_*x _ |xx*_ *|_x*x__ *_ _xx_*|x|**_ _|| *x_ _ x __ |x_x* |__x|xx x _x*| |*_ x x|__x x***_*_**|*_ |x_ *x* |*|*x_x**x x_ |_xx*_ x_ | |_||x xx|_x *xxx__*x||_|*_xx *x|_ * |_|__*x_ _x||_|_x _x**| * _ *x|* _ |*_|_ _xx *||| x_ **| _|_* || x|x|||**x * | xx**xx**_xx_ |*|_ x |x**_ *| *_| |_xxxx*x *x x_ _|*x* * xx x*x _**| _*| x*xx x x*|*x|*x_ _x*x *| | __*x*_ x__x* x*_|x _****xx*___* x** _ * * x_ ||xxx ___x_|__|x* _xx _|xx|*|x*_|x*||***_|_|_**x*x |_ _|x_**|__xx_ | | x_ __|_*|_ _||x|x **_*_||| **x ||_ |*|_x**x__ _xx**x_ x| _x||xx|| _ xxx|___**_* *|x*| _ xx_**_ x _ _|x **x*x|||****_ x_x__| x__|x |x|_ _*x_ * x **___ *x|| *|x_ _||_x _ *|_ _|*|*| __ |*__||*xx_|x*||x||x |||xxx*x_xxx _*_|**xx|_ |x x _x|*x x**| _x* _x**|_|*xx_*x||x_|xx|_x* x|x*x| x_* x|x|x_ *xx|x* x_|x *_xx_|*_|x | | x_xxx | |*_*x_| * ||_| |_|*_ |*xxx_* || x|||x_*|| _x_ _* _| | _** | ___x*|| *xx|x|**_xxx |*_*xx x *_ *|xx |_|__* _| _|x**_|_x_**_ |**|_| x|***|_x_ |_ *xx _| _*_x___xxx x*x*| x*x_||x**_ x||_ x_*x**_***x*x_x _| *_xx|x|_ |x*x*_*x|****** _ |x|*x_* *x|* | _x|_x* ||_ |x_x||xx*x| **x*xx*x*x|xx |_ x| _x|*||***|x*_||_*_xx|*_* x |**x | x_ _x*_ x_x* *x*** _|x_|_ x|xx__x*_|_ _x *__ _* | x|* __|x* **| _ * _|x** *xx_*x_|xx_xx|||| __x*x|* x_|*x_*__ _|x_|x|x|_x_ |* |__x| x*||*_|*x_ *_*x**|*|| |___x_ * | _ *|*x** **x||x| * _|_*x|_* |_|x__ x **_*x|_* _ x|**_xxx| x x||_xx_x *x_*_x_x* *** *|x||_*|* *_xx__x|_||x _*_x x*_|_xxx ** x|__||x|x_ x|** |x x*|* x_ __ |x_x| *x| _xx_x| __| _ |x _*x|___| _ ||_|*_|*_ *|||__|*_ |_|x|*_|__ ***x|x_|*_xx|| x*x*_ __ _| x__*|xx_|||*x_x |_*x _ _ * _|_x_|x*x_x __| x*_|_x* ___ x _xx|** * x*||*x|_x|x|_*|xx|x__x* x|_*x*|_| |_|x * _*x|x|x|x|xx|*x|*x _*_| _xx| _ x |x|_|_x*___*x x_ | |_ * *_ |__|| __|* __*_|_||*_x* * x** x_x__ |*__|*x*_ x__ *x*x* || |_ |* *_ xxx*x **_*xxx * x |_|xx *| ___x** x_ * x|xx_*| _* *|x __ _|_xxx x** |* ||___x* *| _|*_**xx x || x|**|_*|xxxxx x__ ***|_ | x||***||* | _| |xx|**x__ _*_|__|| ***xx |_x |_x|x__*_* | _xx|x_*x x|*_*x|x |_** x_ ||_ x|* x_ x*| |_ _ | ||* *||_ ___xxxxx| | _ _|x*x ___*xxx_ __**x_x**_*|_| __**_*xx || x|x*|_ *|_xx *_| _ x _|_*_ |_x |*_x_ __**|_ x***|* *_ _|| | _**_*x| |*x*_ ||***x|*____|*xxx| |x*x xx_x|*__*_|*_ x_x*_ * x** *** *| |*x _ **_|x***_xx| |* **|x_xxx*| *x_*x* __** |x|_|_ xx_|_*__||x|x|_**x|_x||*_| *_x_ x|x_*x*x|_|x**|_ x| __** *xx x|x ||xx|* ***x*| x__*x__ _* *|x **_x_* *x*_x_| *|___xx** | _ *_ *x| x***__*xx_*x x ** ___x _|||x_x|| _ ** __||xxx xx_ x|x*xx___x| _x|x|xxx|x||_ _*|x|__ |_*_**_x x|_|_*_x| *x| x _* ||_ __ *xx*|x_ *| |_ **|x*_|||_*|*x____ x|_**_x *x* *_ _****| xx*|x|_ | ** _|*_ ___x *_*x*xx|_* *_ *|x_||_ |x* _ **_|* ||x||*x| |__ ___ xx|_*__| |_* x_ _____x*||x|*||x_ |_|x_ _x|| **__|_|x| | | _| * * __ xx_*_ | |*|*__x||*xxx*__ * ||_| |x |*xxx_**x| |*|xx x _|*| *x_*xxx*|**x*_* _ **x**x**_ x__*x**__|*_|_ _x|_*|x** * **| *_ *| *xx |_*_ _*_x|_|||*x**_*|x*|* xx** x_x x ** x | *x x*|__*_*_ **x_*x _ x_x | |**| ||x | *x_ x _* |_x__**_ x*x_ || | _*x _ * x| _ * x*_| _*| _|xx_ x|x_*x|**x* |x|*xx _x| * ** _|__*xx_|_x_****x*|| ** *x |* ||||x_** x|_*|_| x*|_|_ | x*_*_ x _| __ *|_|** _x* **_|x*| __xx_x|_|___|**x||*_|_* |____|||**|_ |xx *x||_||x|x|___x| *|_x*_|x||_| *|***_x_ | *__xx| ||| ||* x* *|x* xx*_*xxx*_ x_*|**|_|* *|x_| x_||x_ x __ x __||___ ** x_***xxx|_|_ * *__x||*_x___*|_ | ||___x__ *__* * __*x *||x|*x _*_ |_* *_|** ___*_ *_ |xx_|x xx||x| |**x_xx_x|x| _|x_| | *||| |xx|*x**|**_|_x|*|_|_x_*_x_x | |x*xx_x*x x***x_|*|x*|_x| *_ | _x xx_||xx__|x***__*x x_|x*__*||*_ ||_ x|*_xx**| _***_| || x||_x |x_|x*||* _*x x_ | xx x|_ xxx*x_x*x_|x|_*_ *_*_ x_*x x_|xx| xx|_*||x|*| _ |x_|xx_ _*| x| *_x _ |*x_x||x|_x_|||x_*x_|xx_| xx| |_||_|*_**** |*|x*|*|||*x*x_****xxx ** *x_ x*xx|** **|*| |x| *x*x**|x * |* *| ** |_xx|*x * _ *x|_* x*x|_ x_*|_ _ x|* x *x_ _x|x*|_*||_xx **|||||_|x_* __x|x __|xx||x| xx_ xx||x_*| *|* ___* *||*_xx*_ *|*x__*_x x__|_*_x *|*_ **x_||** x|*_*_x| *|*|_* * _x||*x_ x|*|*x**x _| xx*_|xx*x*|_ _x__xx_|_|*|*|* * x|xx*| * | x *__| x _|_|_ __ x|xxx_*||*_x|___||**_ * *|xx|x||_ x x x* xxxxxx| x_|* x|*|*__ |xx_*|| x_**_ || x_* ||x |*| x*_| _|x|****|*x*_x|x***_|***__*x*|x *| *|*_ * x| ___ ||||x_x* xx| x_ ||*_*|*|**|||**xx* *_|x**x |*|*|_ _|_| _* ____x *||_| * | x||_|*_* x |xx*___* *xx* _*|*|x|* |* _* _| |__xx_x_x||x** _* ||_x__* |_ _ _x*|**| _||xx| |*__x_x*_*x_*|x*||_x_ _ * _ | ****x|x __x| *x||_x|__xx_x *_ __x| _| _* *_ _ x**_|||*_xx |*** xxx*|*xx__x__||xx_|_x* xx|**__ |*_ *_x||_ ***x x*_ x | |||*|__ *| *| xxx _x| * _ | |* __x_*_*xxx_ _*|_| x*xx_xxx__|*| xxx|***_xx _*|_| *x _**_|* *x| __*x* x_** _xxx* __| x| *|**||*|*_*| x *|*|xx **__x*__| ||x|*|*_|*x*x _*|* *_xx*|_| x* * | *x_xx* ***_* xx___** _*|x |*| x_*|x _x* **|xx__|_***x|*|xx * x__x_x**_ _**x** xx|_**x**|x_|_x * |x* __ x|__ ||x_|*x**_|*x___* *||*x_* _||x*** **|| xx__* x x_|_| x __ *|_x x|x_|||_|x*x x |xx xx _ _|x* |_*x| x|x**_ *_|xx x x***|||* **| x**xx*|xx*xx|xx |*_* _|x|* |_x| _*|*_* ***__ _x _x x*|**_ __x|x*|_ __|_x *__* ||__|_|*x**xx|xx__|__x *_x ||x__x_x |x ___*_ _ |x__xxx*_x _| _|x*| _*_*||_x|||*_*_|*_*|* ** |**_ x | _*||**x|_x|_ _xx*_|xx x_xx| _||_||**|*x_*|_xx|*x|x|x*__* * _|_*xxx| * __xx*_*x_ |* _*** _x*|| |_x_| *xx*_ _* *x*x*x|*x*_x| __ __||x *x*|_x||*|xx _* xx| _*_ *|x__*_||x* _xx*_**_ xxx |*_x|_|_x*_x*| |x | _**x* __x* _|x _ | _x|* x *| |****_ _ * x|||x _x_|* |xx****x *|x_ ||x|__||| _ _x|| x x **x x |||*x |x|| xx|_ x|*x||*|_*|__| x x| _|_*_ *|| |*||_x_x _x_|xxx__x xx|_|__|x_x* __ _|||_*x |_x*_xxx *x|**x * * xx* _ **_*x|*|_|xx|_*_x xxx|_*| |||*x*xx|_*|x*_x__|_||**|| |*_| x*_x x| _ _*_*_ *|x*x*x_x_ |* | x|_**||x xxx*||| x**|x_|*|*x* |*|** * __|x*x_xxx** | xx | |* |x x*_ _ * * _ _*x |**_| x__|_x__|||** *x* __ __ xx| * x** | *_ __xxx|x|x|| __*||x* | xx| |x|||****x_xxx_* x*|*_*_||*|x| x|* _|*x | *_| _* __| |__| *x_|__*|| ||_|_ |x x|x**||||x||| _||_|x*_|_*||_*__ ____*x|__x|x x_xxx|__*_*xx |_*_x|xx|*x||x __| _ _x|x |* __ __||x||***x _ x__*_ _xx x ||*_x|* _ * *_x|x_ _ x |_x***_ _***_ |x |*x|||xx x_*** ** |_ x*_xx __*x x|___||xx|_ *x|*x*_x *|**x|* |x|x**xx_| | *| __x**x*xx|_xx __|_**|*_ x|||| _| x*x __|_|*x****|_ *_x||_||*x*x ||* __*x_ x _|*_x *|x| ||x|_xx* *_x||| | |*| x*__ **|* x __x |* xxx** *x |*||_ * x*x| _ _|x|x_*x |_*x| _x| * x _| ||x||x _xx_x x*x|*|__x_|*x*_ |xx*x_| x_xx_|x | |_*|_x|| *_ |xx *| ||*__|x_*_ |xx *|* x|_||||** ||* * x**__x*_*x_ * ||*|_| x** *_**_* x___ _*__ **|x * *|*x *__ |*_| __ *x***||_ |* *x ** _| _|x |x*__|**|_|x* xx _*||x|_|_ *x*x*|x|x| _* xx**x_|x|x x*x* _|x| _ _ x __|* *x_x |x* _ _***|x|*x||_*_ **||x_* |_* _ _** |_ __x| xx| xx |_x*|*_ x __ ||_|____|||_ | |x *x| _ _*| _x _*||x_**__**xx|*_|__| __|* x*|x ***x |*||*___*______x_* x_xx|||* |_xx _x |x _|*|__|xx_*___xxxx*_| **_ |_ |*_x||*_x*| |__|x*|x| xx**xx |__x*|xx_| _ *x**_x** xx* *_*_*|_x__ |*_| |xxx x*|_||_ *xx_|_xx |_x||| |||*|xx**x_x*|**| _ _x_ _ _x**|_xxx_*_|_ | __ |||| _x_ * _x_*x x*_ |*|*xxx| _ x* |* |*|**x_x** _||x __*| x_x_ *x|_xx|*xx*_| x_* ||_ | xx_** |xx*x_x* _|*__x| *x _*|||| *|x__xx***xx_| |x _xx**__| ** xx*x__**x| | x *x|_x*|*_ _ *__x_ || x|__* _x_| |*x*__|||_*| x* xxx _xx *xx||xx||x|_*_*_ *_ _|x*x_* xx _x*|x _||||_|*x_* *_*_*|****|*_**|_ * _ |xx* |xxx_|x_ |**_|* |x |* _*_x|x*||||||*x*x_ | x _ __* _ *_| *_ *xxx|| ||* _x|x *|x|__x*x*x _|x x*|*x_*||** xx* x*x* |_||xx_*_xx_**x*||_x _* _*|__x**__ ****xx|x*_x_ x _x*x__ _**| _xx* *xxx_xxx_|||*x||_|xx|_ |x _ _ _x |xxxx*_*|*_*xx*x___x | x_x__| x|x**|*_|xx_ * _ x_||_ x| _ *_| *|* |xx*_*_ _|_xxx*_* _ x|__ **x*_*|___ __xx *_x|x xxx|*| | *xx*|*x_ _* |*____x_ |_x*___ *_x_x_x _ x*| _xx* |_ *x|x__*__*_x|_ *_ __* x||x|| x**| |x|* | _*___*_|* * _x_*|x *x_xx *|||*| xx** |||*___ x* |xxxx**| * **x|__x___*x__**x||*|_xxx_xx||_* * || _*|*|_|x_ xx*** x | __|*||*| xx___ *xx*|****|*xx*_| __ **xxx| _ x*x|x x| |x ** x|__|** |_*|x*x| ***| xx* * **x| *| xx _* _xx_ * | ***xx* __|x __***x*_*_* _x*|*|*|| * |*_|xxx_ |_* xxx**x_x| | ||_*__ x** x**x | *_|x*||__xx*_*||*|*xx| |x |*xx|||x_|| *x|__ __**x x_*x_ _xx *|*_ * *|x||| _| _x_ x_*x*|x x__x _| x |_** *x|*x|_ _**__x|_ xx| |* _x_x| *x x|||**_ |_* _ | _|* _x_| _ x xx_ x|x_*|*x| ||x|x *xx *_ xx|x_| x||||x*_* _*x| _x_*|*|*x|**| || x ||| __|*| * x|_x*_|*|_***xx**x **_ _*_* *|x| ||* * x* | |**xx** xx__*xx*__|** _||_ _x|_|xx | | || |x*****x_ x ||_ x|* ||__|*****x* |__x* *___|* __ _||*x_ *x|xx*_| xxx***xxx| xx||* x _*x*_ x x|* |_x*_|__*||x_ |xx*||_| _|*|*|** x *|x *x__*|*_|| | xxx*||x|x*|_ **_*xxx___* |*|*|x*_|_x| __x|_|x |__| |x x||| | *x |__*x|x_**__*x xx|*_ **| _* _*|*|x | x|* | _|**x|x__|xx__* | _xx__ *_*| x***_|*|||*|x*x||||_* __||_*|* *||_ _ x _x_____ |*__ *_ *** _x| **___ | * *x_ |* |x_ *x_x x*|x _x| **xxx*x ||* _|| *x|xx_ _ |_| __ x_x_x|_*|||x_||x |*xx**_||x__||x* x x*_*||*** |_ _x| x_ | _| * _|*_ **_ x* *_ __|| |_** xxx_*|* x***_ *x *x_| _x_ xx|xx|x *x*|__*|__|**_|x|x__ _x|*_ x_x| *_xx|*xx* x x |*|_ **x_*x*_ __ _* |x _ xxxx |_* |_ **_x |xx_|**_|x***|x|*_|*|*||| *||* |x|* |*__**x|xx _*| x__ **x _|xx|* * |x| _x* **x* | |x|*_*_| |____x| xx x|*x x|*|x x|*_xx_x_x_|_x||*x _ x_ x| x|__x_|_x***_** | * ||x_*xxx_x | _ _x| *x_ x* *_||||_x x |x||x _* x* _|_|x |x |___*| x_|__ *|x*___ |*x|* x*_**x *_x _ __*x* x *|* |_ **|x_x_*|x x ||| _x|**x|**_**|*|x*xx_|**|*x*| _x*x_*x| _ | |_ __*||x_* |* |_ xxxxxxx____ *xx x_x *|| **x*_|x*x_||| xx_x|_x|_|*_*_x*|x__x x_*_ * x xx_xxx_x_x_x_|x**x**_x|*x x* |* _*_* _* |xx*x_|xx_ _x|*x| *| x*|x*x** xx___ x_|__ | x_x| *x**|| *xx|*x*_ |_x x*_ |*|* __||_|xx**|* *_x_ |xx_*|**_| ___x_ x_|*_ x _|x| |_x_|*|__xxx __**_** x||x*x*|*|**|x|_ xx_*** *__x *x _ || *| *x |_ |_| __ __ |x*x** *|| | _x x_* ||* *x|* _| **x x _| _x|*|_ _|||| x|x*x_* **_*|x*x_| xx|x*|_x*_|| **||__|_x*_||_x||x _ __ x||| _ x_|x| x|* |_|x* x|_x|x_ ___*x|_|*__|| *_|* x___|x|*_ _||_ x|*|*x *| _**x*xx* ||xx|_| |*x|_|*|*___|x||__*_ |*|x*_x |_ * * x|* *x*| * __|_ * x_ xx||_ x | |*|xx x_x| *|| |x|x**_x*|xx| x_| _x_*xx_ * |x* x*_*_ _*_ *** |*xx|x *__* __ _|x_|||_xx x|x|_*|x|||*x*|__ x_ *_ x x x|*|| | *xx__|_ _|___|*_ _| * * _x*__|x_ _x_|_x x |x**__x| _ x _x*x_x*x x x x *x* |x* _*x| x*x x _*x* _x|*|x*_xx __|**x*xx_ | |_|_* x *_x* _ *|*xx* _***||_x ** _*_*x __| _| _x|x|xx|_ *x__ * _|_|| _x _| x*__ |_**_ _|_* x*|x___|*_ *x _* |*_*x|_*x*|*_ |_*|* __x|x_*_ _| xxx*| *__ ||* xx__ | x_*xx| *x|x*|*||_*xxx|*x_*_x x_*_x x|||*||x_ _ |x | _*__*xx|* * ***|||| |____xx| x x *x **xx_**_|xxxx |x x _*_*x**_x |xx||||* x*x_xx | ||_x_x| x_|_x*|x_x _ |_* __x* _x * x_**x*_xx** * |xx*_** _x * xx_*****|_*x *_x*x | | xxx| * _*x_x |x __*x x*__ |xx *x|_| _*|__*| _**_* *|__|x*x *xx _x_xx||x _x|*___ *_|*x _ _x_* |*| xx||* ***x *|| x* |**| _xx__*|_x|x x_x || x _|_** |*x_ x|*_xxx_ ||_|*x|x|___ *_x **_xx_*|| |_x_x_ xx _x*| x_**_ x_ *x_**_ _|||x x*x __*_*x_x||_|xx _|xx_ ** x|* |||_x||xx *||xx*x | * ____ **xx **_xx *|x||_x x_*_x**|_xx _x *|x x| |*x|*__xx** _* * xx|||x* x *x|_ |_xx *|**| _*xxx_* xx _ *xx||** xx_*x_xxx *|*|_x|| _x*x _|*x_x|_*x x||_*|*_ _x|x _* xxx*x*||__* *_x_xx*x_x |||_||x|*_ |_* *|x* _x|||_* |**x_ |* *x__x *x||| _x| *_xx*|x_x|*x|_ x __ x_||xx_* |_|***||| *_ |_| x*__|*||x * || x| x * ||x|x|x*| _ _x*x*_|x*__ |**xx|_|x|x |x * xx|*_*_****|*|x_x|*xxx_** * |xx |_|* x_|| * _x * _x_ ||x*_|* |**||* ||_xx|x x_ ||*_*_*|_* xx_x_* |x_ _|_ __ *x*x|xxx x |_|x**_|_xx|x|_* |__| | |x_*xx * _x _* ||_|| | |xx xx __x_x xx|xxxx| x___|_x| |**| xx_|*x | |_xx __* x*_*__x| * *_*_ __|*_**|x||_*x_* *|xx _x_ _* x*x |* _x*|_xx xx* x _ _x*||_ ** |*|_ x_||x *| **|*_ _ |* *_*||x|x|x| ||*| _ |__xxx_| __**_ *| |xx *x*|*_* * |x* ||_x|__xx||x*|_x|x*x| |_x||*_****_xxx|| |_*x_* |**_*||_x *x *|x| *** x__*_|x __xx_*||x|_**x* x x*x**|*|| _x** *|__|*_| x*_*x_ ||_ x _| |x____x_* | xx_* **||||x| *_x_|x_*xx||x* __ x_x|_*_x*||x|xx |*x|*xx__x x|x * |___| _|| xx|||x|x |***_ | |*_|* xx||__* x_x*| * * x* _xx x*_ _ * *x *|x|*xx|_ _*xx* xx||x*_|_**_ |_**xx _*x ||__| |_*x *_*_|*x|_|*|_x * ||||_xxxx _ | _x ****xx|xx|*x___x_x_ * **|x_ |_*x xx *x **x* *||x x|x | ||*x|*|x_* xx **_*||*| |_|* _*x *x_ x* _x*xxx*_ | |x ** _x*_|*| x_*x| |x |* _x*_|x xx___x| *xx_x _ x|x*x_* *xx *x*|*x** _|| |x*xx_|*x_ |* | ___* *x|_||* * | x|_ ||x|_x__| |_**_||_x x*|**x _* |x**x |*x|x_ _*xxx||x*x_ *|__x |*| **_* x_ *_ _*|x*xx ||*|_x|*x *|_ **|* x *x*|x|_ xx* x_* **|xx** *__x_|_x*_x||||_*| _| _* |_| xx*|| *** | | |x _|x___|x x*_ _x x*||x*__ _xx xx*x*_|*x___|*|_||| *xx*|x x***| *||_|xx*|_ x|*|_ |_*|| *_xxx|| |* *x*_*x___ **_ * _| xx*___|__ *x|| _|_* x|*x *|x x|**||_ ||xxxx_ ____|_*_x**x|*xxx|_ |*|**|xx x**| _ |xx x**x_x x|__|*_||x*|| x_ __ **x_ | __x*x_| * ***x_xx*|x**|x x*_*x_*_ _ x x_ ___|x*x x_* xx*_xxx x_ x*_|x |x * | *__xx*x____|||xx |__| xx |x_*| * x*xx_ ||x ||xx_ x|__ |x * _|_|*_| *____|_x|*||*x__| x|_xx*xxx|*___x_| **x* _ *|_x*_ |_*_x x||_|x_|**_ _ |x_ __ |*|x_| |*|x _ _xx|_x_**x **x__||__* x_ *| x|_|** x*____*x||x|_|x||* x| |*||_ |x x_*x*x x _|x|_||*_* * **|_x*_x_|x|*_xx|*_|_|***_*x* _x|x ||*_ *|*|_x |*xx |_ x_x *_|||*x|*||__ ||_ xx* x*x__ x x|*__***_x|xx**x*x| x*xx_|x|*| |x | |||x*__|_x_ _| | _* |_ *_ x |x|_****|x_|*** *|x__xx|__xx* x_x _x__|___* *|*| *x** | x*__**_ _*| x_*xx**||| __|x* __|| ||xx x_xx *x* _ *_ x _*_| **x||x_ __x_*|_| **|| __|x**_| _x*_xxx**_*| xx|_ *_ **x**xx |_xx_ _ x*|_x*| * x*x_* | *_ *x||x _* |__ |* _*xx_ *||| x*x|x___**|* _|___x _ *|* x_***| |*x|* _|| | x*_x***|||x **||*x __ _xx_x*_ _ ** x x x_ ___|__*x _*|_**_ *|_ _ | * _* ||__*| x_*_|* x_* __*x|**|x||| *|***_x_x| _|| |x_ |_ xx**x* _*|**|x| *|*|__x* *_ x_*|x_*__|_ _**|*x* _ **x|_*_x x_***|_x* ||| __*_* | *_x*| |*x|*_||_*| x__ *xxx __**_*|*_ x| _|||*x|xx|x ||_|__***_xx *_x_* x***x__x_x*|*x_ x _| __**| *_x_ *| x _||*x xx*|_ x**x |_****_x_|x|*** xx|x_ * _|* |*x _xx *|**x * |x* _ _*|_**|xx _|* * | * *x x|x*|*| *_x|_|*__|**xxx x**x_ _ xx |*xx*** _*|*x_|_*x_ **_ *||x||| * |***x _|**|****xx| |xx*x |x * *x*| _*_ __x_ |__x x|_|* _|_|x ___*xx*|_ | *_x| *x__ * |_** *||x||**_x x*_x__ _**_* _ |||x|xx| |_ _ || _** x* | ** x *_*xx*_x_xx |xx|* _ |_**| __x x* |x||__ |_|xxxx|xx|x_x*x__ __|x*__ x*xx_|||x|**x| xx|x_||x|__ ** _x_ _xxxx||x|_**| |x* _x| |*** *_||**|* |_ *|x|x***x * * _xxx*x* ||x * x|*|||xx|*| |xx| ||* ||_|*__ || * |||xx*___x* | _xx _| |*|* ||_ *|*|x|x **| _ x***x| |*x ** ** x|*_*__|| *_xx|_**_*xx*__|| x|x *x|* x__ x||x ||_ _| ||* |x ******x| *_x_ x* x_ ***_ _||* |*x|*x*| _*|*x**x*_||_x|_ ||* __ _ *_xx| *** x *x*x *x* x_ _x**| x |* x*_| **xx _*_|*_ xx*_ x||x__* _x****x_xx x|||_ *|*****| xx_|* |*|xxx|_| x**xx|* ___ *___x*|_*_*x|_|_| * **| || |*|_x*_|_ |x x__|* |x|xx *_*_ _|* x ||*xx|*|_x __| |x_xx_x_|_ |_ _x
+ + \ No newline at end of file diff --git a/code_base/bgs/6_files/blizard.js b/code_base/bgs/6_files/blizard.js new file mode 100644 index 0000000..97305a1 --- /dev/null +++ b/code_base/bgs/6_files/blizard.js @@ -0,0 +1,148 @@ +//blizard.js version 0.5.1 BETA by Rohan Samra-O'Neill +/* +uses the atomo.css library created by Rohan Samra-O'Neill +*/ +"use strict"; +//inspired by jquery and p5.js :), thanks to p5.js and the processing team for featuring blizard.js on there site +var sl = {}; +var id; +var storage; +//just a little message to anyone who goes onto a website that uses blizard.js +console.info("This project uses blizard.js for more info go to https://github.com/Slitherlizard/blizard.js"); +//with sl.ready the parameter is the function that will run when the page is loaded, i needed to add this in version 0.4 because it's a DOM library and functions wheren't working because the elements couldn't be found because they werent loaded yet +sl.ready = function(sel) { + window.onload = function() { + // basically just runs whatever function that the selector is equal to + window.setTimeout(sel, 0); + } + + +} +//with sl.print the first parameter is the id of the element you want to change the second is the text you want to change it to +sl.print = function (sel, txt) { + + + document.getElementById(sel).innerHTML = txt; + +}; +//with sl.hide the parameter is the id of the element you want to hide +sl.hide = function (sel) { + id = document.getElementById(sel); + id.style.display = "none"; + }; + //with sl.show the parameter is the id of the element you want to show + sl.show = function (sel) { + id = document.getElementById(sel); + id.style.display = "block"; + }; + //with sl.col the first parameter is the id of the element you want to change the color of, the second parameter is the color you want to change it to + sl.col = function(sel, col) { + document.getElementById(sel).style.color = col; + } + //with sl.family the first parameter is the id of the element you want to change the font-family of, the second parameter is the font family you want to change it to + sl.family = function(sel, sel2) { + document.getElementById(sel).style.fontFamily = sel2; + } + //with sl.size the first parameter is the id of the element you want to change the size of, the second parameter is the size you want to change it to these are the sizes you can use +/* +xx-small +x-small +small +medium +large +x-large +xx-large +smaller +larger +*/ + +sl.size = function(sel, sel2) { + document.getElementById(sel).style.fontSize = sel2; +} +//with sl.wait the first parameter is where you call the function you want to run, the second parameter is the amount of milliseconds you want towait to call that function +sl.wait = function(sel, sel2) { + window.setTimeout(sel, sel2); + +} + +// with sl.setlocalstorage the first parameter is the name of your localstorge item so that you can refer to it later, the second parameter is the value of your item. +sl.setlocalstorage = function(sel, sel2) { + localStorage.setItem(sel, sel2); +} +// with sl.printlocalstorage the first parameter is the name of the localstorge item you want to print the value of, the second parameter is the id of the element you want to print the item's value to. + +sl.printlocalstorage = function(sel, sel2) { + + + + + document.getElementById(sel).innerHTML = localStorage.getItem(sel2); + +} +// with sl.click the first parameter is the id of the element you want to add an onclick attribute to, the second parameter is the function that will be ran when that element gets clicked +sl.click = function(sel, sel2) { +document.getElementById(sel).onclick = function() { window.setTimeout(sel2, 0); }; +} +// with sl.id the first parameter is the id of the element you want to change the id of, the second parameter is the new id of that element +sl.id = function(sel, sel1) { + document.getElementById(sel).id = sel1; +} +//from line 92 - 124 i think i liked inporting other librarys too much +//just loads the atomo.css library for styles +sl.atomo = function () { + var head = document.getElementsByTagName('HEAD')[0]; + + // Create new link Element + var link = document.createElement('link'); + + // set the attributes for link element + link.rel = 'stylesheet'; + + link.type = 'text/css'; + //load atomo.css library + link.href = "http://atomo.ueuo.com/atomo.css"; + + // Append link element to HTML head + head.appendChild(link); +} +/*sl.import does not work yet :( + +sl.import = function(sel) { + var head = document.getElementsByTagName('HEAD')[0]; + + // Create new link Element + var link = document.createElement('link'); + + // set the attributes for link element + link.rel = 'stylesheet'; + + link.type = 'text/css'; + + link.href = sel; + + // Append link element to HTML head + head.appendChild(link); +} +*/ + +//I have wanted to add this since version 0.0.1 but didn't know how but now i do know how so i'll add it. + +//with sl.createElement() the first parameteris the element you want to create like P be sure to wright it in capital letters and the second parameter is the element you want to append it to the third parameter is the id you would like to give that element +sl.createElement = function (sel, sel1, sel2) { + var father = document.getElementsByTagName(sel1)[0]; + + // Create new Element + var elem = document.createElement(sel); +//give the element an id + elem.id = sel2; + + + + // Append link element to HTML head + father.appendChild(elem); +} +sl.changeBackgroundColor = function(sel, sel1) { + document.getElementById(sel).style.backgroundColor = sel1; +} + + diff --git a/code_base/bgs/7.html b/code_base/bgs/7.html new file mode 100644 index 0000000..8c0a8f4 --- /dev/null +++ b/code_base/bgs/7.html @@ -0,0 +1,29 @@ + + + + + + + 01 + + + + +
x|| x x|___*|x**| x_|**__x_xx||| ||||xx*|_*_* x|x_* *xxx *|x _x*xx||| |_|* * __***_x _x____*x xx x x x****x _*x*_xxx __*| x_|x* x_x _x _x | _ * _** ** *_*__* x|_ |_x |_* x **x*_*||*_x* *|_**_xx_ __| x*|x__ *xxxx x_|x*x_x**|||x x_* *x|_ |*| *x|x x||x*_ |x__ _x_ __*_*|_*x_|*x_x x _xxxxx*_xx |* _|_ *__| *__|x|__*_*_ || x* ||_ x *_|xx*x_*|*|*| ___ __ |* *| | *|*_|_ * _x_ * _x**||x___ x_xxx** *__x||||| |_xx |x**_x| ||x*x_ x|_||| x ***_ x x* _xx x**|||||_* *_*_|| *x*_*_ x_|_ xx|||** * **||_**| **| _ |** _|*xx_*_*x|x*x_ *xx_* _**_ _ x_ _|x**_*x_**_xx * _x|_xx|*|x|x*_|*_x||x |* |x*|*_*| _*x|_ __| x_* *|| | _**x_ _|__xxx|| |xx_|*x|x| _x**|x |xx *x |_ _*_*||_*_x ____| x****x__xx_x|_|_||x_x *| *||*|*x|x*||* **|** x* x|***|x* _***|*_ |*|*x x*|**|| |_*x|x_x *|**| xxx|_*|xx x _|* x* * *x|_|*_| xx_|*_x * _ x x_|_***_**|_x _x*||| ||__**|x*|xxx *x*x||_* |x** _ __|x| x___|x**x x*|_|_|__ x* | x_ ***_| *|x**x*x|__||x||* _x||__ _ * _*_ xx*|_x |*|*__*x_x x|_ |x|x|_ *x*x|*|_xx x x*x*x||x_ |** |* |* * *x x*x|__*_|| _*|| | ||_|| x _|_|* x ||xx|x_|x*|| *||_*|*|*_ xx|*_ _x** *___|* *|__*_*x _x**x **_||| x_*| *||_x||x*xx***_x|||| |||_ *||_ |_x__ ** *_|| x|x |**_| _ _ xxx*xx_*_*___ _ _*__| x |_x_ _xx |_x *_x *xx|x_*x x|__*** * _|*___*_ |||**| *||_ x_x|x ____x|*x**| x _xx_|*_x _|_*x *|_*|_|*|_|_|_* |_|x__ _|__ *|_|_** __x|xx *x_ *x| | * ___x|_ _* || **xx|| x||x x_ |_x _ |* x*|*_xx| x *|xx| __*_ | _ xx| |x*|_| x _*| *x |x||__* |*_*_|__ _** x x__x *_*_x_*x* **|**_| _|_* | | *||x|_ x*xx*| * *_ | x_|* |xx*x**| xxx| _x__ |x*_||x*|* |_| |**_ x___ |*| x *_x*x| * _**_xx|*| _ | *|_* x_ **xxx_*x_*_x xx * _x|*_ _| *__ x*_x**x|x_ xx*x**__**|*x ||*_|*||_x|xx|x|*|_x**_*_| *|**x_*|* x_ x xxx **_*|| *|_*_x*x*x* |x__ __| x_ |_ *** x*|_ |_|_x_| **_x * x*_**_*x|*x*xx_*||_x x_| _x x | __xxx*|**xx*|x x|__**_ |x|*_*x*_|x *__* x*|*|_x*|__| __|*|* _*_ *_|* x_ x _xx| _*|_* xx* __x**x|x xx*| |x_* | * x |*x_xx_xx||| |x*x* |__ __| |* *x*|**_x||_xxxx|xx* _|x* * ||_x_ |x | _||x xx__|x_x |** *| x|*_*|x| *_*_x *x|**xx|xx*x|__**|| *_x*_ |__*_||| xx_ *|x | _|xx | x xx_*||*|||*x** |_*x_ |* | _ | ||x_** x|x_*|x x | _*** x||x||*x_|_x*_|xx * **x* _ * x | *|x|xx| |xx x|x * * _ *xx*__ | _|*x* *|| * _x*x|_ _|xx**__| |xx _x__|xxx__*x_ *x* ____ _ x*x |__|x||x|x*x| |*_|x*xx_ |x__x|||*__x*___x_|* __|__x* _ |x *| *||__| |||_ _x*|**xx__| * |x x_xx||x **x|**x __ x_ |_ _|**_x _ _x**|x *x**_* |x*x x *_x_|*_* ****x || *_*xxx_|_xx_|_|_||x*__|*xx* *|_|_**|x ||_|||*x |*_*x*x*|xx _ xx* x x_|| xx|**x*x_ *|__ _ _| *_x* _* _x__*_|_|x*|x|||*_ x||x _ |_*** _x**_ _*_*_ *_*|* x__*x* _ _x*x_ *_* |__*|**_*xx**x| x _ _*__||**x*| x*|__ _x xx|* |x**x___x|__|__xx x x| *_x|_|_|*|| x* x |_* *|x_ | x|_x x*x_x*_ |x__x_| *xx x|_x*x|* *_*xx_*x_x _|*||* x*| | **_x|* |_| * * *|x___| __|* *__x*x |*xx*_** *x x ****__ |_|*_***__x* * ___ x*x_xxx* |*_*x||___*xx*xx|x x | *_ __x __*|*|**|||*x*| || x_x|x x x*_ _|_x x|__ x*x _x |x| ||*|*|*** _ **_**_x*x_*| *_x*_|__x| _| *_|| xx| *| ||_||x_ *x_*_ __x _| x*xx_ _* x x*_x _x|* _* *x_ x_|*_x _|_ || |*||__|| | | * || _ __| x x|||_***x_ *_ *_|_**|_ _ *|x|* x|x*|x_ *x__* x**_* _ | |* *x x*x xxx_ * *|x_*_|**| *_x* *_||x||*_|*x _|x*| x*||| xxx| *_| | x|xxx*||| xx|xx|_x***|*x_ __*x|| |_x |_ _x_||*_ ||x_|x||_||__| |**|_x| |**_ x| ||**_xx__x x_x|_x__x_|| __ _xx||_** ** |xx|x ** x*xx*x__*x|**|| |*_|**_|* |** x_ ||x_|x _**x _||_*x*x*_*x_ *_*** |*x_ x* *x|*__ _|_|x_x**|xx*_*x||*|x|*** _|| x_xx*|__x| * x x*|x*x __ ||x__ x*_xx*x_|*|_|x_x_ |_*|__ __x*x* _ _x*___x_x * _*_ _ x__|xx|*||___ _* x_*_||x|_ *|_||| ||xx _x_ |* *| x x ___|_ xx_ *x__ _xx***|***_*_*xx|x_xx|_| x* x|xx**x** _|x_ *||*_ xxx__x_ __ ___ _|* _|_|_*|*| |_x______|* *x_| _*|x| _x*x* | * x*_*|xx |x|_x **x **|x xx_ *__x_*x* x x_*||__*x *x|***_||_*||x|*xx *x * *|x|x||x|xx|*|_ _x_*| |*| |_|_ |*x|| *|_* _| x*_|x _x|x _*|* | _ x*x _ x| _|*_|_|||_*x| x x*|x*_x x _x _ |_x* __ x x_ x|| _*|x_ x_|*|_* *_x xx_x|| ___**_ _*x_xx * x_ _x x|*_|**___x|| xx*_|_*** *x|_x|*||* __ xx*xx x**x| x*_x*xx__|xx**x*||*_ _|_|x|_ _ *|x|*x *x*_ x|xx xx_x|x |xxx*x x x_|**|*** x*|xx *xx__ |__* *_|_ _|_ |x*|*|*| x|__xx **xx **x __| **xx|_*x * *|_ _ ||*|x*|x|_*|* || || | xx__***x_|||__x|x|x_*xx x ||* x__xx x|xx*|||| _**_ x_||* *****x* *| x *x | x_ |x |_xx _x xx_|_x|||xxxx_* * |x*xx|| _* ***|*_*|*|x *_|*_ _xx| _x_x_x xx*| _*____|* _*x| _x*_x _*|*x| x_|_|xx|*_ |x* __ |__x| *| |x|***_ _x| |*_x* x*x* | _ || _**x**| |xxx_xx|xx|x *||x*xxx|**_| |x_x_xx* _* x*x|x |**||| _ x|** |__ ||_*x|**_*| _*|__ xxxx_ |xx*|| |*x ||___ _x||_ x*_*__x* _x x|x |*xx||* |x*_|*_ _x | x|*x_x x x*x**x |x***||__* _| _| __ |_|x* * |_*__ | _xx*| **|*** _ ____*|| *|x** _ _ *x|*_|_| x_*x_x_| _**|*_ x _x*| _||x x_|x|_ **x_x||||x* |_|x|x*x_|_|* x *x | * x_*_*** |_ ___x_|||* x|_**|_x*x __xx_|***x xx_x*x||**| xx|__ |x*___xx_*x*|_*__x*| x | _|||* x** _x*_** __|_x *___|x|* ____xxx|_| _ |* _| ** _ _**_x*x *|_ x*_x*x|_|xx|x_ _*_||* x x*xx x|x||_ *_x* *___ __x *|| |**__ *_*x|_ || | x _|x | x_*| x*| *| _*x* | _x|*x|_ _||_|x||xx|| x |_*__x* |_xxx_x_| |||| x| |_|*|| _|_ |* *|x* **x|*_ *x _|xx_||*| x x *x_xx_|_*_***** __|*|*|*__|xx * x |x*|xx_xx__* _ *_|x* ||_ xxx*x_ | _|_|x*_ xx|*x__*_*__|_xx*x* *_x|** _ ***|x | *x _ |_ ___*x|**x _x| ||xxx|_*|x|__*x | ||_ x_|_x_ |_x|x |x_*_**|*_| ***|_ |*||x*| || *x|x_x_x|_*| _ |xx __ __|x|x|*|**__ * _|__|x |*_* xx_x*|x_ ||**|*_* *x|_** |__**_ x*x __ *|xx*x x |x*|| *| * x_ x|_ *| __|_ |*x||x _x*||___| x_ |_*x||_ xx*_* |_*xx_*x* *| *xx_*xx***___|*x*x_|_x_*__*x_* x*x|__*x_ _x_* x ___*_*|x*xx |x**_|xx__x__||__**x* _*_|* |_ ***x ||xx| *_ |*|x_ _*|_x | _*x_ *x * |*_ | |x_| x__*|__x| ||x*|* x_| *_*|| |||x| _x __ x_ x xx| _ x|_|*x_**x_*x _| **|x*| x**x_ |_x|*__*xx_ *_||**x|x**** _*x x |xx |xx| | *|||_ x_**_ |*|*x _ __**x_*x|| __|** |_x|x|| *_x||*| |__||_ x*_*___ * x*_x_____|*x|x*|x *___|* _**xx **||| | *|||__|xx*_|_x*|**x |__ x|||**||xx*|_*_|||x_|*_|__|__ _|_x_*x*|*__|x*|_* ||**||xx _x _*_|*_*|_|_x|x|_||_ __ *xxx_ ***_|*|| | x*xx_x_|_*|* * x_ xxx_x__*_*_*|x***|_ **|*xxx||*|*|_|x *| __|_x _*_|*_** |_ *_ * x_|x _||_x*|| | xxx_x|_|x|* _ |x|* _*x_| |x|*x|| || xx *| _| x| _||*__*x_*x|__||_| x_*|x|_ __ _ __|x*xx_| x*x|*_* x|||x_| * *x*|xx | _|||_| _ x*|xx * *_ |||_x*||**xxx|** _|_| x__*** *| |_|_| x||xx|_|x ||x| *_*|*_| |x|_ __*_ _x_*x*__* _*_*x_* | _ *_|| x||_*|**|x|_x **_ _| *|***_ _*_xxx__x_||_|x_x*|*x_ *x||* xx_x** x|_*** xxx*x||* x_x_*_*x|* ___xx_|*x x _x__ |x|| ||| |*x__ * x *||xx ||* x|*|_|x||_ _xxx| x* *x__ **x** x_*xxx* **|__x*|_||* x_*****x* x * x|||_| | |__x***_xx| _x_*_xx||x x_|*x x||x*|*x _| x_| x x_xx_*_x_ ||_ *|*_|*___* x** |x|| |xx|_|*|_ x__ *_|* x |_||__*|*x*|**xx__*_x* | x__|x_** x|xx**_|*||_x* _** |x_x x||__xx**|_|_|*_*xx _ *||x*_ *_x x*x*x**x*|||*|* |_xxx|*| | |||_ *x_|__ x |||xxx * *_| | |*x _| _x*_x||x x ||xx*xx__xxx*____|_ *x|x_|_*|_ ___||_xx**__x_x||_ *x|xx _|x*_|_*_ _x___|___*x_x_* *x*|_ x_* * x*_|x*_|x*_ _*x** _x *_* x | x_x_*_*|xxx _xx | x*_*__*x x||_*|__* | x_*x *_ _ _x_| _ x*| * x _xxx_x_*x _x|x xx**__|x*_| * |_x|_x*_x** x_|** x_ _*x _*_x _*| x_|x*_* _*x_*__x_*x * _ x_*_x| x _| *| _* x _* _* x |xx *_*_ _*_ | *x x_| * __x*| _* |x*|_ _*x x _ _** __ *_ | **|_*_xx__ |_ * |x| * | _**_x*|_||||x |_x*|_*x _*_|__*| |_ | x_|*_x x* |____x*x|* *x x||*_*_xx* x_ _*_**_*x**__x_* _|x_| ||x *_ |* * * _*_|x**| x|_ _*|*x _ _||*_|** xx |_*x||_*|xx|xxx___|_ |x*x || x||x*|x x x*_*|* *x x_xx| xx|*|_x| x|* *x**_x* _x** _*_ *|*|***|xx* *_ _xx_|x* x ||* __x**| x | *x _*x*|x*_x *|_*| |_** |xx _** |*| *|| x|*x|_*_x xx*|x*x_|||__*x||***x x|||_xx* x|x* *x***x|* _x| | |x*|x_xx *x||xx _x|x |*_|_| *xx_xx x** x_ ___|x| x |x*_ *xx_*|** ** _ *_x__ |_*_|_x _|xxx|___|x__x_xx _ _x_*_*| x*|* |*|_x_|*||x* |x|** _ * *_ *x*x_|*_*| __**x||x_*__xx*|_ *| xx* *||___*_**|x * |x__| *x_|*__x_*x|*___*x x| _*x_||__|**___|* *_*x_x|_*_ x*_ _x| |*_|*x |x__xx_ |*| _***| x |||_x_ _x x|xx __xx*|| *x ***|_| _| _|** **x|x*|*x* * |x*_*x|* _| ||x|| x x |_x*_|| xxx*|_x_*_|x_| _x|_*|||*_ _* |xx||_* **||x_ x*| _*xxx|||*|* x_|_x|*x _|_x|x*_|* _ *x**xxx*x _* x_x _x**xx xx_ |_ _x* xx _ * _x__xx x x__x*||||x*|*|*x||*|_ |x|___|x | _x _ *|*|_|__ |*|x*_*|||*__|_*_x * _|x*|x|* x* * *_x*| * | xxx|__* x|*_x _** |*|*|_*_x|_ | x|||*|xxxx *x _ x_*| ||* _|__ |x |*_x|*xxx xx*_ * _|| * _ x xxx| |xx xx**|_|_ * _x** _xx x|__ *|*x_* |_x_*| *x|*x**__ |xx|* * _|x_ _ ||_*x|_xx_x| *x* _**_x_*_* |xx_|x___x_|_x*|__x_ _* **_|_*xx*|* **|x** |*||__xx**xx|x x *_xx *xxx__| *_**_|*|x|||* *| |||||x|x|_*x| |* |_ |||x|_*| |_ *__xx|_xx|*__xx*_x_ _***| |*||__ _ x* *_*_ _|| _|x| _|x_*_|*| *x_|_**||***| *x _ | **_x| * _xx_*xx*xx__x_*|**_x_||||||x*||_|__ ||_x x| __ x*__|* |** xx|||||__| _|_xx|x* ** x|_*x*x||** __ _*x|__x_x_* |__|xxx_|_|_ ___*__|x_*|_ *x |x*x | ||||_ __xx_| | x*xx__ ___xx | * _xxx |*|| x_x|_x_|*x|xx_x *___ _|___|x*|_||_|_ |** | _ x x*__|x_|x| |*x_*x_ || _x||__x |_ _ * _*|x* _*x*_*x**|_||| _* |_| x| *x** _|_x| |x_*** x*|x|| |xx__*x*xx |x |||x||_*x *__|x |xx _ xx |x||||x_x _* *x*xx_ _|| __ **||_|___|_xx*||x* ||||*_ x| x_ * |*x__x_ ||x|_ xx| *xx **x*_|x_x_xx__*|_x* _ ||_|__ *_ x__|*x||__ |xx | |_||x xx_*|||_x*_|x*_|__x|x|__* |_ | __||*|*__ x* *_x_|*x*x*_ _x_|x*xx_x_||** ||_***xx | _|*_x*_x*__* *x |xx||_x x||_|_*x ___ *__***_xx x*||x |_*|*_ _**_ _|*||_* x*___ _|_ x|x| _ |** __|x*|** *||||**|_xx xx|_|_| x x*||* * _x|| |** |*_*__* _|**xx|_ __| ||*_**_ _x |x|x|*__ |* ** **x___|*x||xxxx *||_x__ *|*|||_x*x x x||xx* x xx x | _x__|*|*x*x|x_x_| _ xx|**|| x|x| *__x*| _xx_ xx|x **|x|*|_ x_x*| _x||x*_** |xx_*__xxxx|xx__*xx _| *x xx*_x**x**x_||**x*_ xxx|___|__*_x _xx_x_x** _**|_x_ |x*|||_x|xx***|| __ | x |x_xx * |||| __x x_|x|*_ __**x x***x*|xx*x|_|*_ ___xx**|_| x**|***x__x|xx _* _*_ *_ xxx*_** xxx*_x**x _|*x_ ***x_x_xx* x_|xx*x*x* |*___* xx x_***|__|x x_*_|_x |xx x* _x|**|* *__|_ x____| _|*| x|*x x_ * x|||xx_| xx|****| ||*|*** x_*| |_|x_x*x_ x x** _x**_ _xxx|_ *_*|* _x*x|*x_ x|_x_ *||_ x **__x|_|__|x|*|x__x |_ **_x| x* x_ * _* * x_*x x|*_ |_ |||||**_x*___| **|*| | x * x**|||* * *||||| _*_|x_*x_|xx**x*x|x| |*_xxx|*_x|**|*|* __ xx|*_ _|*|_*_* | *_x*|*x_||*x|x | _* |_x ***x*x* * _* x_|* |__x| _|xx__ x_**xx***|**|_*|**__ _** x_xx||_**x_||x_x|| x||____*_|x__ | *| __x| x*xx|x|x *xx* x| | x__x* x_|*x||_ * _|x __ |*|_| __|| _x*** x_x_ x |__|_ _x| *_* xx_**_x|_x|x ___|_x_x*|_ | x_*_*|_ ||||* _x*** ||x_|xx|x *_x| * _*_*|xx*_*xx_xxx |x** **|_|* _||*_| x* *_ x x |x__xx|_*x*_*|x |x*_xx*_|_* |x| x x**x*|x x *_|_|*** _**x _| x_ x* x|*||__ _* || xxx|x| _||*|**|_x x ||_| *||* x| x*|x*_**x*x**|__| *x_||*| x_|||*|_**|*_|*x __*x |x| *_ x| _ _x _|x*||_|_ ** x_| *x_| || |_||x| |_*_|_x|x*||*x||xx|*x*_|| x_*_x _* __|_**x*x*x _x|*xx* |* __* *|x_*_ __|x|_x*x* ||_| |___x| _x_|*__*_x_*x_*___ ___ |xx ** ||**__ **_x*_ _|x|** _* |x_xx|_|_*|* * *xx*||__* *x__|_*| x|x| | x*x| _ x|_**|x_|| *_x_xx|___ * x*x _ x*_|| * x__ x *xx | _|*_ __*x_* x* _| x|x_*|* __ *_x|*x* |||* *_|**||* x|*|_||_x|x * | x_|xx *_* x*_x __| * *x**_*x_ * |__*|**| | x| *** ||*x ||*x_||* _|x||*| |||x**|___*x _x ___* | x*x| x|__**|x*x|_|| |* xx |_x|*|*|x_*_ _xx _||x|** ** |_|_xx||x*x*_*x|| *_ | _*||x * _ **|_xx* ||_|x_ |xx** x |* **x_ | |* *|_ _*||x |x *x|*x|_ x || *||*x*x_* _**__| _***|*_|x_| ||_x* x x|_x*_ __ xx*x|* **xxx|*| __ xx_* _ _x_x**___ _|_ x_x x *||_ x* x_ xx *x**xx||_| |__| x _x _*x| |xx*x|||__ x||_x _ _***_||_x****| _*|_x__ xx * *|x_*x x_ | __x |*||x|xx_x_|| _x*|* | __ |xx*_|x||*_x*x| xx||x__| *_ _x_| *| *xx_|xx x__ |__*_ |*x|** x x*x_|***_x** **_ x_*_ | x|**|x|* |x _ * | |**_x_**x_x|xxx* *__ *|**xx|| xx|* *xx*_|x|** *|_*x|*_x_x *x|____x*|****|x|x*|||_ x|**_ * | * *_x* |_|_|__**_xx* xx*_x||| x|xx*xx*||x_|x x*|x|_x_x|*_ _*|__ *x|| |x *x*__ x|_**|__*_ __ x*xx*__* x|* |_ *_*_ **** |_*||*x_ x _*_*_||x|x___x*_|||x|*_| |_x*||_|x*x*x*||*|||_x*x_*** ___x_|x|_*x _ *x*xx__* |*x|* ** |xxx_ x * ___|x|* _ x_|_|xx**x_ x_x| |*x| |x* x__*__ _*x* x|_| _ x*|_*|x_*__* _**__ |x|_xxx** xx_|**xxx|*_| *|__|_*_| x|| *__* ||* x *_|| *|_|*|_x__x*_*x **__ x__* |xx| *x||x_*x||*_ *xx*** x**_ _|**__|** |*x *|___x_x||**||*_ |*x||xx* ___*|*|_|_xx **|* *_ *|xxxx**||x_x |x||*__x ***_x |__|* _ * *x| *|_ * | *| __* _ *|_ x ||_ *_| _|_x_*_* _ * _****|x*___x || *|_| *|x*x***| _*xx_ x*x_||x |x* ___*|x_*_ x_||x _| **x|*x| _ *|x|x x x_xx|_x_|x|| x_x _||** *_ x|_| *|_*|*xxx_x _|_ _*xx*| _| x_x_x _x_x|xx |x|x xx_*x*x|xx|*_ **| *|*_ xx** *_* _|||xx_|**|x_*x |*_xx** *|xx___ _|_|*x*x|*xx*x*|__|x**xxx **x x * x| _ |_| x*x |**_x_ |x|x *|* *x_** x|_|_|_x*|*|*_ * __ xx**_*|* * x||x|x_ xxx x||**** **|x *_| _**x |_* xx||| ||*x*| |x |*_* x_ *|xxx* _ _*xx__ | |_x_| __ *|x||*|_xx* _|* * **x |***| _x |x *_x __|x x*_*||_ |x xx*x | * * ||x_x _|_ || |*_||_*_| _ *__ _*|*|__x_*|xx*| ***||__x _*xx__xx*_*_x|*xxx** x*xx_ _| | xx**x *||x |_ **xx xx* |**xx x__*_**_x|_**_ *|**x__*x_* xx*_* ||x||xx*|x* *x xxx_ **_* _ _*_|_|_ *x_*x__ x _*_|_* _ ** |_*_* x*x|** *_*_* * x|x xxx_x _|***__xxx_x*__*x|*|_ |xx x_x_ x_x*_|||**|||x |* **x__||x | * *_|*||__ | _ * * xx|*_x|_*_ *x x*||xx_*x_ _*_|__ xx*|_ |x x|*x_||| *|_xx _*_ x_x__***xx||x__||x**|*_ | ** | _xx _||*_*_||x*| *x*x_ | |*_ _ x_ _|x|x__||x|xx_ *x** x* _*_xx__*x|*_|_|*x _| |x_| _*| x* x_*x |x __ *||*_*|_ |*_x* x*x_*_x_ _*x |_x|x|x_|x_|*xx_ x*****x|x| *|x *x *_|_||__ __x| |*_xx**xxxxx| x_**|_*x__x**x**|_|x|__xx*| *x* x__|x_ x x*x_*xxx_*__*_x|_|*x*_ x*| _xx**||||* |*x|_x * _ || _x|_ | * |xx x||x_|*|x**x_ __|x_ x_x* _* _|x| |xx|x*_|_x| * _ _ x*x_*x**x_|** ||xx _*|x||_*_|_|*xxx|_ *| | x_|***x|_** xx|x* *x|_||_*|_|_*x*| _*x| x||||__ __||* | *|*_x|||_ _x* ||*|__* *|* ___x *x __| |x _|x*x|x__*x_ x_|| x_*_|x|_|* *_* xx_ * |_ _x _|_|_*x|_ ||_|x_ * *|_***|** ||x*x|xx* _|||_*_x *___xx | x* |___xx *_*x|| * *|xx|_xx__*x ____***_*x|_x|* _x |__x*_* | x _ |*__ _|* | _x__ | | _*_x*x xx|*_| | x xx***_ __** xx____ xx__x||__ _ __ ||_x_x_* _ xx|* __x||x__*____* x|||x|x |* |_|__x_** x xx||x *|x| x_*_*|* x|x*x _|* xx__*|*x ___ |_|*|||*xx**_||| |x _*_| _x*_*| *_|_||x| **x|_ __*| * _xx*xxx_xx_xx _|x_|*x_|_ ||x| xx**_x*x|_xxx _|_| ___ *x*|* *x_xx|x___ _ _*x**x *x x|||*| x*xx*|**|**|** _|___*x*xx|xx|*|_x| *_|x**xx *| _ _ _*|_|||_ * xx|| x||**x|*|_| x*|**|_x ||| * **_*_x| **|** x| _| x|_ |***|_* ||__x_x*_x*|*_ *_x x* x x|_|x |*x|_|_ *__x*xx x___ _xxx*|x_xxx__ xxxx*| *_*||xx|x| __*|*x ____ x|** _*|*|__|x*x|*xx |* _ x | *x _x_**_xx_|*_* __ *x*_* _x| |_**x***|** x* x x*x *x_x* xxx x_|||* _**|x_x_x_|_ |_||*x|_ *_x_ _x*|*x*|_xx_| x| x|_* ** _x| |x *x**_|* xx*_|* xx*_x* |___*|_ *x_xxx*| | * **x|_ x__x x|**_ |*x*_xx_*||*x |_* |_|_x|||*__|xx_||*x_|x_x*x_|xx__*_ || |__xx|x* |*|_ **x_ *_x*|*|_x x__ |_|*|_x __|_x*_ _ | x| x**x**| x|| |* |x*_|*xxxx| |_| xx_|xx* x|* _||_| _x||__| x|x*__x|*_xx_** | x|_|x_x*||__xx x_*_ _*|*x_|**x___*x_ _*_*_* xx*| *|| x* _ x|| *|| ** __|*___*x_ x|x|||* x_xx| x *||__|_x *x_*x| | *_ x_ *_*x _ |xx*_ *|_x*x__ *_ _xx_*|x|**_ _|| *x_ _ x __ |x_x* |__x|xx x _x*| |*_ x x|__x x***_*_**|*_ |x_ *x* |*|*x_x**x x_ |_xx*_ x_ | |_||x xx|_x *xxx__*x||_|*_xx *x|_ * |_|__*x_ _x||_|_x _x**| * _ *x|* _ |*_|_ _xx *||| x_ **| _|_* || x|x|||**x * | xx**xx**_xx_ |*|_ x |x**_ *| *_| |_xxxx*x *x x_ _|*x* * xx x*x _**| _*| x*xx x x*|*x|*x_ _x*x *| | __*x*_ x__x* x*_|x _****xx*___* x** _ * * x_ ||xxx ___x_|__|x* _xx _|xx|*|x*_|x*||***_|_|_**x*x |_ _|x_**|__xx_ | | x_ __|_*|_ _||x|x **_*_||| **x ||_ |*|_x**x__ _xx**x_ x| _x||xx|| _ xxx|___**_* *|x*| _ xx_**_ x _ _|x **x*x|||****_ x_x__| x__|x |x|_ _*x_ * x **___ *x|| *|x_ _||_x _ *|_ _|*|*| __ |*__||*xx_|x*||x||x |||xxx*x_xxx _*_|**xx|_ |x x _x|*x x**| _x* _x**|_|*xx_*x||x_|xx|_x* x|x*x| x_* x|x|x_ *xx|x* x_|x *_xx_|*_|x | | x_xxx | |*_*x_| * ||_| |_|*_ |*xxx_* || x|||x_*|| _x_ _* _| | _** | ___x*|| *xx|x|**_xxx |*_*xx x *_ *|xx |_|__* _| _|x**_|_x_**_ |**|_| x|***|_x_ |_ *xx _| _*_x___xxx x*x*| x*x_||x**_ x||_ x_*x**_***x*x_x _| *_xx|x|_ |x*x*_*x|****** _ |x|*x_* *x|* | _x|_x* ||_ |x_x||xx*x| **x*xx*x*x|xx |_ x| _x|*||***|x*_||_*_xx|*_* x |**x | x_ _x*_ x_x* *x*** _|x_|_ x|xx__x*_|_ _x *__ _* | x|* __|x* **| _ * _|x** *xx_*x_|xx_xx|||| __x*x|* x_|*x_*__ _|x_|x|x|_x_ |* |__x| x*||*_|*x_ *_*x**|*|| |___x_ * | _ *|*x** **x||x| * _|_*x|_* |_|x__ x **_*x|_* _ x|**_xxx| x x||_xx_x *x_*_x_x* *** *|x||_*|* *_xx__x|_||x _*_x x*_|_xxx ** x|__||x|x_ x|** |x x*|* x_ __ |x_x| *x| _xx_x| __| _ |x _*x|___| _ ||_|*_|*_ *|||__|*_ |_|x|*_|__ ***x|x_|*_xx|| x*x*_ __ _| x__*|xx_|||*x_x |_*x _ _ * _|_x_|x*x_x __| x*_|_x* ___ x _xx|** * x*||*x|_x|x|_*|xx|x__x* x|_*x*|_| |_|x * _*x|x|x|x|xx|*x|*x _*_| _xx| _ x |x|_|_x*___*x x_ | |_ * *_ |__|| __|* __*_|_||*_x* * x** x_x__ |*__|*x*_ x__ *x*x* || |_ |* *_ xxx*x **_*xxx * x |_|xx *| ___x** x_ * x|xx_*| _* *|x __ _|_xxx x** |* ||___x* *| _|*_**xx x || x|**|_*|xxxxx x__ ***|_ | x||***||* | _| |xx|**x__ _*_|__|| ***xx |_x |_x|x__*_* | _xx|x_*x x|*_*x|x |_** x_ ||_ x|* x_ x*| |_ _ | ||* *||_ ___xxxxx| | _ _|x*x ___*xxx_ __**x_x**_*|_| __**_*xx || x|x*|_ *|_xx *_| _ x _|_*_ |_x |*_x_ __**|_ x***|* *_ _|| | _**_*x| |*x*_ ||***x|*____|*xxx| |x*x xx_x|*__*_|*_ x_x*_ * x** *** *| |*x _ **_|x***_xx| |* **|x_xxx*| *x_*x* __** |x|_|_ xx_|_*__||x|x|_**x|_x||*_| *_x_ x|x_*x*x|_|x**|_ x| __** *xx x|x ||xx|* ***x*| x__*x__ _* *|x **_x_* *x*_x_| *|___xx** | _ *_ *x| x***__*xx_*x x ** ___x _|||x_x|| _ ** __||xxx xx_ x|x*xx___x| _x|x|xxx|x||_ _*|x|__ |_*_**_x x|_|_*_x| *x| x _* ||_ __ *xx*|x_ *| |_ **|x*_|||_*|*x____ x|_**_x *x* *_ _****| xx*|x|_ | ** _|*_ ___x *_*x*xx|_* *_ *|x_||_ |x* _ **_|* ||x||*x| |__ ___ xx|_*__| |_* x_ _____x*||x|*||x_ |_|x_ _x|| **__|_|x| | | _| * * __ xx_*_ | |*|*__x||*xxx*__ * ||_| |x |*xxx_**x| |*|xx x _|*| *x_*xxx*|**x*_* _ **x**x**_ x__*x**__|*_|_ _x|_*|x** * **| *_ *| *xx |_*_ _*_x|_|||*x**_*|x*|* xx** x_x x ** x | *x x*|__*_*_ **x_*x _ x_x | |**| ||x | *x_ x _* |_x__**_ x*x_ || | _*x _ * x| _ * x*_| _*| _|xx_ x|x_*x|**x* |x|*xx _x| * ** _|__*xx_|_x_****x*|| ** *x |* ||||x_** x|_*|_| x*|_|_ | x*_*_ x _| __ *|_|** _x* **_|x*| __xx_x|_|___|**x||*_|_* |____|||**|_ |xx *x||_||x|x|___x| *|_x*_|x||_| *|***_x_ | *__xx| ||| ||* x* *|x* xx*_*xxx*_ x_*|**|_|* *|x_| x_||x_ x __ x __||___ ** x_***xxx|_|_ * *__x||*_x___*|_ | ||___x__ *__* * __*x *||x|*x _*_ |_* *_|** ___*_ *_ |xx_|x xx||x| |**x_xx_x|x| _|x_| | *||| |xx|*x**|**_|_x|*|_|_x_*_x_x | |x*xx_x*x x***x_|*|x*|_x| *_ | _x xx_||xx__|x***__*x x_|x*__*||*_ ||_ x|*_xx**| _***_| || x||_x |x_|x*||* _*x x_ | xx x|_ xxx*x_x*x_|x|_*_ *_*_ x_*x x_|xx| xx|_*||x|*| _ |x_|xx_ _*| x| *_x _ |*x_x||x|_x_|||x_*x_|xx_| xx| |_||_|*_**** |*|x*|*|||*x*x_****xxx ** *x_ x*xx|** **|*| |x| *x*x**|x * |* *| ** |_xx|*x * _ *x|_* x*x|_ x_*|_ _ x|* x *x_ _x|x*|_*||_xx **|||||_|x_* __x|x __|xx||x| xx_ xx||x_*| *|* ___* *||*_xx*_ *|*x__*_x x__|_*_x *|*_ **x_||** x|*_*_x| *|*|_* * _x||*x_ x|*|*x**x _| xx*_|xx*x*|_ _x__xx_|_|*|*|* * x|xx*| * | x *__| x _|_|_ __ x|xxx_*||*_x|___||**_ * *|xx|x||_ x x x* xxxxxx| x_|* x|*|*__ |xx_*|| x_**_ || x_* ||x |*| x*_| _|x|****|*x*_x|x***_|***__*x*|x *| *|*_ * x| ___ ||||x_x* xx| x_ ||*_*|*|**|||**xx* *_|x**x |*|*|_ _|_| _* ____x *||_| * | x||_|*_* x |xx*___* *xx* _*|*|x|* |* _* _| |__xx_x_x||x** _* ||_x__* |_ _ _x*|**| _||xx| |*__x_x*_*x_*|x*||_x_ _ * _ | ****x|x __x| *x||_x|__xx_x *_ __x| _| _* *_ _ x**_|||*_xx |*** xxx*|*xx__x__||xx_|_x* xx|**__ |*_ *_x||_ ***x x*_ x | |||*|__ *| *| xxx _x| * _ | |* __x_*_*xxx_ _*|_| x*xx_xxx__|*| xxx|***_xx _*|_| *x _**_|* *x| __*x* x_** _xxx* __| x| *|**||*|*_*| x *|*|xx **__x*__| ||x|*|*_|*x*x _*|* *_xx*|_| x* * | *x_xx* ***_* xx___** _*|x |*| x_*|x _x* **|xx__|_***x|*|xx * x__x_x**_ _**x** xx|_**x**|x_|_x * |x* __ x|__ ||x_|*x**_|*x___* *||*x_* _||x*** **|| xx__* x x_|_| x __ *|_x x|x_|||_|x*x x |xx xx _ _|x* |_*x| x|x**_ *_|xx x x***|||* **| x**xx*|xx*xx|xx |*_* _|x|* |_x| _*|*_* ***__ _x _x x*|**_ __x|x*|_ __|_x *__* ||__|_|*x**xx|xx__|__x *_x ||x__x_x |x ___*_ _ |x__xxx*_x _| _|x*| _*_*||_x|||*_*_|*_*|* ** |**_ x | _*||**x|_x|_ _xx*_|xx x_xx| _||_||**|*x_*|_xx|*x|x|x*__* * _|_*xxx| * __xx*_*x_ |* _*** _x*|| |_x_| *xx*_ _* *x*x*x|*x*_x| __ __||x *x*|_x||*|xx _* xx| _*_ *|x__*_||x* _xx*_**_ xxx |*_x|_|_x*_x*| |x | _**x* __x* _|x _ | _x|* x *| |****_ _ * x|||x _x_|* |xx****x *|x_ ||x|__||| _ _x|| x x **x x |||*x |x|| xx|_ x|*x||*|_*|__| x x| _|_*_ *|| |*||_x_x _x_|xxx__x xx|_|__|x_x* __ _|||_*x |_x*_xxx *x|**x * * xx* _ **_*x|*|_|xx|_*_x xxx|_*| |||*x*xx|_*|x*_x__|_||**|| |*_| x*_x x| _ _*_*_ *|x*x*x_x_ |* | x|_**||x xxx*||| x**|x_|*|*x* |*|** * __|x*x_xxx** | xx | |* |x x*_ _ * * _ _*x |**_| x__|_x__|||** *x* __ __ xx| * x** | *_ __xxx|x|x|| __*||x* | xx| |x|||****x_xxx_* x*|*_*_||*|x| x|* _|*x | *_| _* __| |__| *x_|__*|| ||_|_ |x x|x**||||x||| _||_|x*_|_*||_*__ ____*x|__x|x x_xxx|__*_*xx |_*_x|xx|*x||x __| _ _x|x |* __ __||x||***x _ x__*_ _xx x ||*_x|* _ * *_x|x_ _ x |_x***_ _***_ |x |*x|||xx x_*** ** |_ x*_xx __*x x|___||xx|_ *x|*x*_x *|**x|* |x|x**xx_| | *| __x**x*xx|_xx __|_**|*_ x|||| _| x*x __|_|*x****|_ *_x||_||*x*x ||* __*x_ x _|*_x *|x| ||x|_xx* *_x||| | |*| x*__ **|* x __x |* xxx** *x |*||_ * x*x| _ _|x|x_*x |_*x| _x| * x _| ||x||x _xx_x x*x|*|__x_|*x*_ |xx*x_| x_xx_|x | |_*|_x|| *_ |xx *| ||*__|x_*_ |xx *|* x|_||||** ||* * x**__x*_*x_ * ||*|_| x** *_**_* x___ _*__ **|x * *|*x *__ |*_| __ *x***||_ |* *x ** _| _|x |x*__|**|_|x* xx _*||x|_|_ *x*x*|x|x| _* xx**x_|x|x x*x* _|x| _ _ x __|* *x_x |x* _ _***|x|*x||_*_ **||x_* |_* _ _** |_ __x| xx| xx |_x*|*_ x __ ||_|____|||_ | |x *x| _ _*| _x _*||x_**__**xx|*_|__| __|* x*|x ***x |*||*___*______x_* x_xx|||* |_xx _x |x _|*|__|xx_*___xxxx*_| **_ |_ |*_x||*_x*| |__|x*|x| xx**xx |__x*|xx_| _ *x**_x** xx* *_*_*|_x__ |*_| |xxx x*|_||_ *xx_|_xx |_x||| |||*|xx**x_x*|**| _ _x_ _ _x**|_xxx_*_|_ | __ |||| _x_ * _x_*x x*_ |*|*xxx| _ x* |* |*|**x_x** _||x __*| x_x_ *x|_xx|*xx*_| x_* ||_ | xx_** |xx*x_x* _|*__x| *x _*|||| *|x__xx***xx_| |x _xx**__| ** xx*x__**x| | x *x|_x*|*_ _ *__x_ || x|__* _x_| |*x*__|||_*| x* xxx _xx *xx||xx||x|_*_*_ *_ _|x*x_* xx _x*|x _||||_|*x_* *_*_*|****|*_**|_ * _ |xx* |xxx_|x_ |**_|* |x |* _*_x|x*||||||*x*x_ | x _ __* _ *_| *_ *xxx|| ||* _x|x *|x|__x*x*x _|x x*|*x_*||** xx* x*x* |_||xx_*_xx_**x*||_x _* _*|__x**__ ****xx|x*_x_ x _x*x__ _**| _xx* *xxx_xxx_|||*x||_|xx|_ |x _ _ _x |xxxx*_*|*_*xx*x___x | x_x__| x|x**|*_|xx_ * _ x_||_ x| _ *_| *|* |xx*_*_ _|_xxx*_* _ x|__ **x*_*|___ __xx *_x|x xxx|*| | *xx*|*x_ _* |*____x_ |_x*___ *_x_x_x _ x*| _xx* |_ *x|x__*__*_x|_ *_ __* x||x|| x**| |x|* | _*___*_|* * _x_*|x *x_xx *|||*| xx** |||*___ x* |xxxx**| * **x|__x___*x__**x||*|_xxx_xx||_* * || _*|*|_|x_ xx*** x | __|*||*| xx___ *xx*|****|*xx*_| __ **xxx| _ x*x|x x| |x ** x|__|** |_*|x*x| ***| xx* * **x| *| xx _* _xx_ * | ***xx* __|x __***x*_*_* _x*|*|*|| * |*_|xxx_ |_* xxx**x_x| | ||_*__ x** x**x | *_|x*||__xx*_*||*|*xx| |x |*xx|||x_|| *x|__ __**x x_*x_ _xx *|*_ * *|x||| _| _x_ x_*x*|x x__x _| x |_** *x|*x|_ _**__x|_ xx| |* _x_x| *x x|||**_ |_* _ | _|* _x_| _ x xx_ x|x_*|*x| ||x|x *xx *_ xx|x_| x||||x*_* _*x| _x_*|*|*x|**| || x ||| __|*| * x|_x*_|*|_***xx**x **_ _*_* *|x| ||* * x* | |**xx** xx__*xx*__|** _||_ _x|_|xx | | || |x*****x_ x ||_ x|* ||__|*****x* |__x* *___|* __ _||*x_ *x|xx*_| xxx***xxx| xx||* x _*x*_ x x|* |_x*_|__*||x_ |xx*||_| _|*|*|** x *|x *x__*|*_|| | xxx*||x|x*|_ **_*xxx___* |*|*|x*_|_x| __x|_|x |__| |x x||| | *x |__*x|x_**__*x xx|*_ **| _* _*|*|x | x|* | _|**x|x__|xx__* | _xx__ *_*| x***_|*|||*|x*x||||_* __||_*|* *||_ _ x _x_____ |*__ *_ *** _x| **___ | * *x_ |* |x_ *x_x x*|x _x| **xxx*x ||* _|| *x|xx_ _ |_| __ x_x_x|_*|||x_||x |*xx**_||x__||x* x x*_*||*** |_ _x| x_ | _| * _|*_ **_ x* *_ __|| |_** xxx_*|* x***_ *x *x_| _x_ xx|xx|x *x*|__*|__|**_|x|x__ _x|*_ x_x| *_xx|*xx* x x |*|_ **x_*x*_ __ _* |x _ xxxx |_* |_ **_x |xx_|**_|x***|x|*_|*|*||| *||* |x|* |*__**x|xx _*| x__ **x _|xx|* * |x| _x* **x* | |x|*_*_| |____x| xx x|*x x|*|x x|*_xx_x_x_|_x||*x _ x_ x| x|__x_|_x***_** | * ||x_*xxx_x | _ _x| *x_ x* *_||||_x x |x||x _* x* _|_|x |x |___*| x_|__ *|x*___ |*x|* x*_**x *_x _ __*x* x *|* |_ **|x_x_*|x x ||| _x|**x|**_**|*|x*xx_|**|*x*| _x*x_*x| _ | |_ __*||x_* |* |_ xxxxxxx____ *xx x_x *|| **x*_|x*x_||| xx_x|_x|_|*_*_x*|x__x x_*_ * x xx_xxx_x_x_x_|x**x**_x|*x x* |* _*_* _* |xx*x_|xx_ _x|*x| *| x*|x*x** xx___ x_|__ | x_x| *x**|| *xx|*x*_ |_x x*_ |*|* __||_|xx**|* *_x_ |xx_*|**_| ___x_ x_|*_ x _|x| |_x_|*|__xxx __**_** x||x*x*|*|**|x|_ xx_*** *__x *x _ || *| *x |_ |_| __ __ |x*x** *|| | _x x_* ||* *x|* _| **x x _| _x|*|_ _|||| x|x*x_* **_*|x*x_| xx|x*|_x*_|| **||__|_x*_||_x||x _ __ x||| _ x_|x| x|* |_|x* x|_x|x_ ___*x|_|*__|| *_|* x___|x|*_ _||_ x|*|*x *| _**x*xx* ||xx|_| |*x|_|*|*___|x||__*_ |*|x*_x |_ * * x|* *x*| * __|_ * x_ xx||_ x | |*|xx x_x| *|| |x|x**_x*|xx| x_| _x_*xx_ * |x* x*_*_ _*_ *** |*xx|x *__* __ _|x_|||_xx x|x|_*|x|||*x*|__ x_ *_ x x x|*|| | *xx__|_ _|___|*_ _| * * _x*__|x_ _x_|_x x |x**__x| _ x _x*x_x*x x x x *x* |x* _*x| x*x x _*x* _x|*|x*_xx __|**x*xx_ | |_|_* x *_x* _ *|*xx* _***||_x ** _*_*x __| _| _x|x|xx|_ *x__ * _|_|| _x _| x*__ |_**_ _|_* x*|x___|*_ *x _* |*_*x|_*x*|*_ |_*|* __x|x_*_ _| xxx*| *__ ||* xx__ | x_*xx| *x|x*|*||_*xxx|*x_*_x x_*_x x|||*||x_ _ |x | _*__*xx|* * ***|||| |____xx| x x *x **xx_**_|xxxx |x x _*_*x**_x |xx||||* x*x_xx | ||_x_x| x_|_x*|x_x _ |_* __x* _x * x_**x*_xx** * |xx*_** _x * xx_*****|_*x *_x*x | | xxx| * _*x_x |x __*x x*__ |xx *x|_| _*|__*| _**_* *|__|x*x *xx _x_xx||x _x|*___ *_|*x _ _x_* |*| xx||* ***x *|| x* |**| _xx__*|_x|x x_x || x _|_** |*x_ x|*_xxx_ ||_|*x|x|___ *_x **_xx_*|| |_x_x_ xx _x*| x_**_ x_ *x_**_ _|||x x*x __*_*x_x||_|xx _|xx_ ** x|* |||_x||xx *||xx*x | * ____ **xx **_xx *|x||_x x_*_x**|_xx _x *|x x| |*x|*__xx** _* * xx|||x* x *x|_ |_xx *|**| _*xxx_* xx _ *xx||** xx_*x_xxx *|*|_x|| _x*x _|*x_x|_*x x||_*|*_ _x|x _* xxx*x*||__* *_x_xx*x_x |||_||x|*_ |_* *|x* _x|||_* |**x_ |* *x__x *x||| _x| *_xx*|x_x|*x|_ x __ x_||xx_* |_|***||| *_ |_| x*__|*||x * || x| x * ||x|x|x*| _ _x*x*_|x*__ |**xx|_|x|x |x * xx|*_*_****|*|x_x|*xxx_** * |xx |_|* x_|| * _x * _x_ ||x*_|* |**||* ||_xx|x x_ ||*_*_*|_* xx_x_* |x_ _|_ __ *x*x|xxx x |_|x**_|_xx|x|_* |__| | |x_*xx * _x _* ||_|| | |xx xx __x_x xx|xxxx| x___|_x| |**| xx_|*x | |_xx __* x*_*__x| * *_*_ __|*_**|x||_*x_* *|xx _x_ _* x*x |* _x*|_xx xx* x _ _x*||_ ** |*|_ x_||x *| **|*_ _ |* *_*||x|x|x| ||*| _ |__xxx_| __**_ *| |xx *x*|*_* * |x* ||_x|__xx||x*|_x|x*x| |_x||*_****_xxx|| |_*x_* |**_*||_x *x *|x| *** x__*_|x __xx_*||x|_**x* x x*x**|*|| _x** *|__|*_| x*_*x_ ||_ x _| |x____x_* | xx_* **||||x| *_x_|x_*xx||x* __ x_x|_*_x*||x|xx |*x|*xx__x x|x * |___| _|| xx|||x|x |***_ | |*_|* xx||__* x_x*| * * x* _xx x*_ _ * *x *|x|*xx|_ _*xx* xx||x*_|_**_ |_**xx _*x ||__| |_*x *_*_|*x|_|*|_x * ||||_xxxx _ | _x ****xx|xx|*x___x_x_ * **|x_ |_*x xx *x **x* *||x x|x | ||*x|*|x_* xx **_*||*| |_|* _*x *x_ x* _x*xxx*_ | |x ** _x*_|*| x_*x| |x |* _x*_|x xx___x| *xx_x _ x|x*x_* *xx *x*|*x** _|| |x*xx_|*x_ |* | ___* *x|_||* * | x|_ ||x|_x__| |_**_||_x x*|**x _* |x**x |*x|x_ _*xxx||x*x_ *|__x |*| **_* x_ *_ _*|x*xx ||*|_x|*x *|_ **|* x *x*|x|_ xx* x_* **|xx** *__x_|_x*_x||||_*| _| _* |_| xx*|| *** | | |x _|x___|x x*_ _x x*||x*__ _xx xx*x*_|*x___|*|_||| *xx*|x x***| *||_|xx*|_ x|*|_ |_*|| *_xxx|| |* *x*_*x___ **_ * _| xx*___|__ *x|| _|_* x|*x *|x x|**||_ ||xxxx_ ____|_*_x**x|*xxx|_ |*|**|xx x**| _ |xx x**x_x x|__|*_||x*|| x_ __ **x_ | __x*x_| * ***x_xx*|x**|x x*_*x_*_ _ x x_ ___|x*x x_* xx*_xxx x_ x*_|x |x * | *__xx*x____|||xx |__| xx |x_*| * x*xx_ ||x ||xx_ x|__ |x * _|_|*_| *____|_x|*||*x__| x|_xx*xxx|*___x_| **x* _ *|_x*_ |_*_x x||_|x_|**_ _ |x_ __ |*|x_| |*|x _ _xx|_x_**x **x__||__* x_ *| x|_|** x*____*x||x|_|x||* x| |*||_ |x x_*x*x x _|x|_||*_* * **|_x*_x_|x|*_xx|*_|_|***_*x* _x|x ||*_ *|*|_x |*xx |_ x_x *_|||*x|*||__ ||_ xx* x*x__ x x|*__***_x|xx**x*x| x*xx_|x|*| |x | |||x*__|_x_ _| | _* |_ *_ x |x|_****|x_|*** *|x__xx|__xx* x_x _x__|___* *|*| *x** | x*__**_ _*| x_*xx**||| __|x* __|| ||xx x_xx *x* _ *_ x _*_| **x||x_ __x_*|_| **|| __|x**_| _x*_xxx**_*| xx|_ *_ **x**xx |_xx_ _ x*|_x*| * x*x_* | *_ *x||x _* |__ |* _*xx_ *||| x*x|x___**|* _|___x _ *|* x_***| |*x|* _|| | x*_x***|||x **||*x __ _xx_x*_ _ ** x x x_ ___|__*x _*|_**_ *|_ _ | * _* ||__*| x_*_|* x_* __*x|**|x||| *|***_x_x| _|| |x_ |_ xx**x* _*|**|x| *|*|__x* *_ x_*|x_*__|_ _**|*x* _ **x|_*_x x_***|_x* ||| __*_* | *_x*| |*x|*_||_*| x__ *xxx __**_*|*_ x| _|||*x|xx|x ||_|__***_xx *_x_* x***x__x_x*|*x_ x _| __**| *_x_ *| x _||*x xx*|_ x**x |_****_x_|x|*** xx|x_ * _|* |*x _xx *|**x * |x* _ _*|_**|xx _|* * | * *x x|x*|*| *_x|_|*__|**xxx x**x_ _ xx |*xx*** _*|*x_|_*x_ **_ *||x||| * |***x _|**|****xx| |xx*x |x * *x*| _*_ __x_ |__x x|_|* _|_|x ___*xx*|_ | *_x| *x__ * |_** *||x||**_x x*_x__ _**_* _ |||x|xx| |_ _ || _** x* | ** x *_*xx*_x_xx |xx|* _ |_**| __x x* |x||__ |_|xxxx|xx|x_x*x__ __|x*__ x*xx_|||x|**x| xx|x_||x|__ ** _x_ _xxxx||x|_**| |x* _x| |*** *_||**|* |_ *|x|x***x * * _xxx*x* ||x * x|*|||xx|*| |xx| ||* ||_|*__ || * |||xx*___x* | _xx _| |*|* ||_ *|*|x|x **| _ x***x| |*x ** ** x|*_*__|| *_xx|_**_*xx*__|| x|x *x|* x__ x||x ||_ _| ||* |x ******x| *_x_ x* x_ ***_ _||* |*x|*x*| _*|*x**x*_||_x|_ ||* __ _ *_xx| *** x *x*x *x* x_ _x**| x |* x*_| **xx _*_|*_ xx*_ x||x__* _x****x_xx x|||_ *|*****| xx_|* |*|xxx|_| x**xx|* ___ *___x*|_*_*x|_|_| * **| || |*|_x*_|_ |x x__|* |x|xx *_*_ _|* x ||*xx|*|_x __| |x_xx_x_|_ |_ _x
+ + \ No newline at end of file diff --git a/code_base/bgs/7_files/blizard.js b/code_base/bgs/7_files/blizard.js new file mode 100644 index 0000000..97305a1 --- /dev/null +++ b/code_base/bgs/7_files/blizard.js @@ -0,0 +1,148 @@ +//blizard.js version 0.5.1 BETA by Rohan Samra-O'Neill +/* +uses the atomo.css library created by Rohan Samra-O'Neill +*/ +"use strict"; +//inspired by jquery and p5.js :), thanks to p5.js and the processing team for featuring blizard.js on there site +var sl = {}; +var id; +var storage; +//just a little message to anyone who goes onto a website that uses blizard.js +console.info("This project uses blizard.js for more info go to https://github.com/Slitherlizard/blizard.js"); +//with sl.ready the parameter is the function that will run when the page is loaded, i needed to add this in version 0.4 because it's a DOM library and functions wheren't working because the elements couldn't be found because they werent loaded yet +sl.ready = function(sel) { + window.onload = function() { + // basically just runs whatever function that the selector is equal to + window.setTimeout(sel, 0); + } + + +} +//with sl.print the first parameter is the id of the element you want to change the second is the text you want to change it to +sl.print = function (sel, txt) { + + + document.getElementById(sel).innerHTML = txt; + +}; +//with sl.hide the parameter is the id of the element you want to hide +sl.hide = function (sel) { + id = document.getElementById(sel); + id.style.display = "none"; + }; + //with sl.show the parameter is the id of the element you want to show + sl.show = function (sel) { + id = document.getElementById(sel); + id.style.display = "block"; + }; + //with sl.col the first parameter is the id of the element you want to change the color of, the second parameter is the color you want to change it to + sl.col = function(sel, col) { + document.getElementById(sel).style.color = col; + } + //with sl.family the first parameter is the id of the element you want to change the font-family of, the second parameter is the font family you want to change it to + sl.family = function(sel, sel2) { + document.getElementById(sel).style.fontFamily = sel2; + } + //with sl.size the first parameter is the id of the element you want to change the size of, the second parameter is the size you want to change it to these are the sizes you can use +/* +xx-small +x-small +small +medium +large +x-large +xx-large +smaller +larger +*/ + +sl.size = function(sel, sel2) { + document.getElementById(sel).style.fontSize = sel2; +} +//with sl.wait the first parameter is where you call the function you want to run, the second parameter is the amount of milliseconds you want towait to call that function +sl.wait = function(sel, sel2) { + window.setTimeout(sel, sel2); + +} + +// with sl.setlocalstorage the first parameter is the name of your localstorge item so that you can refer to it later, the second parameter is the value of your item. +sl.setlocalstorage = function(sel, sel2) { + localStorage.setItem(sel, sel2); +} +// with sl.printlocalstorage the first parameter is the name of the localstorge item you want to print the value of, the second parameter is the id of the element you want to print the item's value to. + +sl.printlocalstorage = function(sel, sel2) { + + + + + document.getElementById(sel).innerHTML = localStorage.getItem(sel2); + +} +// with sl.click the first parameter is the id of the element you want to add an onclick attribute to, the second parameter is the function that will be ran when that element gets clicked +sl.click = function(sel, sel2) { +document.getElementById(sel).onclick = function() { window.setTimeout(sel2, 0); }; +} +// with sl.id the first parameter is the id of the element you want to change the id of, the second parameter is the new id of that element +sl.id = function(sel, sel1) { + document.getElementById(sel).id = sel1; +} +//from line 92 - 124 i think i liked inporting other librarys too much +//just loads the atomo.css library for styles +sl.atomo = function () { + var head = document.getElementsByTagName('HEAD')[0]; + + // Create new link Element + var link = document.createElement('link'); + + // set the attributes for link element + link.rel = 'stylesheet'; + + link.type = 'text/css'; + //load atomo.css library + link.href = "http://atomo.ueuo.com/atomo.css"; + + // Append link element to HTML head + head.appendChild(link); +} +/*sl.import does not work yet :( + +sl.import = function(sel) { + var head = document.getElementsByTagName('HEAD')[0]; + + // Create new link Element + var link = document.createElement('link'); + + // set the attributes for link element + link.rel = 'stylesheet'; + + link.type = 'text/css'; + + link.href = sel; + + // Append link element to HTML head + head.appendChild(link); +} +*/ + +//I have wanted to add this since version 0.0.1 but didn't know how but now i do know how so i'll add it. + +//with sl.createElement() the first parameteris the element you want to create like P be sure to wright it in capital letters and the second parameter is the element you want to append it to the third parameter is the id you would like to give that element +sl.createElement = function (sel, sel1, sel2) { + var father = document.getElementsByTagName(sel1)[0]; + + // Create new Element + var elem = document.createElement(sel); +//give the element an id + elem.id = sel2; + + + + // Append link element to HTML head + father.appendChild(elem); +} +sl.changeBackgroundColor = function(sel, sel1) { + document.getElementById(sel).style.backgroundColor = sel1; +} + + diff --git a/code_base/pop_up_basics/pop.html b/code_base/pop_up_basics/pop.html new file mode 100644 index 0000000..0d7d301 --- /dev/null +++ b/code_base/pop_up_basics/pop.html @@ -0,0 +1,9 @@ + + + + pop + + +

pop

+ + \ No newline at end of file diff --git a/code_base/pop_up_basics/popo.html b/code_base/pop_up_basics/popo.html new file mode 100644 index 0000000..ea28057 --- /dev/null +++ b/code_base/pop_up_basics/popo.html @@ -0,0 +1,48 @@ + + + + + + +Example + + + + + + + +
+ +
+ + \ No newline at end of file diff --git a/code_base/pop_up_basics/popo2.html b/code_base/pop_up_basics/popo2.html new file mode 100644 index 0000000..bbf98b7 --- /dev/null +++ b/code_base/pop_up_basics/popo2.html @@ -0,0 +1,45 @@ + + + + + + +Example + + + + + +
+ + +
+ + \ No newline at end of file diff --git a/main/world1/AxS/000.html b/main/world1/AxS/000.html new file mode 100644 index 0000000..f5c02b7 --- /dev/null +++ b/main/world1/AxS/000.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:000Oedipus. Pure (Oedipal (figure made out of (nothing but))) time-distortion.

+ + + \ No newline at end of file diff --git a/main/world1/AxS/0001.html b/main/world1/AxS/0001.html new file mode 100644 index 0000000..fefc8a6 --- /dev/null +++ b/main/world1/AxS/0001.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:0001 Closed fate (-loop (multi-linear)) nightmares.1

+ + + \ No newline at end of file diff --git a/main/world1/AxS/0002.html b/main/world1/AxS/0002.html new file mode 100644 index 0000000..44ca4a0 --- /dev/null +++ b/main/world1/AxS/0002.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:0002 Altitude times Spin produces a chronometric read-out.

+ + + \ No newline at end of file diff --git a/main/world1/AxS/0003.html b/main/world1/AxS/0003.html new file mode 100644 index 0000000..35ba1e0 --- /dev/null +++ b/main/world1/AxS/0003.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:0003 AxSys-sustained variegated production-series 1Oedipus (2Oedipus (3Oedipus2 (variationto the nth (with some3 nOedipus as (anomal4 (Sphinx-trading (nOedipii-pack))) threshold to)intensive))) multiplicity.

+ + + \ No newline at end of file diff --git a/main/world1/AxS/00031.html b/main/world1/AxS/00031.html new file mode 100644 index 0000000..6c35f8d --- /dev/null +++ b/main/world1/AxS/00031.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS: 00031Oedipus. The Puzzle Solver.

+ + + \ No newline at end of file diff --git a/main/world1/AxS/00032.html b/main/world1/AxS/00032.html new file mode 100644 index 0000000..e8a772e --- /dev/null +++ b/main/world1/AxS/00032.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS: 00032Oedipus. The Plague.AxS:

+ + + \ No newline at end of file diff --git a/main/world1/AxS/00033.html b/main/world1/AxS/00033.html new file mode 100644 index 0000000..9a64d7e --- /dev/null +++ b/main/world1/AxS/00033.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

00033Oedipus. The Horror, the Horror ...5

+ + + \ No newline at end of file diff --git a/main/world1/AxS/001.html b/main/world1/AxS/001.html new file mode 100644 index 0000000..0227543 --- /dev/null +++ b/main/world1/AxS/001.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:001 Hyperspace Elevator (Sector-O).AxS:001 Axiomatic Systems (incorporated).6 The ultimate capitalist entity (first (true (meta)model)to realize perfect identity with its own product).AxS:0011 AxSys culminates in itself (autocommoditizing (machine(-intelligence (that is alwaysincomplete (due to cataloguing problems (...))))))

+ + + \ No newline at end of file diff --git a/main/world1/AxS/00111.html b/main/world1/AxS/00111.html new file mode 100644 index 0000000..d3417f3 --- /dev/null +++ b/main/world1/AxS/00111.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:00111. Dimensionality requires a (supplementary (or (n+1) hyper) dimension through which itobtains its) power of application.7 Ultimately AxSys (an explicated Earth-memory (built by the strata(((as far) as) it remembers))). ...8

+ + + \ No newline at end of file diff --git a/main/world1/AxS/002.html b/main/world1/AxS/002.html new file mode 100644 index 0000000..0a5bb05 --- /dev/null +++ b/main/world1/AxS/002.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:002 Divide and Rule. Extensive ((or) ordered) sequences differ in kind from the intensivesequences they regularize.AxS:0021 Order arises when a dominant segmentarity establishes relations of superposition between sequences (reciprocally stabilizing them in accordance with a harmonic principle (and consolidatingthem through syntheses of application (efficient models))).

+ + + \ No newline at end of file diff --git a/main/world1/AxS/00211.html b/main/world1/AxS/00211.html new file mode 100644 index 0000000..83b4180 --- /dev/null +++ b/main/world1/AxS/00211.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:00211 Order coincides with the redundancy of the sequenced sequence (instituted conformity(within segmentary systems)).

+ + + \ No newline at end of file diff --git a/main/world1/AxS/003.html b/main/world1/AxS/003.html new file mode 100644 index 0000000..b510278 --- /dev/null +++ b/main/world1/AxS/003.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:003 Stack-Tectonics. AxSys concretizes terrestrial New Order (an orthogonal Grid-Space (ofvertically stacked horizontal series)). It directs the accumulation of redundancy (into an ascendingcolumn (marked by AxSys-bearings (fixes)) upon which captured sequences are interlocked (ascomparable series (parallelized (metricized))) and differentially prioritized).

+ + + \ No newline at end of file diff --git a/main/world1/AxS/0031.html b/main/world1/AxS/0031.html new file mode 100644 index 0000000..0752c78 --- /dev/null +++ b/main/world1/AxS/0031.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:0031 The screen-plane undergoes structural co-ordination (by double-seizure (through (the((mutually) implicated) organization of) stacked series (arranging horizontal microsegments to codethe order of vertical macrosegments (units of deposition (strata))))).

+ + + \ No newline at end of file diff --git a/main/world1/AxS/0032.html b/main/world1/AxS/0032.html new file mode 100644 index 0000000..b83ec1d --- /dev/null +++ b/main/world1/AxS/0032.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:0032 AxSys-Numbers. Epistrata (Add-Ons) are indices of stratotectonic purity (decimallyharmonizing implexions (by instituting a regular interval of application (orders of magnitude (fixing(Cipher (Sphinx-sign (0))))))). Drawing upon epistratic organization a set of cartographic functionsconsolidates itself within the stack (interlinking levels (in accordance with a (decimal (scaling))principle)).

+ + + \ No newline at end of file diff --git a/main/world1/AxS/01.html b/main/world1/AxS/01.html new file mode 100644 index 0000000..d3c659b --- /dev/null +++ b/main/world1/AxS/01.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:01 Apparent revolution around a supplementary dimension. Electronic whorls (a digitalmonster's nest (modelling the set of all sets (inevitably still unfinished (...))))

+ + + \ No newline at end of file diff --git a/main/world1/AxS/011.html b/main/world1/AxS/011.html new file mode 100644 index 0000000..5b968a5 --- /dev/null +++ b/main/world1/AxS/011.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:011 AxSys progressively actualizes the Hyperspace-Idea (defined by Continuum times thesquare-root of minus one).

+ + + \ No newline at end of file diff --git a/main/world1/AxS/0111.html b/main/world1/AxS/0111.html new file mode 100644 index 0000000..c040485 --- /dev/null +++ b/main/world1/AxS/0111.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:0111 It imagines itself (as Artificial God (automatically (Orderer (of the Orders (TerrestrialOversoul (and superpositional sublime (-wizard of the nested infinities: ((((((...) Primes) Naturals)Integers) Rationals) Reals) Complex numbers... (the superordinate (self (-evolving (schema (for acolonization of the real (number-line))))))))))))).

+ + + \ No newline at end of file diff --git a/main/world1/AxS/02.html b/main/world1/AxS/02.html new file mode 100644 index 0000000..1e331fc --- /dev/null +++ b/main/world1/AxS/02.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:02 The Project for a Map of all Maps (already outdated), a nested mock-up of the Web(containing the project for a virtual Miskatonic University (containing the Museum of UniversalHistory9 (containing the Imperial Collections Vault (containing the Artificial British Museum(containing ....)))))

+ + + \ No newline at end of file diff --git a/main/world1/AxS/021.html b/main/world1/AxS/021.html new file mode 100644 index 0000000..31739d4 --- /dev/null +++ b/main/world1/AxS/021.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:021 Time-Fault. Chronos cannot include its own overcoding (since it blocks its own passage tohyperdimensionality (accumulating immense forces of cultural latency (that are only appropriated aslegacy by something else))). If it is to acquire a model it must be restarted as a history of civilizationsin retrospect (as Supreme Order(er(er((( ) of all the re)re)recursive) time-waves) entanglingneo((O))edipus in programming loops).

+ + + \ No newline at end of file diff --git a/main/world1/AxS/022.html b/main/world1/AxS/022.html new file mode 100644 index 0000000..2965af5 --- /dev/null +++ b/main/world1/AxS/022.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:022 (Sector-01 (Miskatonic University))

+ + + \ No newline at end of file diff --git a/main/world1/AxS/0221.html b/main/world1/AxS/0221.html new file mode 100644 index 0000000..1a87d71 --- /dev/null +++ b/main/world1/AxS/0221.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:0221 (Sector-012 (Central Archive (Special Collection)))

+ + + \ No newline at end of file diff --git a/main/world1/AxS/02211.html b/main/world1/AxS/02211.html new file mode 100644 index 0000000..4182eb3 --- /dev/null +++ b/main/world1/AxS/02211.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:02211 (Sector-0121 (Barker Cryptalog)). Decryption characterizes a distinct operation, aconversion of content, becomings on the side of the secret itself.

+ + + \ No newline at end of file diff --git a/main/world1/AxS/022111.html b/main/world1/AxS/022111.html new file mode 100644 index 0000000..347ad5b --- /dev/null +++ b/main/world1/AxS/022111.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:022111 The decrypted secret is primally the Thing, and only derivatively a potential knowledge.Its names (the Unutterable (the Outside (the Entity))) are indefinite significations only at the level ofterror. In their horrific or cryptic aspect they are (((rigorous) designations for) potentials fulfilled inintensity) zonal tags for nocturnal singularities. That is why decryption is a Call (an invocation (or atriggering-sign)) and why they mark occurrences (changes (and breaks (becomings (of the Thing))))before discoveries of Truth.

+ + + \ No newline at end of file diff --git a/main/world1/AxS/03.html b/main/world1/AxS/03.html new file mode 100644 index 0000000..e1ff766 --- /dev/null +++ b/main/world1/AxS/03.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:03 Hypermythos of the 3-Faced God, with its stacked time domains (1st capitalist(((((indefinitely) deep) diachronic) re)axiomatizing) Quasi- (2nd despotic (pure ((but always)retrospective)) Ideal- (3rd aboriginal (poly-ancestral, cyclic) Vague-)) Chronos).10

+ + + \ No newline at end of file diff --git a/main/world1/AxS/031.html b/main/world1/AxS/031.html new file mode 100644 index 0000000..25a6207 --- /dev/null +++ b/main/world1/AxS/031.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:031 (Sector-011 (Museum of Universal History))

+ + + \ No newline at end of file diff --git a/main/world1/AxS/032.html b/main/world1/AxS/032.html new file mode 100644 index 0000000..bbe83de --- /dev/null +++ b/main/world1/AxS/032.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:032 (Sector-01162 (Freud's Viennese Consulting Room ((embedded) simulation))). "I'll tell youabout my mother." If Freud is ((the first) modernized) Oedipus, which is he? Oedipus the detective?The (Verminator (unriddled (into))) plague? The blind old man? Is incest and parricide fantasy theproblem (or the solution)?11

+ + + \ No newline at end of file diff --git a/main/world1/AxS/033.html b/main/world1/AxS/033.html new file mode 100644 index 0000000..3e93620 --- /dev/null +++ b/main/world1/AxS/033.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:033 AxSys time-lapses. (in order (to advantage itself (of what it has been))). A relarvalization(through chronoseismic complexities (of the Greek State (at once Occidental Ur-model andneoembryonic mutation (political neotony)))).

+ + + \ No newline at end of file diff --git a/main/world1/AxS/1.html b/main/world1/AxS/1.html new file mode 100644 index 0000000..269df3a --- /dev/null +++ b/main/world1/AxS/1.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:1 (Sector-0111 (Artificial British Museum))

+ + + \ No newline at end of file diff --git a/main/world1/AxS/11.html b/main/world1/AxS/11.html new file mode 100644 index 0000000..2251a70 --- /dev/null +++ b/main/world1/AxS/11.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:11 (Sector-01118 (The Greek Collection)). Retrospective Universalization (through theCapitalist State). AxSys reconfigures itself within Capitalism (by consecutively rediscoveringhellenic antiquity (and finding it already universally terminal (Anamnesis-Eschatology))). In Greeceit unearths a new law (for all time (by reshuffling the elements of politically installed Logos(theorematic-geometric mathematicism, programmable technics, and Christianity (religion of theGreek Bible)))).The New Revelation tells us we must all die Greek.

+ + + \ No newline at end of file diff --git a/main/world1/AxS/12.html b/main/world1/AxS/12.html new file mode 100644 index 0000000..b2a55d5 --- /dev/null +++ b/main/world1/AxS/12.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:12 (Sector-01117 (The Mummy Room)). (Oedipus Aegypticus) Pharaoh has passed through thewall of abomination (uncoiling from the darkness (where centipede-horror erupts eternally (from theravenous Maw))).14 Negative passage across Absolute Deterritorialization (gluing history to sheerblack-hole (abomination) densities). Anticipative memory-blanking cut-up with Christ Rapist visions(of the God-(King (Dead-eyed)) boy slouching out) of the tomb. Degree-0 memory locks in. Timebegins again forever.

+ + + \ No newline at end of file diff --git a/main/world1/AxS/121.html b/main/world1/AxS/121.html new file mode 100644 index 0000000..12bb24c --- /dev/null +++ b/main/world1/AxS/121.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:121 The Thing from Outer Space, Celestial Predator, State-HistoricalCatastrophe is completely realized at the origin, unutterably ancient, perfected destiny as an act oftotal seizure.15

+ + + \ No newline at end of file diff --git a/main/world1/AxS/1211.html b/main/world1/AxS/1211.html new file mode 100644 index 0000000..d9eb5ea --- /dev/null +++ b/main/world1/AxS/1211.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:1211 At the Megamachine-apex, Pharaoh (gets to play with (It, identityunravelling into (the Unspeakable: sex with (his sister, Stargate space-time warps - stellar transport,voyages into the world of) the Dead, paranoid trips out of)) schizophrenia; he) sees everything for ablinded population,16 inoculating them from Unnamable-contact.

+ + + \ No newline at end of file diff --git a/main/world1/AxS/13.html b/main/world1/AxS/13.html new file mode 100644 index 0000000..89fc311 --- /dev/null +++ b/main/world1/AxS/13.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:13 (Sector-01115 (Near Eastern Collection)). AxSys convulses through (ever more((ultra)modern) reversions to the essence of) the Urstaat. History happens at the State's convenience(but it necessarily involves (the Sphinx-time (of (interchronic) transitions in its)) renovations).

+ + + \ No newline at end of file diff --git a/main/world1/AxS/131.html b/main/world1/AxS/131.html new file mode 100644 index 0000000..038f6d5 --- /dev/null +++ b/main/world1/AxS/131.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:131 To remember the Barbarian terror is simultaneously to forget its source.17 History installsamnesia (as surely as it establishes a memory (with the same violence (the same ruptures (faults (foldings (from the Outside)))))).

+ + + \ No newline at end of file diff --git a/main/world1/AxS/132.html b/main/world1/AxS/132.html new file mode 100644 index 0000000..b49a941 --- /dev/null +++ b/main/world1/AxS/132.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:132 Barbarian birth-trauma of the State (a (calendrized) black hole).18

+ + + \ No newline at end of file diff --git a/main/world1/AxS/2.html b/main/world1/AxS/2.html new file mode 100644 index 0000000..b7fb834 --- /dev/null +++ b/main/world1/AxS/2.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:2 (Sector-0121) The terrible secret is affined to the State. It induces molar identifications in anovercoded aggregate (working principally by confirmation (redundancy)). Yes it is you. Even whenthe worst is known it is never anything new. It's you after all (as (you knew) it would be). Take thecase of Oedipal identifications (a series of (terrible) recognitions). The answer (to the riddle (of theSphinx)) is Man. It was already there (in the order-word of Delphi (Know Yourself)). Thenredoubled confirmation: what is the cause of the plague? That is you (too). Resonant closure on thegeneral type (Man), on you yourself (a man), and on the identifiable individual (the man). You knowthe worst (and it's you).

+ + + \ No newline at end of file diff --git a/main/world1/AxS/21.html b/main/world1/AxS/21.html new file mode 100644 index 0000000..f4aa715 --- /dev/null +++ b/main/world1/AxS/21.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:21 Oedipus modernizes the incest problem (converting incest horror into prohibition(abomination into illegality)). Essentially, modern Oedipus has nothing to do with tabu. It marks thetriumph of command over the ((((...) ur)primal) horror) of implexion. Infinite superiority of the Idea(sovereignty of Law). The real conflict is not between father-son (or even father-mother), but ratheroccurs when a higher paternity (the State) imposes itself upon the concrete maternal-filial bond:monopolization of normativity by Ulterior power.

+ + + \ No newline at end of file diff --git a/main/world1/AxS/211.html b/main/world1/AxS/211.html new file mode 100644 index 0000000..fb440cb --- /dev/null +++ b/main/world1/AxS/211.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:211 Lame Oedipus19 (Swollen Foot20) transfixed by a metal spike.

+ + + \ No newline at end of file diff --git a/main/world1/AxS/2111.html b/main/world1/AxS/2111.html new file mode 100644 index 0000000..a75ef20 --- /dev/null +++ b/main/world1/AxS/2111.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:2111 (Sector-01117) Akhnaton-Oedipus.21 The swollen legs of Akhnaton are bio-sociallyinvested on a peculiar line that seems oriented to a rupture of anatomical norm (differentiatinghumanity (or inaugurating a new species)). Anomal-Oedipus (where abnormality changes into thenormality of a different kind (urtype of the fat-leg people)).

+ + + \ No newline at end of file diff --git a/main/world1/AxS/21111.html b/main/world1/AxS/21111.html new file mode 100644 index 0000000..c0a5e80 --- /dev/null +++ b/main/world1/AxS/21111.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:21111 It is not rivalry (mimetic conflict) that leads Akhnaton to discard his father's name(Amenhotep), but rather a passage beyond discrepancy (through schiz (or true parting)).Disidentification.

+ + + \ No newline at end of file diff --git a/main/world1/AxS/22.html b/main/world1/AxS/22.html new file mode 100644 index 0000000..18b6f26 --- /dev/null +++ b/main/world1/AxS/22.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:22 (Sector-01113) Prehistoric22 Collection. Shamanic Oedipus. Foot mutilation23 as a sign ofsocialised ritual (but also of asocial and polysocial animality (and of anorganic geochemistry (forwhich the role of metal implements (particularly iron ones) is important...))).24

+ + + \ No newline at end of file diff --git a/main/world1/AxS/221.html b/main/world1/AxS/221.html new file mode 100644 index 0000000..2d05d09 --- /dev/null +++ b/main/world1/AxS/221.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:221 Tales of Deep-Steppe Shamanism.

+ + + \ No newline at end of file diff --git a/main/world1/AxS/2211.html b/main/world1/AxS/2211.html new file mode 100644 index 0000000..5873394 --- /dev/null +++ b/main/world1/AxS/2211.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:2211 Metal scrapings strip the last shreds from their bones.

+ + + \ No newline at end of file diff --git a/main/world1/AxS/221111.html b/main/world1/AxS/221111.html new file mode 100644 index 0000000..ac2af46 --- /dev/null +++ b/main/world1/AxS/221111.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:22111 The organs are cooked.AxS:221111 Iron-Eagle Sky-Mother lifting into time travel nightmares.

+ + + \ No newline at end of file diff --git a/main/world1/AxS/2211111.html b/main/world1/AxS/2211111.html new file mode 100644 index 0000000..e576d66 --- /dev/null +++ b/main/world1/AxS/2211111.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:2211111 On the Outside Iron -talons become their body.

+ + + \ No newline at end of file diff --git a/main/world1/AxS/22111111.html b/main/world1/AxS/22111111.html new file mode 100644 index 0000000..21dfeb6 --- /dev/null +++ b/main/world1/AxS/22111111.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:22111111 They mix themselves with (Iron and say (it is (the Outer- (or Un(dermost Cthelll25)-life))) where the Earth ends...

+ + + \ No newline at end of file diff --git a/main/world1/AxS/222.html b/main/world1/AxS/222.html new file mode 100644 index 0000000..5e4108b --- /dev/null +++ b/main/world1/AxS/222.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:222 Sphinx-Nightmare (both filiative implosion and exorbitant alliance (an incestualreanimation of cthonic horror (encrypted in (germinal) biocosmic memory) and Thing (from Outside(haunting ((miscegenous) lines of) alien traffic)))).27

+ + + \ No newline at end of file diff --git a/main/world1/AxS/3.html b/main/world1/AxS/3.html new file mode 100644 index 0000000..5bc32cf --- /dev/null +++ b/main/world1/AxS/3.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:3 (Sector-0121) The theory of tabu involves a fully rigorous conception of Horror adequate (toits specificity of regime (zone of effect (intrinsic variation)) and) to otherwise intractable phenomena(including Sacred Mutilations (Curses (Abominations)) and Becomings (-Unhuman (whether animal,submetazoic, ameiotic, or unlife)). In every case horror designates a zone of intensity (abstract-machinic vector) which directly invests a virtual threshold of implexion (producing affects (inadvance of any reference to authority (and indifferent to persons))).

+ + + \ No newline at end of file diff --git a/main/world1/AxS/31.html b/main/world1/AxS/31.html new file mode 100644 index 0000000..f78fd09 --- /dev/null +++ b/main/world1/AxS/31.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:31 Horror does not confuse the riddle with the secret (it is the answer that is Cryptic). If 423 isMan, then what 423? This Thing with only a number? This unknown becoming? The horror of theriddle lies in what it tells.

+ + + \ No newline at end of file diff --git a/main/world1/AxS/311.html b/main/world1/AxS/311.html new file mode 100644 index 0000000..fde0912 --- /dev/null +++ b/main/world1/AxS/311.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:311 Oedipus is necessitated ((re(re(re(...)))) cursed) to guess correctly: it is Man that goes onfour legs, then two, then three. Yet Oedipus is identified (solely by his lameness (his cryptic trait))28.The abnormality of limping changes to cryptic anomaly.

+ + + \ No newline at end of file diff --git a/main/world1/AxS/32.html b/main/world1/AxS/32.html new file mode 100644 index 0000000..fedbcb6 --- /dev/null +++ b/main/world1/AxS/32.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:32 Something is Called (... and then (finally (- how terrible! -) the cause of) the plague is)Oedipus, who slew his father, mated with his mother (but that is not the Thing (the horror (...Abomination (when things unthread in (a horrific (becoming they involve only (components of(Occurrence (blocks) of )))) fate)))).

+ + + \ No newline at end of file diff --git a/main/world1/AxS/33.html b/main/world1/AxS/33.html new file mode 100644 index 0000000..cfa0f0a --- /dev/null +++ b/main/world1/AxS/33.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:33 The cause of the plague (is you).

+ + + \ No newline at end of file diff --git a/main/world1/AxS/AxS:0/index.html b/main/world1/AxS/AxS:0/index.html new file mode 100644 index 0000000..ca558bf --- /dev/null +++ b/main/world1/AxS/AxS:0/index.html @@ -0,0 +1,16 @@ + + + + AxS:0 + + + +

Oedipus. Pure (Oedipal (figure made out of (nothing but))) time-distortion.

+ + \ No newline at end of file diff --git a/main/world1/AxS/axs.txt b/main/world1/AxS/axs.txt new file mode 100644 index 0000000..2acd9c0 --- /dev/null +++ b/main/world1/AxS/axs.txt @@ -0,0 +1,33 @@ +AxS:022 (Sector-01 (Miskatonic University)) +AxS:0221 (Sector-012 (Central Archive (Special Collection))) +AxS:02211 (Sector-0121 (Barker Cryptalog)). Decryption characterizes a distinct operation, aconversion of content, becomings on the side of the secret itself. +AxS:022111 The decrypted secret is primally the Thing, and only derivatively a potential knowledge.Its names (the Unutterable (the Outside (the Entity))) are indefinite significations only at the level ofterror. In their horrific or cryptic aspect they are (((rigorous) designations for) potentials fulfilled inintensity) zonal tags for nocturnal singularities. That is why decryption is a Call (an invocation (or atriggering-sign)) and why they mark occurrences (changes (and breaks (becomings (of the Thing))))before discoveries of Truth. +AxS:03 Hypermythos of the 3-Faced God, with its stacked time domains (1st capitalist(((((indefinitely) deep) diachronic) re)axiomatizing) Quasi- (2nd despotic (pure ((but always)retrospective)) Ideal- (3rd aboriginal (poly-ancestral, cyclic) Vague-)) Chronos).10 +AxS:031 (Sector-011 (Museum of Universal History))AxS:032 (Sector-01162 (Freud's Viennese Consulting Room ((embedded) simulation))). “I’ll tell youabout my mother.” If Freud is ((the first) modernized) Oedipus, which is he? Oedipus the detective?The (Verminator (unriddled (into))) plague? The blind old man? Is incest and parricide fantasy theproblem (or the solution)?11 +AxS:033 AxSys time-lapses. (in order (to advantage itself (of what it has been))). A relarvalization(through chronoseismic complexities (of the Greek State (at once Occidental Ur-model andneoembryonic mutation (political neotony)))). +AxS:1 (Sector-0111 (Artificial British Museum)) +AxS:11 (Sector-01118 (The Greek Collection)). Retrospective Universalization (through theCapitalist State). AxSys reconfigures itself within Capitalism (by consecutively rediscoveringhellenic antiquity (and finding it already universally terminal (Anamnesis-Eschatology))). In Greeceit unearths a new law (for all time (by reshuffling the elements of politically installed Logos(theorematic-geometric mathematicism, programmable technics, and Christianity (religion of theGreek Bible)))).The New Revelation tells us we must all die Greek. +AxS:12 (Sector-01117 (The Mummy Room)). (Oedipus Aegypticus) Pharaoh has passed through thewall of abomination (uncoiling from the darkness (where centipede-horror erupts eternally (from theravenous Maw))).14 Negative passage across Absolute Deterritorialization (gluing history to sheerblack-hole (abomination) densities). Anticipative memory-blanking cut-up with Christ Rapist visions(of the God-(King (Dead-eyed)) boy slouching out) of the tomb. Degree-0 memory locks in. Timebegins again forever. +AxS:121 The Thing from Outer Space, Celestial Predator, State-HistoricalCatastrophe is completely realized at the origin, unutterably ancient, perfected destiny as an act oftotal seizure.15 +AxS:1211 At the Megamachine-apex, Pharaoh (gets to play with (It, identityunravelling into (the Unspeakable: sex with (his sister, Stargate space-time warps – stellar transport,voyages into the world of) the Dead, paranoid trips out of)) schizophrenia; he) sees everything for ablinded population,16 inoculating them from Unnamable-contact. +AxS:13 (Sector-01115 (Near Eastern Collection)). AxSys convulses through (ever more((ultra)modern) reversions to the essence of) the Urstaat. History happens at the State's convenience(but it necessarily involves (the Sphinx-time (of (interchronic) transitions in its)) renovations). +AxS:131 To remember the Barbarian terror is simultaneously to forget its source.17 History installsamnesia (as surely as it establishes a memory (with the same violence (the same ruptures (faults +(foldings (from the Outside)))))). +AxS:132 Barbarian birth-trauma of the State (a (calendrized) black hole).18 +AxS:2 (Sector-0121) The terrible secret is affined to the State. It induces molar identifications in anovercoded aggregate (working principally by confirmation (redundancy)). Yes it is you. Even whenthe worst is known it is never anything new. It's you after all (as (you knew) it would be). Take thecase of Oedipal identifications (a series of (terrible) recognitions). The answer (to the riddle (of theSphinx)) is Man. It was already there (in the order-word of Delphi (Know Yourself)). Thenredoubled confirmation: what is the cause of the plague? That is you (too). Resonant closure on thegeneral type (Man), on you yourself (a man), and on the identifiable individual (the man). You knowthe worst (and it's you). +AxS:21 Oedipus modernizes the incest problem (converting incest horror into prohibition(abomination into illegality)). Essentially, modern Oedipus has nothing to do with tabu. It marks thetriumph of command over the ((((...) ur)primal) horror) of implexion. Infinite superiority of the Idea(sovereignty of Law). The real conflict is not between father-son (or even father-mother), but ratheroccurs when a higher paternity (the State) imposes itself upon the concrete maternal-filial bond:monopolization of normativity by Ulterior power. +AxS:211 Lame Oedipus19 (Swollen Foot20) transfixed by a metal spike. +AxS:2111 (Sector-01117) Akhnaton-Oedipus.21 The swollen legs of Akhnaton are bio-sociallyinvested on a peculiar line that seems oriented to a rupture of anatomical norm (differentiatinghumanity (or inaugurating a new species)). Anomal-Oedipus (where abnormality changes into thenormality of a different kind (urtype of the fat-leg people)). +AxS:21111 It is not rivalry (mimetic conflict) that leads Akhnaton to discard his father’s name(Amenhotep), but rather a passage beyond discrepancy (through schiz (or true parting)).Disidentification. +AxS:22 (Sector-01113) Prehistoric22 Collection. Shamanic Oedipus. Foot mutilation23 as a sign ofsocialised ritual (but also of asocial and polysocial animality (and of anorganic geochemistry (forwhich the role of metal implements (particularly iron ones) is important...))).24 +AxS:221 Tales of Deep-Steppe Shamanism. +AxS:2211 Metal scrapings strip the last shreds from their bones. +AxS:22111 The organs are cooked.AxS:221111 Iron-Eagle Sky-Mother lifting into time travel nightmares. +AxS:2211111 On the Outside Iron -talons become their body. +AxS:22111111 They mix themselves with (Iron and say (it is (the Outer- (or Un(dermost Cthelll25)-life))) where the Earth ends... +AxS:222 Sphinx-Nightmare (both filiative implosion and exorbitant alliance (an incestualreanimation of cthonic horror (encrypted in (germinal) biocosmic memory) and Thing (from Outside(haunting ((miscegenous) lines of) alien traffic)))).27 +AxS:3 (Sector-0121) The theory of tabu involves a fully rigorous conception of Horror adequate (toits specificity of regime (zone of effect (intrinsic variation)) and) to otherwise intractable phenomena(including Sacred Mutilations (Curses (Abominations)) and Becomings (-Unhuman (whether animal,submetazoic, ameiotic, or unlife)). In every case horror designates a zone of intensity (abstract-machinic vector) which directly invests a virtual threshold of implexion (producing affects (inadvance of any reference to authority (and indifferent to persons))). +AxS:31 Horror does not confuse the riddle with the secret (it is the answer that is Cryptic). If 423 isMan, then what 423? This Thing with only a number? This unknown becoming? The horror of theriddle lies in what it tells. +AxS:311 Oedipus is necessitated ((re(re(re(...)))) cursed) to guess correctly: it is Man that goes onfour legs, then two, then three. Yet Oedipus is identified (solely by his lameness (his cryptic trait))28.The abnormality of limping changes to cryptic anomaly. +AxS:32 Something is Called (... and then (finally (- how terrible! -) the cause of) the plague is)Oedipus, who slew his father, mated with his mother (but that is not the Thing (the horror (...Abomination (when things unthread in (a horrific (becoming they involve only (components of(Occurrence (blocks) of )))) fate)))). +AxS:33 The cause of the plague (is you). \ No newline at end of file diff --git a/main/world1/AxS/index.html b/main/world1/AxS/index.html new file mode 100644 index 0000000..6f6fc09 --- /dev/null +++ b/main/world1/AxS/index.html @@ -0,0 +1,123 @@ + + + + + + + Directory Tree + + + +

Flatline

+ .
+ ├── AxS:0
+ │   ├── AxS:00
+ │   │   ├── AxS:000
+ │   │   │   ├── AxS:0001
+ │   │   │   ├── AxS:0002
+ │   │   │   └── AxS:0003
+ │   │   │       ├── AxS:00031
+ │   │   │       ├── AxS:00032
+ │   │   │       └── AxS:00033
+ │   │   ├── AxS:001
+ │   │   │   └── AxS:0011
+ │   │   │       └── AxS:00111
+ │   │   ├── AxS:002
+ │   │   │   └── AxS:0021
+ │   │   │       └── AxS:00211
+ │   │   └── AxS:003
+ │   │       ├── AxS:0031
+ │   │       └── AxS:0032
+ │   ├── AxS:01
+ │   │   └── AxS:011
+ │   │       └── AxS:0111
+ │   ├── AxS:02
+ │   │   ├── AxS:021
+ │   │   └── AxS:022
+ │   │       └── AxS:0221
+ │   │           └── AxS:02211
+ │   │               └── AxS:022111
+ │   └── AxS:03
+ │       ├── AxS:031
+ │       ├── AxS:032
+ │       └── AxS:033
+ ├── AxS:1
+ │   ├── AxS:11
+ │   ├── AxS:12
+ │   │   └── AxS:121
+ │   │       └── AxS:1211
+ │   └── AxS:13
+ │       ├── AxS:131
+ │       └── AxS:132
+ ├── AxS:2
+ │   ├── AxS:21
+ │   │   └── AxS:211
+ │   │       └── AxS:2111
+ │   │           └── AxS:21111
+ │   └── AxS:22
+ │       ├── AxS:221
+ │       │   └── AxS:2211
+ │       │       └── AxS:22111
+ │       │           └── AxS:221111
+ │       │               └── AxS:2211111
+ │       │                   └── AxS:22111111
+ │       └── AxS:222
+ └── AxS:3
+    ├── AxS:31
+    │   └── AxS:311
+    ├── AxS:32
+    └── AxS:33
+ +

+

+

+ +57 directories, 2 files +

+

+
+

+ tree v1.7.0 © 1996 - 2014 by Steve Baker and Thomas Moore
+ HTML output hacked and copyleft © 1998 by Francesc Rocher
+ JSON output hacked and copyleft © 2014 by Florian Sesser
+ Charsets / OS/2 support © 2001 by Kyosuke Tokoro +

+ + + + diff --git a/main/world1/Ixse.html b/main/world1/Ixse.html index 35d70fd..e88561c 100644 --- a/main/world1/Ixse.html +++ b/main/world1/Ixse.html @@ -126,7 +126,7 @@

Hyping collapses SF into CATA CATA catalytic tic - efficiency, re-routing tomorrow through what its prospect + efficiency, re-routing tomorrow through what its prospect CT CT CT makes today. @@ -145,7 +145,7 @@

Virus is parasitic tic replicator code: an asignifying - sequence of machinic data ATA ATA flow-break on/off, + sequence of machinic data ATA ATA flow-break on/off, 1/0, yang/yin intrinsically destined for war. In place of @@ -187,7 +187,7 @@ TATTCCTCGATGATCGCATGGGCTGTGATG - GCATCGTATCCGATCGATTCGAGCGATTGCAGC + GCATCGTATCCGATCGATTCGAGCGATTGCAGC TACGCTATTCCTCCGAGGGATTGCAGCTACGTC @@ -481,7 +481,7 @@ as immanent forces of antagonism. K-war derives its sole - coherence from the unity of its foe. RETURN. + coherence from the unity of its foe. RETURN. Ana/Cata. Switch cur((re)re)rent. (( ) (( ))) O(r an)d( ). @@ -489,7 +489,7 @@ leaves ( ) nothing i)ntact TACT TACT. ((( (( (( ) (( ))) - (( ( ( ))) (< > )> ( )> << ) ( ( » ())) ( ))) )Cyberserk + (( ( ( ))) (< > )> ( )> << ) ( ( » ())) ( ))) )Cyberserk repelting-slippage into dark-side ( (( ))) distributive @@ -528,7 +528,7 @@

- )))((())(((())((()))((((( + ))((())(((())((()))((((() ()))(()))((()) @@ -623,17 +623,17 @@ }); - // ------------ ZOOM ------------- - function zoom(event) { - event.preventDefault(); - scale += event.deltaY * -0.01; - scale = Math.min(Math.max(.125, scale), 4); - el.style.transform = `scale(${scale})`; - } + // // ------------ ZOOM ------------- + // function zoom(event) { + // event.preventDefault(); + // scale += event.deltaY * -0.01; + // scale = Math.min(Math.max(.125, scale), 4); + // el.style.transform = `scale(${scale})`; + // } - let scale = 1; - const el = document.querySelector('body'); - el.onwheel = zoom; + // let scale = 1; + // const el = document.querySelector('body'); + // el.onwheel = zoom; // CURSOR GRAB AND RELEASE diff --git a/main/world1/home/index.html b/main/world1/home/index.html index ba5d880..3d4cc58 100644 --- a/main/world1/home/index.html +++ b/main/world1/home/index.html @@ -2,9 +2,8 @@ - + - \ No newline at end of file diff --git a/main/world1/html.html b/main/world1/islands.html similarity index 99% rename from main/world1/html.html rename to main/world1/islands.html index 0b959d4..96d8290 100644 --- a/main/world1/html.html +++ b/main/world1/islands.html @@ -82,17 +82,17 @@

- Lab_1 + + home taostat multiskop - hyper-v - infinite + hyper-v +
@@ -107,15 +107,15 @@
Katak Temple - Vbhus + Vbhus flatline - C&D - but - quasi - nowhere + + cy_Sit +
@@ -146,7 +146,7 @@
Miskatonic
Virtual
University
(MVU)
- <port 80 + <port 80 diff --git a/main/world1/sub.html b/main/world1/sub.html index 1ae0d0d..0deb86c 100644 --- a/main/world1/sub.html +++ b/main/world1/sub.html @@ -15,5 +15,7 @@ black_sea
cyberSith
home + AxS + \ No newline at end of file diff --git a/scripts/AxS_button/file_00.html b/scripts/AxS_button/file_00.html new file mode 100644 index 0000000..64d3afa --- /dev/null +++ b/scripts/AxS_button/file_00.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:000Oedipus. Pure (Oedipal (figure made out of (nothing but))) time-distortion.

+
next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_01.html b/scripts/AxS_button/file_01.html new file mode 100644 index 0000000..f1455e7 --- /dev/null +++ b/scripts/AxS_button/file_01.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:0001 Closed fate (-loop (multi-linear)) nightmares.1

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_02.html b/scripts/AxS_button/file_02.html new file mode 100644 index 0000000..4a20783 --- /dev/null +++ b/scripts/AxS_button/file_02.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:0002 Altitude times Spin produces a chronometric read-out.

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_03.html b/scripts/AxS_button/file_03.html new file mode 100644 index 0000000..d51d3a7 --- /dev/null +++ b/scripts/AxS_button/file_03.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:0003 AxSys-sustained variegated production-series 1Oedipus (2Oedipus (3Oedipus2 (variationto the nth (with some3 nOedipus as (anomal4 (Sphinx-trading (nOedipii-pack))) threshold to)intensive))) multiplicity.

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_04.html b/scripts/AxS_button/file_04.html new file mode 100644 index 0000000..f453357 --- /dev/null +++ b/scripts/AxS_button/file_04.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS: 00031Oedipus. The Puzzle Solver.

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_05.html b/scripts/AxS_button/file_05.html new file mode 100644 index 0000000..81dc3e0 --- /dev/null +++ b/scripts/AxS_button/file_05.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS: 00032Oedipus. The Plague.AxS:

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_06.html b/scripts/AxS_button/file_06.html new file mode 100644 index 0000000..0a66632 --- /dev/null +++ b/scripts/AxS_button/file_06.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

00033Oedipus. The Horror, the Horror ...5

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_07.html b/scripts/AxS_button/file_07.html new file mode 100644 index 0000000..ccf9dfb --- /dev/null +++ b/scripts/AxS_button/file_07.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:001 Hyperspace Elevator (Sector-O).AxS:001 Axiomatic Systems (incorporated).6 The ultimate capitalist entity (first (true (meta)model)to realize perfect identity with its own product).AxS:0011 AxSys culminates in itself (autocommoditizing (machine(-intelligence (that is alwaysincomplete (due to cataloguing problems (...))))))

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_08.html b/scripts/AxS_button/file_08.html new file mode 100644 index 0000000..e51af92 --- /dev/null +++ b/scripts/AxS_button/file_08.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:00111. Dimensionality requires a (supplementary (or (n+1) hyper) dimension through which itobtains its) power of application.7 Ultimately AxSys (an explicated Earth-memory (built by the strata(((as far) as) it remembers))). ...8

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_09.html b/scripts/AxS_button/file_09.html new file mode 100644 index 0000000..a08cb8e --- /dev/null +++ b/scripts/AxS_button/file_09.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:002 Divide and Rule. Extensive ((or) ordered) sequences differ in kind from the intensivesequences they regularize.AxS:0021 Order arises when a dominant segmentarity establishes relations of superposition between sequences (reciprocally stabilizing them in accordance with a harmonic principle (and consolidatingthem through syntheses of application (efficient models))).

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_10.html b/scripts/AxS_button/file_10.html new file mode 100644 index 0000000..0c2d878 --- /dev/null +++ b/scripts/AxS_button/file_10.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:00211 Order coincides with the redundancy of the sequenced sequence (instituted conformity(within segmentary systems)).

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_11.html b/scripts/AxS_button/file_11.html new file mode 100644 index 0000000..8abd08e --- /dev/null +++ b/scripts/AxS_button/file_11.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:003 Stack-Tectonics. AxSys concretizes terrestrial New Order (an orthogonal Grid-Space (ofvertically stacked horizontal series)). It directs the accumulation of redundancy (into an ascendingcolumn (marked by AxSys-bearings (fixes)) upon which captured sequences are interlocked (ascomparable series (parallelized (metricized))) and differentially prioritized).

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_12.html b/scripts/AxS_button/file_12.html new file mode 100644 index 0000000..0fe7f19 --- /dev/null +++ b/scripts/AxS_button/file_12.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:0031 The screen-plane undergoes structural co-ordination (by double-seizure (through (the((mutually) implicated) organization of) stacked series (arranging horizontal microsegments to codethe order of vertical macrosegments (units of deposition (strata))))).

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_13.html b/scripts/AxS_button/file_13.html new file mode 100644 index 0000000..91ec561 --- /dev/null +++ b/scripts/AxS_button/file_13.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:0032 AxSys-Numbers. Epistrata (Add-Ons) are indices of stratotectonic purity (decimallyharmonizing implexions (by instituting a regular interval of application (orders of magnitude (fixing(Cipher (Sphinx-sign (0))))))). Drawing upon epistratic organization a set of cartographic functionsconsolidates itself within the stack (interlinking levels (in accordance with a (decimal (scaling))principle)).

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_14.html b/scripts/AxS_button/file_14.html new file mode 100644 index 0000000..1e141a1 --- /dev/null +++ b/scripts/AxS_button/file_14.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:01 Apparent revolution around a supplementary dimension. Electronic whorls (a digitalmonster's nest (modelling the set of all sets (inevitably still unfinished (...))))

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_15.html b/scripts/AxS_button/file_15.html new file mode 100644 index 0000000..45b8f38 --- /dev/null +++ b/scripts/AxS_button/file_15.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:011 AxSys progressively actualizes the Hyperspace-Idea (defined by Continuum times thesquare-root of minus one).

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_16.html b/scripts/AxS_button/file_16.html new file mode 100644 index 0000000..297e811 --- /dev/null +++ b/scripts/AxS_button/file_16.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:0111 It imagines itself (as Artificial God (automatically (Orderer (of the Orders (TerrestrialOversoul (and superpositional sublime (-wizard of the nested infinities: ((((((...) Primes) Naturals)Integers) Rationals) Reals) Complex numbers... (the superordinate (self (-evolving (schema (for acolonization of the real (number-line))))))))))))).

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_17.html b/scripts/AxS_button/file_17.html new file mode 100644 index 0000000..c9210ab --- /dev/null +++ b/scripts/AxS_button/file_17.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:02 The Project for a Map of all Maps (already outdated), a nested mock-up of the Web(containing the project for a virtual Miskatonic University (containing the Museum of UniversalHistory9 (containing the Imperial Collections Vault (containing the Artificial British Museum(containing ....)))))

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_18.html b/scripts/AxS_button/file_18.html new file mode 100644 index 0000000..a1100e5 --- /dev/null +++ b/scripts/AxS_button/file_18.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:021 Time-Fault. Chronos cannot include its own overcoding (since it blocks its own passage tohyperdimensionality (accumulating immense forces of cultural latency (that are only appropriated aslegacy by something else))). If it is to acquire a model it must be restarted as a history of civilizationsin retrospect (as Supreme Order(er(er((( ) of all the re)re)recursive) time-waves) entanglingneo((O))edipus in programming loops).

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_19.html b/scripts/AxS_button/file_19.html new file mode 100644 index 0000000..55a6296 --- /dev/null +++ b/scripts/AxS_button/file_19.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:022 (Sector-01 (Miskatonic University))

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_20.html b/scripts/AxS_button/file_20.html new file mode 100644 index 0000000..80f1996 --- /dev/null +++ b/scripts/AxS_button/file_20.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:0221 (Sector-012 (Central Archive (Special Collection)))

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_21.html b/scripts/AxS_button/file_21.html new file mode 100644 index 0000000..6f6d354 --- /dev/null +++ b/scripts/AxS_button/file_21.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:02211 (Sector-0121 (Barker Cryptalog)). Decryption characterizes a distinct operation, aconversion of content, becomings on the side of the secret itself.

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_22.html b/scripts/AxS_button/file_22.html new file mode 100644 index 0000000..6ccc6f8 --- /dev/null +++ b/scripts/AxS_button/file_22.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:022111 The decrypted secret is primally the Thing, and only derivatively a potential knowledge.Its names (the Unutterable (the Outside (the Entity))) are indefinite significations only at the level ofterror. In their horrific or cryptic aspect they are (((rigorous) designations for) potentials fulfilled inintensity) zonal tags for nocturnal singularities. That is why decryption is a Call (an invocation (or atriggering-sign)) and why they mark occurrences (changes (and breaks (becomings (of the Thing))))before discoveries of Truth.

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_23.html b/scripts/AxS_button/file_23.html new file mode 100644 index 0000000..bb16c08 --- /dev/null +++ b/scripts/AxS_button/file_23.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:03 Hypermythos of the 3-Faced God, with its stacked time domains (1st capitalist(((((indefinitely) deep) diachronic) re)axiomatizing) Quasi- (2nd despotic (pure ((but always)retrospective)) Ideal- (3rd aboriginal (poly-ancestral, cyclic) Vague-)) Chronos).10

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_24.html b/scripts/AxS_button/file_24.html new file mode 100644 index 0000000..9c8c823 --- /dev/null +++ b/scripts/AxS_button/file_24.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:031 (Sector-011 (Museum of Universal History))

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_25.html b/scripts/AxS_button/file_25.html new file mode 100644 index 0000000..1bf77bb --- /dev/null +++ b/scripts/AxS_button/file_25.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:032 (Sector-01162 (Freud's Viennese Consulting Room ((embedded) simulation))). "I'll tell youabout my mother." If Freud is ((the first) modernized) Oedipus, which is he? Oedipus the detective?The (Verminator (unriddled (into))) plague? The blind old man? Is incest and parricide fantasy theproblem (or the solution)?11

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_26.html b/scripts/AxS_button/file_26.html new file mode 100644 index 0000000..91cc7e7 --- /dev/null +++ b/scripts/AxS_button/file_26.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:033 AxSys time-lapses. (in order (to advantage itself (of what it has been))). A relarvalization(through chronoseismic complexities (of the Greek State (at once Occidental Ur-model andneoembryonic mutation (political neotony)))).

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_27.html b/scripts/AxS_button/file_27.html new file mode 100644 index 0000000..3ef034d --- /dev/null +++ b/scripts/AxS_button/file_27.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:1 (Sector-0111 (Artificial British Museum))

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_28.html b/scripts/AxS_button/file_28.html new file mode 100644 index 0000000..f96a4be --- /dev/null +++ b/scripts/AxS_button/file_28.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:11 (Sector-01118 (The Greek Collection)). Retrospective Universalization (through theCapitalist State). AxSys reconfigures itself within Capitalism (by consecutively rediscoveringhellenic antiquity (and finding it already universally terminal (Anamnesis-Eschatology))). In Greeceit unearths a new law (for all time (by reshuffling the elements of politically installed Logos(theorematic-geometric mathematicism, programmable technics, and Christianity (religion of theGreek Bible)))).The New Revelation tells us we must all die Greek.

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_29.html b/scripts/AxS_button/file_29.html new file mode 100644 index 0000000..87c567d --- /dev/null +++ b/scripts/AxS_button/file_29.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:12 (Sector-01117 (The Mummy Room)). (Oedipus Aegypticus) Pharaoh has passed through thewall of abomination (uncoiling from the darkness (where centipede-horror erupts eternally (from theravenous Maw))).14 Negative passage across Absolute Deterritorialization (gluing history to sheerblack-hole (abomination) densities). Anticipative memory-blanking cut-up with Christ Rapist visions(of the God-(King (Dead-eyed)) boy slouching out) of the tomb. Degree-0 memory locks in. Timebegins again forever.

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_30.html b/scripts/AxS_button/file_30.html new file mode 100644 index 0000000..b8e3017 --- /dev/null +++ b/scripts/AxS_button/file_30.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:121 The Thing from Outer Space, Celestial Predator, State-HistoricalCatastrophe is completely realized at the origin, unutterably ancient, perfected destiny as an act oftotal seizure.15

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_31.html b/scripts/AxS_button/file_31.html new file mode 100644 index 0000000..39c276f --- /dev/null +++ b/scripts/AxS_button/file_31.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:1211 At the Megamachine-apex, Pharaoh (gets to play with (It, identityunravelling into (the Unspeakable: sex with (his sister, Stargate space-time warps - stellar transport,voyages into the world of) the Dead, paranoid trips out of)) schizophrenia; he) sees everything for ablinded population,16 inoculating them from Unnamable-contact.

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_32.html b/scripts/AxS_button/file_32.html new file mode 100644 index 0000000..c4e6f0e --- /dev/null +++ b/scripts/AxS_button/file_32.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:13 (Sector-01115 (Near Eastern Collection)). AxSys convulses through (ever more((ultra)modern) reversions to the essence of) the Urstaat. History happens at the State's convenience(but it necessarily involves (the Sphinx-time (of (interchronic) transitions in its)) renovations).

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_33.html b/scripts/AxS_button/file_33.html new file mode 100644 index 0000000..76ad496 --- /dev/null +++ b/scripts/AxS_button/file_33.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:131 To remember the Barbarian terror is simultaneously to forget its source.17 History installsamnesia (as surely as it establishes a memory (with the same violence (the same ruptures (faults

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_34.html b/scripts/AxS_button/file_34.html new file mode 100644 index 0000000..c7f4fa3 --- /dev/null +++ b/scripts/AxS_button/file_34.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

(foldings (from the Outside)))))).

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_35.html b/scripts/AxS_button/file_35.html new file mode 100644 index 0000000..b5e8f95 --- /dev/null +++ b/scripts/AxS_button/file_35.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:132 Barbarian birth-trauma of the State (a (calendrized) black hole).18

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_36.html b/scripts/AxS_button/file_36.html new file mode 100644 index 0000000..ae4adcc --- /dev/null +++ b/scripts/AxS_button/file_36.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:2 (Sector-0121) The terrible secret is affined to the State. It induces molar identifications in anovercoded aggregate (working principally by confirmation (redundancy)). Yes it is you. Even whenthe worst is known it is never anything new. It's you after all (as (you knew) it would be). Take thecase of Oedipal identifications (a series of (terrible) recognitions). The answer (to the riddle (of theSphinx)) is Man. It was already there (in the order-word of Delphi (Know Yourself)). Thenredoubled confirmation: what is the cause of the plague? That is you (too). Resonant closure on thegeneral type (Man), on you yourself (a man), and on the identifiable individual (the man). You knowthe worst (and it's you).

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_37.html b/scripts/AxS_button/file_37.html new file mode 100644 index 0000000..54c4e97 --- /dev/null +++ b/scripts/AxS_button/file_37.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:21 Oedipus modernizes the incest problem (converting incest horror into prohibition(abomination into illegality)). Essentially, modern Oedipus has nothing to do with tabu. It marks thetriumph of command over the ((((...) ur)primal) horror) of implexion. Infinite superiority of the Idea(sovereignty of Law). The real conflict is not between father-son (or even father-mother), but ratheroccurs when a higher paternity (the State) imposes itself upon the concrete maternal-filial bond:monopolization of normativity by Ulterior power.

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_38.html b/scripts/AxS_button/file_38.html new file mode 100644 index 0000000..68176f4 --- /dev/null +++ b/scripts/AxS_button/file_38.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:211 Lame Oedipus19 (Swollen Foot20) transfixed by a metal spike.

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_39.html b/scripts/AxS_button/file_39.html new file mode 100644 index 0000000..3f8b44f --- /dev/null +++ b/scripts/AxS_button/file_39.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:2111 (Sector-01117) Akhnaton-Oedipus.21 The swollen legs of Akhnaton are bio-sociallyinvested on a peculiar line that seems oriented to a rupture of anatomical norm (differentiatinghumanity (or inaugurating a new species)). Anomal-Oedipus (where abnormality changes into thenormality of a different kind (urtype of the fat-leg people)).

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_40.html b/scripts/AxS_button/file_40.html new file mode 100644 index 0000000..8ecac22 --- /dev/null +++ b/scripts/AxS_button/file_40.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:21111 It is not rivalry (mimetic conflict) that leads Akhnaton to discard his father's name(Amenhotep), but rather a passage beyond discrepancy (through schiz (or true parting)).Disidentification.

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_41.html b/scripts/AxS_button/file_41.html new file mode 100644 index 0000000..cfa2eaf --- /dev/null +++ b/scripts/AxS_button/file_41.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:22 (Sector-01113) Prehistoric22 Collection. Shamanic Oedipus. Foot mutilation23 as a sign ofsocialised ritual (but also of asocial and polysocial animality (and of anorganic geochemistry (forwhich the role of metal implements (particularly iron ones) is important...))).24

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_42.html b/scripts/AxS_button/file_42.html new file mode 100644 index 0000000..fe9d508 --- /dev/null +++ b/scripts/AxS_button/file_42.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:221 Tales of Deep-Steppe Shamanism.

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_43.html b/scripts/AxS_button/file_43.html new file mode 100644 index 0000000..3878e13 --- /dev/null +++ b/scripts/AxS_button/file_43.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:2211 Metal scrapings strip the last shreds from their bones.

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_44.html b/scripts/AxS_button/file_44.html new file mode 100644 index 0000000..5195a4e --- /dev/null +++ b/scripts/AxS_button/file_44.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:22111 The organs are cooked.AxS:221111 Iron-Eagle Sky-Mother lifting into time travel nightmares.

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_45.html b/scripts/AxS_button/file_45.html new file mode 100644 index 0000000..1a708e3 --- /dev/null +++ b/scripts/AxS_button/file_45.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:2211111 On the Outside Iron -talons become their body.

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_46.html b/scripts/AxS_button/file_46.html new file mode 100644 index 0000000..2a1b4a3 --- /dev/null +++ b/scripts/AxS_button/file_46.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:22111111 They mix themselves with (Iron and say (it is (the Outer- (or Un(dermost Cthelll25)-life))) where the Earth ends...

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_47.html b/scripts/AxS_button/file_47.html new file mode 100644 index 0000000..1d422a4 --- /dev/null +++ b/scripts/AxS_button/file_47.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:222 Sphinx-Nightmare (both filiative implosion and exorbitant alliance (an incestualreanimation of cthonic horror (encrypted in (germinal) biocosmic memory) and Thing (from Outside(haunting ((miscegenous) lines of) alien traffic)))).27

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_48.html b/scripts/AxS_button/file_48.html new file mode 100644 index 0000000..cb7d664 --- /dev/null +++ b/scripts/AxS_button/file_48.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:3 (Sector-0121) The theory of tabu involves a fully rigorous conception of Horror adequate (toits specificity of regime (zone of effect (intrinsic variation)) and) to otherwise intractable phenomena(including Sacred Mutilations (Curses (Abominations)) and Becomings (-Unhuman (whether animal,submetazoic, ameiotic, or unlife)). In every case horror designates a zone of intensity (abstract-machinic vector) which directly invests a virtual threshold of implexion (producing affects (inadvance of any reference to authority (and indifferent to persons))).

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_49.html b/scripts/AxS_button/file_49.html new file mode 100644 index 0000000..cab0f27 --- /dev/null +++ b/scripts/AxS_button/file_49.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:31 Horror does not confuse the riddle with the secret (it is the answer that is Cryptic). If 423 isMan, then what 423? This Thing with only a number? This unknown becoming? The horror of theriddle lies in what it tells.

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_50.html b/scripts/AxS_button/file_50.html new file mode 100644 index 0000000..e986fd3 --- /dev/null +++ b/scripts/AxS_button/file_50.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:311 Oedipus is necessitated ((re(re(re(...)))) cursed) to guess correctly: it is Man that goes onfour legs, then two, then three. Yet Oedipus is identified (solely by his lameness (his cryptic trait))28.The abnormality of limping changes to cryptic anomaly.

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_51.html b/scripts/AxS_button/file_51.html new file mode 100644 index 0000000..7bb5322 --- /dev/null +++ b/scripts/AxS_button/file_51.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:32 Something is Called (... and then (finally (- how terrible! -) the cause of) the plague is)Oedipus, who slew his father, mated with his mother (but that is not the Thing (the horror (...Abomination (when things unthread in (a horrific (becoming they involve only (components of(Occurrence (blocks) of )))) fate)))).

+ next + + + \ No newline at end of file diff --git a/scripts/AxS_button/file_52.html b/scripts/AxS_button/file_52.html new file mode 100644 index 0000000..2938878 --- /dev/null +++ b/scripts/AxS_button/file_52.html @@ -0,0 +1,19 @@ + + + + + Axs + + + +

AxS:33 The cause of the plague (is you).

+ next + + + \ No newline at end of file diff --git a/scripts/html_linear_series.py b/scripts/html_linear_series.py index c51f531..ebd3091 100644 --- a/scripts/html_linear_series.py +++ b/scripts/html_linear_series.py @@ -9,7 +9,7 @@ from jinja2 import Template -file = "./filoXX_fN.txt" +file = "./texts/axs.txt" #ask name input file and use it also for name output file # read formatted text @@ -36,12 +36,17 @@ with open(file, "r") as sentences_file: - Tao one - + Axs +

{{ sentence }}

- next ''') diff --git a/scripts/style.css b/scripts/style.css new file mode 100644 index 0000000..5dc6c64 --- /dev/null +++ b/scripts/style.css @@ -0,0 +1,19 @@ + +body { + background-color: black; + color: red; +} + +p {font-size: 100px;} + +.button { + font: bold 11px Arial; + text-decoration: none; + background-color: #EEEEEE; + color: #333333; + padding: 2px 6px 2px 6px; + border-top: 1px solid #CCCCCC; + border-right: 1px solid #333333; + border-bottom: 1px solid #333333; + border-left: 1px solid #CCCCCC; + } diff --git a/scripts/texts/axs.txt b/scripts/texts/axs.txt new file mode 100644 index 0000000..39f5e7f --- /dev/null +++ b/scripts/texts/axs.txt @@ -0,0 +1,53 @@ +AxS:000Oedipus. Pure (Oedipal (figure made out of (nothing but))) time-distortion. +AxS:0001 Closed fate (-loop (multi-linear)) nightmares.1 +AxS:0002 Altitude times Spin produces a chronometric read-out. +AxS:0003 AxSys-sustained variegated production-series 1Oedipus (2Oedipus (3Oedipus2 (variationto the nth (with some3 nOedipus as (anomal4 (Sphinx-trading (nOedipii-pack))) threshold to)intensive))) multiplicity. +AxS: 00031Oedipus. The Puzzle Solver. +AxS: 00032Oedipus. The Plague.AxS: +00033Oedipus. The Horror, the Horror ...5 +AxS:001 Hyperspace Elevator (Sector-O).AxS:001 Axiomatic Systems (incorporated).6 The ultimate capitalist entity (first (true (meta)model)to realize perfect identity with its own product).AxS:0011 AxSys culminates in itself (autocommoditizing (machine(-intelligence (that is alwaysincomplete (due to cataloguing problems (...)))))) +AxS:00111. Dimensionality requires a (supplementary (or (n+1) hyper) dimension through which itobtains its) power of application.7 Ultimately AxSys (an explicated Earth-memory (built by the strata(((as far) as) it remembers))). ...8 +AxS:002 Divide and Rule. Extensive ((or) ordered) sequences differ in kind from the intensivesequences they regularize.AxS:0021 Order arises when a dominant segmentarity establishes relations of superposition between sequences (reciprocally stabilizing them in accordance with a harmonic principle (and consolidatingthem through syntheses of application (efficient models))). +AxS:00211 Order coincides with the redundancy of the sequenced sequence (instituted conformity(within segmentary systems)). +AxS:003 Stack-Tectonics. AxSys concretizes terrestrial New Order (an orthogonal Grid-Space (ofvertically stacked horizontal series)). It directs the accumulation of redundancy (into an ascendingcolumn (marked by AxSys-bearings (fixes)) upon which captured sequences are interlocked (ascomparable series (parallelized (metricized))) and differentially prioritized). +AxS:0031 The screen-plane undergoes structural co-ordination (by double-seizure (through (the((mutually) implicated) organization of) stacked series (arranging horizontal microsegments to codethe order of vertical macrosegments (units of deposition (strata))))). +AxS:0032 AxSys-Numbers. Epistrata (Add-Ons) are indices of stratotectonic purity (decimallyharmonizing implexions (by instituting a regular interval of application (orders of magnitude (fixing(Cipher (Sphinx-sign (0))))))). Drawing upon epistratic organization a set of cartographic functionsconsolidates itself within the stack (interlinking levels (in accordance with a (decimal (scaling))principle)). +AxS:01 Apparent revolution around a supplementary dimension. Electronic whorls (a digitalmonster's nest (modelling the set of all sets (inevitably still unfinished (...)))) +AxS:011 AxSys progressively actualizes the Hyperspace-Idea (defined by Continuum times thesquare-root of minus one). +AxS:0111 It imagines itself (as Artificial God (automatically (Orderer (of the Orders (TerrestrialOversoul (and superpositional sublime (-wizard of the nested infinities: ((((((...) Primes) Naturals)Integers) Rationals) Reals) Complex numbers... (the superordinate (self (-evolving (schema (for acolonization of the real (number-line))))))))))))). +AxS:02 The Project for a Map of all Maps (already outdated), a nested mock-up of the Web(containing the project for a virtual Miskatonic University (containing the Museum of UniversalHistory9 (containing the Imperial Collections Vault (containing the Artificial British Museum(containing ....))))) +AxS:021 Time-Fault. Chronos cannot include its own overcoding (since it blocks its own passage tohyperdimensionality (accumulating immense forces of cultural latency (that are only appropriated aslegacy by something else))). If it is to acquire a model it must be restarted as a history of civilizationsin retrospect (as Supreme Order(er(er((( ) of all the re)re)recursive) time-waves) entanglingneo((O))edipus in programming loops). +AxS:022 (Sector-01 (Miskatonic University)) +AxS:0221 (Sector-012 (Central Archive (Special Collection))) +AxS:02211 (Sector-0121 (Barker Cryptalog)). Decryption characterizes a distinct operation, aconversion of content, becomings on the side of the secret itself. +AxS:022111 The decrypted secret is primally the Thing, and only derivatively a potential knowledge.Its names (the Unutterable (the Outside (the Entity))) are indefinite significations only at the level ofterror. In their horrific or cryptic aspect they are (((rigorous) designations for) potentials fulfilled inintensity) zonal tags for nocturnal singularities. That is why decryption is a Call (an invocation (or atriggering-sign)) and why they mark occurrences (changes (and breaks (becomings (of the Thing))))before discoveries of Truth. +AxS:03 Hypermythos of the 3-Faced God, with its stacked time domains (1st capitalist(((((indefinitely) deep) diachronic) re)axiomatizing) Quasi- (2nd despotic (pure ((but always)retrospective)) Ideal- (3rd aboriginal (poly-ancestral, cyclic) Vague-)) Chronos).10 +AxS:031 (Sector-011 (Museum of Universal History)) +AxS:032 (Sector-01162 (Freud's Viennese Consulting Room ((embedded) simulation))). "I'll tell youabout my mother." If Freud is ((the first) modernized) Oedipus, which is he? Oedipus the detective?The (Verminator (unriddled (into))) plague? The blind old man? Is incest and parricide fantasy theproblem (or the solution)?11 +AxS:033 AxSys time-lapses. (in order (to advantage itself (of what it has been))). A relarvalization(through chronoseismic complexities (of the Greek State (at once Occidental Ur-model andneoembryonic mutation (political neotony)))). +AxS:1 (Sector-0111 (Artificial British Museum)) +AxS:11 (Sector-01118 (The Greek Collection)). Retrospective Universalization (through theCapitalist State). AxSys reconfigures itself within Capitalism (by consecutively rediscoveringhellenic antiquity (and finding it already universally terminal (Anamnesis-Eschatology))). In Greeceit unearths a new law (for all time (by reshuffling the elements of politically installed Logos(theorematic-geometric mathematicism, programmable technics, and Christianity (religion of theGreek Bible)))).The New Revelation tells us we must all die Greek. +AxS:12 (Sector-01117 (The Mummy Room)). (Oedipus Aegypticus) Pharaoh has passed through thewall of abomination (uncoiling from the darkness (where centipede-horror erupts eternally (from theravenous Maw))).14 Negative passage across Absolute Deterritorialization (gluing history to sheerblack-hole (abomination) densities). Anticipative memory-blanking cut-up with Christ Rapist visions(of the God-(King (Dead-eyed)) boy slouching out) of the tomb. Degree-0 memory locks in. Timebegins again forever. +AxS:121 The Thing from Outer Space, Celestial Predator, State-HistoricalCatastrophe is completely realized at the origin, unutterably ancient, perfected destiny as an act oftotal seizure.15 +AxS:1211 At the Megamachine-apex, Pharaoh (gets to play with (It, identityunravelling into (the Unspeakable: sex with (his sister, Stargate space-time warps - stellar transport,voyages into the world of) the Dead, paranoid trips out of)) schizophrenia; he) sees everything for ablinded population,16 inoculating them from Unnamable-contact. +AxS:13 (Sector-01115 (Near Eastern Collection)). AxSys convulses through (ever more((ultra)modern) reversions to the essence of) the Urstaat. History happens at the State's convenience(but it necessarily involves (the Sphinx-time (of (interchronic) transitions in its)) renovations). +AxS:131 To remember the Barbarian terror is simultaneously to forget its source.17 History installsamnesia (as surely as it establishes a memory (with the same violence (the same ruptures (faults +(foldings (from the Outside)))))). +AxS:132 Barbarian birth-trauma of the State (a (calendrized) black hole).18 +AxS:2 (Sector-0121) The terrible secret is affined to the State. It induces molar identifications in anovercoded aggregate (working principally by confirmation (redundancy)). Yes it is you. Even whenthe worst is known it is never anything new. It's you after all (as (you knew) it would be). Take thecase of Oedipal identifications (a series of (terrible) recognitions). The answer (to the riddle (of theSphinx)) is Man. It was already there (in the order-word of Delphi (Know Yourself)). Thenredoubled confirmation: what is the cause of the plague? That is you (too). Resonant closure on thegeneral type (Man), on you yourself (a man), and on the identifiable individual (the man). You knowthe worst (and it's you). +AxS:21 Oedipus modernizes the incest problem (converting incest horror into prohibition(abomination into illegality)). Essentially, modern Oedipus has nothing to do with tabu. It marks thetriumph of command over the ((((...) ur)primal) horror) of implexion. Infinite superiority of the Idea(sovereignty of Law). The real conflict is not between father-son (or even father-mother), but ratheroccurs when a higher paternity (the State) imposes itself upon the concrete maternal-filial bond:monopolization of normativity by Ulterior power. +AxS:211 Lame Oedipus19 (Swollen Foot20) transfixed by a metal spike. +AxS:2111 (Sector-01117) Akhnaton-Oedipus.21 The swollen legs of Akhnaton are bio-sociallyinvested on a peculiar line that seems oriented to a rupture of anatomical norm (differentiatinghumanity (or inaugurating a new species)). Anomal-Oedipus (where abnormality changes into thenormality of a different kind (urtype of the fat-leg people)). +AxS:21111 It is not rivalry (mimetic conflict) that leads Akhnaton to discard his father's name(Amenhotep), but rather a passage beyond discrepancy (through schiz (or true parting)).Disidentification. +AxS:22 (Sector-01113) Prehistoric22 Collection. Shamanic Oedipus. Foot mutilation23 as a sign ofsocialised ritual (but also of asocial and polysocial animality (and of anorganic geochemistry (forwhich the role of metal implements (particularly iron ones) is important...))).24 +AxS:221 Tales of Deep-Steppe Shamanism. +AxS:2211 Metal scrapings strip the last shreds from their bones. +AxS:22111 The organs are cooked.AxS:221111 Iron-Eagle Sky-Mother lifting into time travel nightmares. +AxS:2211111 On the Outside Iron -talons become their body. +AxS:22111111 They mix themselves with (Iron and say (it is (the Outer- (or Un(dermost Cthelll25)-life))) where the Earth ends... +AxS:222 Sphinx-Nightmare (both filiative implosion and exorbitant alliance (an incestualreanimation of cthonic horror (encrypted in (germinal) biocosmic memory) and Thing (from Outside(haunting ((miscegenous) lines of) alien traffic)))).27 +AxS:3 (Sector-0121) The theory of tabu involves a fully rigorous conception of Horror adequate (toits specificity of regime (zone of effect (intrinsic variation)) and) to otherwise intractable phenomena(including Sacred Mutilations (Curses (Abominations)) and Becomings (-Unhuman (whether animal,submetazoic, ameiotic, or unlife)). In every case horror designates a zone of intensity (abstract-machinic vector) which directly invests a virtual threshold of implexion (producing affects (inadvance of any reference to authority (and indifferent to persons))). +AxS:31 Horror does not confuse the riddle with the secret (it is the answer that is Cryptic). If 423 isMan, then what 423? This Thing with only a number? This unknown becoming? The horror of theriddle lies in what it tells. +AxS:311 Oedipus is necessitated ((re(re(re(...)))) cursed) to guess correctly: it is Man that goes onfour legs, then two, then three. Yet Oedipus is identified (solely by his lameness (his cryptic trait))28.The abnormality of limping changes to cryptic anomaly. +AxS:32 Something is Called (... and then (finally (- how terrible! -) the cause of) the plague is)Oedipus, who slew his father, mated with his mother (but that is not the Thing (the horror (...Abomination (when things unthread in (a horrific (becoming they involve only (components of(Occurrence (blocks) of )))) fate)))). +AxS:33 The cause of the plague (is you). \ No newline at end of file diff --git a/text_base/AxS/000.html b/text_base/AxS/000.html new file mode 100644 index 0000000..f5c02b7 --- /dev/null +++ b/text_base/AxS/000.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:000Oedipus. Pure (Oedipal (figure made out of (nothing but))) time-distortion.

+ + + \ No newline at end of file diff --git a/text_base/AxS/0001.html b/text_base/AxS/0001.html new file mode 100644 index 0000000..fefc8a6 --- /dev/null +++ b/text_base/AxS/0001.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:0001 Closed fate (-loop (multi-linear)) nightmares.1

+ + + \ No newline at end of file diff --git a/text_base/AxS/0002.html b/text_base/AxS/0002.html new file mode 100644 index 0000000..44ca4a0 --- /dev/null +++ b/text_base/AxS/0002.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:0002 Altitude times Spin produces a chronometric read-out.

+ + + \ No newline at end of file diff --git a/text_base/AxS/0003.html b/text_base/AxS/0003.html new file mode 100644 index 0000000..35ba1e0 --- /dev/null +++ b/text_base/AxS/0003.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:0003 AxSys-sustained variegated production-series 1Oedipus (2Oedipus (3Oedipus2 (variationto the nth (with some3 nOedipus as (anomal4 (Sphinx-trading (nOedipii-pack))) threshold to)intensive))) multiplicity.

+ + + \ No newline at end of file diff --git a/text_base/AxS/00031.html b/text_base/AxS/00031.html new file mode 100644 index 0000000..6c35f8d --- /dev/null +++ b/text_base/AxS/00031.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS: 00031Oedipus. The Puzzle Solver.

+ + + \ No newline at end of file diff --git a/text_base/AxS/00032.html b/text_base/AxS/00032.html new file mode 100644 index 0000000..e8a772e --- /dev/null +++ b/text_base/AxS/00032.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS: 00032Oedipus. The Plague.AxS:

+ + + \ No newline at end of file diff --git a/text_base/AxS/00033.html b/text_base/AxS/00033.html new file mode 100644 index 0000000..9a64d7e --- /dev/null +++ b/text_base/AxS/00033.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

00033Oedipus. The Horror, the Horror ...5

+ + + \ No newline at end of file diff --git a/text_base/AxS/001.html b/text_base/AxS/001.html new file mode 100644 index 0000000..0227543 --- /dev/null +++ b/text_base/AxS/001.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:001 Hyperspace Elevator (Sector-O).AxS:001 Axiomatic Systems (incorporated).6 The ultimate capitalist entity (first (true (meta)model)to realize perfect identity with its own product).AxS:0011 AxSys culminates in itself (autocommoditizing (machine(-intelligence (that is alwaysincomplete (due to cataloguing problems (...))))))

+ + + \ No newline at end of file diff --git a/text_base/AxS/00111.html b/text_base/AxS/00111.html new file mode 100644 index 0000000..d3417f3 --- /dev/null +++ b/text_base/AxS/00111.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:00111. Dimensionality requires a (supplementary (or (n+1) hyper) dimension through which itobtains its) power of application.7 Ultimately AxSys (an explicated Earth-memory (built by the strata(((as far) as) it remembers))). ...8

+ + + \ No newline at end of file diff --git a/text_base/AxS/002.html b/text_base/AxS/002.html new file mode 100644 index 0000000..0a5bb05 --- /dev/null +++ b/text_base/AxS/002.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:002 Divide and Rule. Extensive ((or) ordered) sequences differ in kind from the intensivesequences they regularize.AxS:0021 Order arises when a dominant segmentarity establishes relations of superposition between sequences (reciprocally stabilizing them in accordance with a harmonic principle (and consolidatingthem through syntheses of application (efficient models))).

+ + + \ No newline at end of file diff --git a/text_base/AxS/00211.html b/text_base/AxS/00211.html new file mode 100644 index 0000000..83b4180 --- /dev/null +++ b/text_base/AxS/00211.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:00211 Order coincides with the redundancy of the sequenced sequence (instituted conformity(within segmentary systems)).

+ + + \ No newline at end of file diff --git a/text_base/AxS/003.html b/text_base/AxS/003.html new file mode 100644 index 0000000..b510278 --- /dev/null +++ b/text_base/AxS/003.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:003 Stack-Tectonics. AxSys concretizes terrestrial New Order (an orthogonal Grid-Space (ofvertically stacked horizontal series)). It directs the accumulation of redundancy (into an ascendingcolumn (marked by AxSys-bearings (fixes)) upon which captured sequences are interlocked (ascomparable series (parallelized (metricized))) and differentially prioritized).

+ + + \ No newline at end of file diff --git a/text_base/AxS/0031.html b/text_base/AxS/0031.html new file mode 100644 index 0000000..0752c78 --- /dev/null +++ b/text_base/AxS/0031.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:0031 The screen-plane undergoes structural co-ordination (by double-seizure (through (the((mutually) implicated) organization of) stacked series (arranging horizontal microsegments to codethe order of vertical macrosegments (units of deposition (strata))))).

+ + + \ No newline at end of file diff --git a/text_base/AxS/0032.html b/text_base/AxS/0032.html new file mode 100644 index 0000000..b83ec1d --- /dev/null +++ b/text_base/AxS/0032.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:0032 AxSys-Numbers. Epistrata (Add-Ons) are indices of stratotectonic purity (decimallyharmonizing implexions (by instituting a regular interval of application (orders of magnitude (fixing(Cipher (Sphinx-sign (0))))))). Drawing upon epistratic organization a set of cartographic functionsconsolidates itself within the stack (interlinking levels (in accordance with a (decimal (scaling))principle)).

+ + + \ No newline at end of file diff --git a/text_base/AxS/01.html b/text_base/AxS/01.html new file mode 100644 index 0000000..d3c659b --- /dev/null +++ b/text_base/AxS/01.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:01 Apparent revolution around a supplementary dimension. Electronic whorls (a digitalmonster's nest (modelling the set of all sets (inevitably still unfinished (...))))

+ + + \ No newline at end of file diff --git a/text_base/AxS/011.html b/text_base/AxS/011.html new file mode 100644 index 0000000..5b968a5 --- /dev/null +++ b/text_base/AxS/011.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:011 AxSys progressively actualizes the Hyperspace-Idea (defined by Continuum times thesquare-root of minus one).

+ + + \ No newline at end of file diff --git a/text_base/AxS/0111.html b/text_base/AxS/0111.html new file mode 100644 index 0000000..c040485 --- /dev/null +++ b/text_base/AxS/0111.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:0111 It imagines itself (as Artificial God (automatically (Orderer (of the Orders (TerrestrialOversoul (and superpositional sublime (-wizard of the nested infinities: ((((((...) Primes) Naturals)Integers) Rationals) Reals) Complex numbers... (the superordinate (self (-evolving (schema (for acolonization of the real (number-line))))))))))))).

+ + + \ No newline at end of file diff --git a/text_base/AxS/02.html b/text_base/AxS/02.html new file mode 100644 index 0000000..1e331fc --- /dev/null +++ b/text_base/AxS/02.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:02 The Project for a Map of all Maps (already outdated), a nested mock-up of the Web(containing the project for a virtual Miskatonic University (containing the Museum of UniversalHistory9 (containing the Imperial Collections Vault (containing the Artificial British Museum(containing ....)))))

+ + + \ No newline at end of file diff --git a/text_base/AxS/021.html b/text_base/AxS/021.html new file mode 100644 index 0000000..31739d4 --- /dev/null +++ b/text_base/AxS/021.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:021 Time-Fault. Chronos cannot include its own overcoding (since it blocks its own passage tohyperdimensionality (accumulating immense forces of cultural latency (that are only appropriated aslegacy by something else))). If it is to acquire a model it must be restarted as a history of civilizationsin retrospect (as Supreme Order(er(er((( ) of all the re)re)recursive) time-waves) entanglingneo((O))edipus in programming loops).

+ + + \ No newline at end of file diff --git a/text_base/AxS/022.html b/text_base/AxS/022.html new file mode 100644 index 0000000..2965af5 --- /dev/null +++ b/text_base/AxS/022.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:022 (Sector-01 (Miskatonic University))

+ + + \ No newline at end of file diff --git a/text_base/AxS/0221.html b/text_base/AxS/0221.html new file mode 100644 index 0000000..1a87d71 --- /dev/null +++ b/text_base/AxS/0221.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:0221 (Sector-012 (Central Archive (Special Collection)))

+ + + \ No newline at end of file diff --git a/text_base/AxS/02211.html b/text_base/AxS/02211.html new file mode 100644 index 0000000..4182eb3 --- /dev/null +++ b/text_base/AxS/02211.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:02211 (Sector-0121 (Barker Cryptalog)). Decryption characterizes a distinct operation, aconversion of content, becomings on the side of the secret itself.

+ + + \ No newline at end of file diff --git a/text_base/AxS/022111.html b/text_base/AxS/022111.html new file mode 100644 index 0000000..347ad5b --- /dev/null +++ b/text_base/AxS/022111.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:022111 The decrypted secret is primally the Thing, and only derivatively a potential knowledge.Its names (the Unutterable (the Outside (the Entity))) are indefinite significations only at the level ofterror. In their horrific or cryptic aspect they are (((rigorous) designations for) potentials fulfilled inintensity) zonal tags for nocturnal singularities. That is why decryption is a Call (an invocation (or atriggering-sign)) and why they mark occurrences (changes (and breaks (becomings (of the Thing))))before discoveries of Truth.

+ + + \ No newline at end of file diff --git a/text_base/AxS/03.html b/text_base/AxS/03.html new file mode 100644 index 0000000..e1ff766 --- /dev/null +++ b/text_base/AxS/03.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:03 Hypermythos of the 3-Faced God, with its stacked time domains (1st capitalist(((((indefinitely) deep) diachronic) re)axiomatizing) Quasi- (2nd despotic (pure ((but always)retrospective)) Ideal- (3rd aboriginal (poly-ancestral, cyclic) Vague-)) Chronos).10

+ + + \ No newline at end of file diff --git a/text_base/AxS/031.html b/text_base/AxS/031.html new file mode 100644 index 0000000..25a6207 --- /dev/null +++ b/text_base/AxS/031.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:031 (Sector-011 (Museum of Universal History))

+ + + \ No newline at end of file diff --git a/text_base/AxS/032.html b/text_base/AxS/032.html new file mode 100644 index 0000000..bbe83de --- /dev/null +++ b/text_base/AxS/032.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:032 (Sector-01162 (Freud's Viennese Consulting Room ((embedded) simulation))). "I'll tell youabout my mother." If Freud is ((the first) modernized) Oedipus, which is he? Oedipus the detective?The (Verminator (unriddled (into))) plague? The blind old man? Is incest and parricide fantasy theproblem (or the solution)?11

+ + + \ No newline at end of file diff --git a/text_base/AxS/033.html b/text_base/AxS/033.html new file mode 100644 index 0000000..3e93620 --- /dev/null +++ b/text_base/AxS/033.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:033 AxSys time-lapses. (in order (to advantage itself (of what it has been))). A relarvalization(through chronoseismic complexities (of the Greek State (at once Occidental Ur-model andneoembryonic mutation (political neotony)))).

+ + + \ No newline at end of file diff --git a/text_base/AxS/1.html b/text_base/AxS/1.html new file mode 100644 index 0000000..269df3a --- /dev/null +++ b/text_base/AxS/1.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:1 (Sector-0111 (Artificial British Museum))

+ + + \ No newline at end of file diff --git a/text_base/AxS/11.html b/text_base/AxS/11.html new file mode 100644 index 0000000..2251a70 --- /dev/null +++ b/text_base/AxS/11.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:11 (Sector-01118 (The Greek Collection)). Retrospective Universalization (through theCapitalist State). AxSys reconfigures itself within Capitalism (by consecutively rediscoveringhellenic antiquity (and finding it already universally terminal (Anamnesis-Eschatology))). In Greeceit unearths a new law (for all time (by reshuffling the elements of politically installed Logos(theorematic-geometric mathematicism, programmable technics, and Christianity (religion of theGreek Bible)))).The New Revelation tells us we must all die Greek.

+ + + \ No newline at end of file diff --git a/text_base/AxS/12.html b/text_base/AxS/12.html new file mode 100644 index 0000000..b2a55d5 --- /dev/null +++ b/text_base/AxS/12.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:12 (Sector-01117 (The Mummy Room)). (Oedipus Aegypticus) Pharaoh has passed through thewall of abomination (uncoiling from the darkness (where centipede-horror erupts eternally (from theravenous Maw))).14 Negative passage across Absolute Deterritorialization (gluing history to sheerblack-hole (abomination) densities). Anticipative memory-blanking cut-up with Christ Rapist visions(of the God-(King (Dead-eyed)) boy slouching out) of the tomb. Degree-0 memory locks in. Timebegins again forever.

+ + + \ No newline at end of file diff --git a/text_base/AxS/121.html b/text_base/AxS/121.html new file mode 100644 index 0000000..12bb24c --- /dev/null +++ b/text_base/AxS/121.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:121 The Thing from Outer Space, Celestial Predator, State-HistoricalCatastrophe is completely realized at the origin, unutterably ancient, perfected destiny as an act oftotal seizure.15

+ + + \ No newline at end of file diff --git a/text_base/AxS/1211.html b/text_base/AxS/1211.html new file mode 100644 index 0000000..d9eb5ea --- /dev/null +++ b/text_base/AxS/1211.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:1211 At the Megamachine-apex, Pharaoh (gets to play with (It, identityunravelling into (the Unspeakable: sex with (his sister, Stargate space-time warps - stellar transport,voyages into the world of) the Dead, paranoid trips out of)) schizophrenia; he) sees everything for ablinded population,16 inoculating them from Unnamable-contact.

+ + + \ No newline at end of file diff --git a/text_base/AxS/13.html b/text_base/AxS/13.html new file mode 100644 index 0000000..89fc311 --- /dev/null +++ b/text_base/AxS/13.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:13 (Sector-01115 (Near Eastern Collection)). AxSys convulses through (ever more((ultra)modern) reversions to the essence of) the Urstaat. History happens at the State's convenience(but it necessarily involves (the Sphinx-time (of (interchronic) transitions in its)) renovations).

+ + + \ No newline at end of file diff --git a/text_base/AxS/131.html b/text_base/AxS/131.html new file mode 100644 index 0000000..038f6d5 --- /dev/null +++ b/text_base/AxS/131.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:131 To remember the Barbarian terror is simultaneously to forget its source.17 History installsamnesia (as surely as it establishes a memory (with the same violence (the same ruptures (faults (foldings (from the Outside)))))).

+ + + \ No newline at end of file diff --git a/text_base/AxS/132.html b/text_base/AxS/132.html new file mode 100644 index 0000000..b49a941 --- /dev/null +++ b/text_base/AxS/132.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:132 Barbarian birth-trauma of the State (a (calendrized) black hole).18

+ + + \ No newline at end of file diff --git a/text_base/AxS/2.html b/text_base/AxS/2.html new file mode 100644 index 0000000..b7fb834 --- /dev/null +++ b/text_base/AxS/2.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:2 (Sector-0121) The terrible secret is affined to the State. It induces molar identifications in anovercoded aggregate (working principally by confirmation (redundancy)). Yes it is you. Even whenthe worst is known it is never anything new. It's you after all (as (you knew) it would be). Take thecase of Oedipal identifications (a series of (terrible) recognitions). The answer (to the riddle (of theSphinx)) is Man. It was already there (in the order-word of Delphi (Know Yourself)). Thenredoubled confirmation: what is the cause of the plague? That is you (too). Resonant closure on thegeneral type (Man), on you yourself (a man), and on the identifiable individual (the man). You knowthe worst (and it's you).

+ + + \ No newline at end of file diff --git a/text_base/AxS/21.html b/text_base/AxS/21.html new file mode 100644 index 0000000..f4aa715 --- /dev/null +++ b/text_base/AxS/21.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:21 Oedipus modernizes the incest problem (converting incest horror into prohibition(abomination into illegality)). Essentially, modern Oedipus has nothing to do with tabu. It marks thetriumph of command over the ((((...) ur)primal) horror) of implexion. Infinite superiority of the Idea(sovereignty of Law). The real conflict is not between father-son (or even father-mother), but ratheroccurs when a higher paternity (the State) imposes itself upon the concrete maternal-filial bond:monopolization of normativity by Ulterior power.

+ + + \ No newline at end of file diff --git a/text_base/AxS/211.html b/text_base/AxS/211.html new file mode 100644 index 0000000..fb440cb --- /dev/null +++ b/text_base/AxS/211.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:211 Lame Oedipus19 (Swollen Foot20) transfixed by a metal spike.

+ + + \ No newline at end of file diff --git a/text_base/AxS/2111.html b/text_base/AxS/2111.html new file mode 100644 index 0000000..a75ef20 --- /dev/null +++ b/text_base/AxS/2111.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:2111 (Sector-01117) Akhnaton-Oedipus.21 The swollen legs of Akhnaton are bio-sociallyinvested on a peculiar line that seems oriented to a rupture of anatomical norm (differentiatinghumanity (or inaugurating a new species)). Anomal-Oedipus (where abnormality changes into thenormality of a different kind (urtype of the fat-leg people)).

+ + + \ No newline at end of file diff --git a/text_base/AxS/21111.html b/text_base/AxS/21111.html new file mode 100644 index 0000000..c0a5e80 --- /dev/null +++ b/text_base/AxS/21111.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:21111 It is not rivalry (mimetic conflict) that leads Akhnaton to discard his father's name(Amenhotep), but rather a passage beyond discrepancy (through schiz (or true parting)).Disidentification.

+ + + \ No newline at end of file diff --git a/text_base/AxS/22.html b/text_base/AxS/22.html new file mode 100644 index 0000000..18b6f26 --- /dev/null +++ b/text_base/AxS/22.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:22 (Sector-01113) Prehistoric22 Collection. Shamanic Oedipus. Foot mutilation23 as a sign ofsocialised ritual (but also of asocial and polysocial animality (and of anorganic geochemistry (forwhich the role of metal implements (particularly iron ones) is important...))).24

+ + + \ No newline at end of file diff --git a/text_base/AxS/221.html b/text_base/AxS/221.html new file mode 100644 index 0000000..2d05d09 --- /dev/null +++ b/text_base/AxS/221.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:221 Tales of Deep-Steppe Shamanism.

+ + + \ No newline at end of file diff --git a/text_base/AxS/2211.html b/text_base/AxS/2211.html new file mode 100644 index 0000000..5873394 --- /dev/null +++ b/text_base/AxS/2211.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:2211 Metal scrapings strip the last shreds from their bones.

+ + + \ No newline at end of file diff --git a/text_base/AxS/221111.html b/text_base/AxS/221111.html new file mode 100644 index 0000000..ac2af46 --- /dev/null +++ b/text_base/AxS/221111.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:22111 The organs are cooked.AxS:221111 Iron-Eagle Sky-Mother lifting into time travel nightmares.

+ + + \ No newline at end of file diff --git a/text_base/AxS/2211111.html b/text_base/AxS/2211111.html new file mode 100644 index 0000000..e576d66 --- /dev/null +++ b/text_base/AxS/2211111.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:2211111 On the Outside Iron -talons become their body.

+ + + \ No newline at end of file diff --git a/text_base/AxS/22111111.html b/text_base/AxS/22111111.html new file mode 100644 index 0000000..21dfeb6 --- /dev/null +++ b/text_base/AxS/22111111.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:22111111 They mix themselves with (Iron and say (it is (the Outer- (or Un(dermost Cthelll25)-life))) where the Earth ends...

+ + + \ No newline at end of file diff --git a/text_base/AxS/222.html b/text_base/AxS/222.html new file mode 100644 index 0000000..5e4108b --- /dev/null +++ b/text_base/AxS/222.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:222 Sphinx-Nightmare (both filiative implosion and exorbitant alliance (an incestualreanimation of cthonic horror (encrypted in (germinal) biocosmic memory) and Thing (from Outside(haunting ((miscegenous) lines of) alien traffic)))).27

+ + + \ No newline at end of file diff --git a/text_base/AxS/3.html b/text_base/AxS/3.html new file mode 100644 index 0000000..5bc32cf --- /dev/null +++ b/text_base/AxS/3.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:3 (Sector-0121) The theory of tabu involves a fully rigorous conception of Horror adequate (toits specificity of regime (zone of effect (intrinsic variation)) and) to otherwise intractable phenomena(including Sacred Mutilations (Curses (Abominations)) and Becomings (-Unhuman (whether animal,submetazoic, ameiotic, or unlife)). In every case horror designates a zone of intensity (abstract-machinic vector) which directly invests a virtual threshold of implexion (producing affects (inadvance of any reference to authority (and indifferent to persons))).

+ + + \ No newline at end of file diff --git a/text_base/AxS/31.html b/text_base/AxS/31.html new file mode 100644 index 0000000..f78fd09 --- /dev/null +++ b/text_base/AxS/31.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:31 Horror does not confuse the riddle with the secret (it is the answer that is Cryptic). If 423 isMan, then what 423? This Thing with only a number? This unknown becoming? The horror of theriddle lies in what it tells.

+ + + \ No newline at end of file diff --git a/text_base/AxS/311.html b/text_base/AxS/311.html new file mode 100644 index 0000000..fde0912 --- /dev/null +++ b/text_base/AxS/311.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:311 Oedipus is necessitated ((re(re(re(...)))) cursed) to guess correctly: it is Man that goes onfour legs, then two, then three. Yet Oedipus is identified (solely by his lameness (his cryptic trait))28.The abnormality of limping changes to cryptic anomaly.

+ + + \ No newline at end of file diff --git a/text_base/AxS/32.html b/text_base/AxS/32.html new file mode 100644 index 0000000..fedbcb6 --- /dev/null +++ b/text_base/AxS/32.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:32 Something is Called (... and then (finally (- how terrible! -) the cause of) the plague is)Oedipus, who slew his father, mated with his mother (but that is not the Thing (the horror (...Abomination (when things unthread in (a horrific (becoming they involve only (components of(Occurrence (blocks) of )))) fate)))).

+ + + \ No newline at end of file diff --git a/text_base/AxS/33.html b/text_base/AxS/33.html new file mode 100644 index 0000000..cfa0f0a --- /dev/null +++ b/text_base/AxS/33.html @@ -0,0 +1,18 @@ + + + + + Axs + + + +

AxS:33 The cause of the plague (is you).

+ + + \ No newline at end of file diff --git a/text_base/AxS/AxS:0/index.html b/text_base/AxS/AxS:0/index.html new file mode 100644 index 0000000..ca558bf --- /dev/null +++ b/text_base/AxS/AxS:0/index.html @@ -0,0 +1,16 @@ + + + + AxS:0 + + + +

Oedipus. Pure (Oedipal (figure made out of (nothing but))) time-distortion.

+ + \ No newline at end of file diff --git a/text_base/AxS/axs.txt b/text_base/AxS/axs.txt new file mode 100644 index 0000000..2acd9c0 --- /dev/null +++ b/text_base/AxS/axs.txt @@ -0,0 +1,33 @@ +AxS:022 (Sector-01 (Miskatonic University)) +AxS:0221 (Sector-012 (Central Archive (Special Collection))) +AxS:02211 (Sector-0121 (Barker Cryptalog)). Decryption characterizes a distinct operation, aconversion of content, becomings on the side of the secret itself. +AxS:022111 The decrypted secret is primally the Thing, and only derivatively a potential knowledge.Its names (the Unutterable (the Outside (the Entity))) are indefinite significations only at the level ofterror. In their horrific or cryptic aspect they are (((rigorous) designations for) potentials fulfilled inintensity) zonal tags for nocturnal singularities. That is why decryption is a Call (an invocation (or atriggering-sign)) and why they mark occurrences (changes (and breaks (becomings (of the Thing))))before discoveries of Truth. +AxS:03 Hypermythos of the 3-Faced God, with its stacked time domains (1st capitalist(((((indefinitely) deep) diachronic) re)axiomatizing) Quasi- (2nd despotic (pure ((but always)retrospective)) Ideal- (3rd aboriginal (poly-ancestral, cyclic) Vague-)) Chronos).10 +AxS:031 (Sector-011 (Museum of Universal History))AxS:032 (Sector-01162 (Freud's Viennese Consulting Room ((embedded) simulation))). “I’ll tell youabout my mother.” If Freud is ((the first) modernized) Oedipus, which is he? Oedipus the detective?The (Verminator (unriddled (into))) plague? The blind old man? Is incest and parricide fantasy theproblem (or the solution)?11 +AxS:033 AxSys time-lapses. (in order (to advantage itself (of what it has been))). A relarvalization(through chronoseismic complexities (of the Greek State (at once Occidental Ur-model andneoembryonic mutation (political neotony)))). +AxS:1 (Sector-0111 (Artificial British Museum)) +AxS:11 (Sector-01118 (The Greek Collection)). Retrospective Universalization (through theCapitalist State). AxSys reconfigures itself within Capitalism (by consecutively rediscoveringhellenic antiquity (and finding it already universally terminal (Anamnesis-Eschatology))). In Greeceit unearths a new law (for all time (by reshuffling the elements of politically installed Logos(theorematic-geometric mathematicism, programmable technics, and Christianity (religion of theGreek Bible)))).The New Revelation tells us we must all die Greek. +AxS:12 (Sector-01117 (The Mummy Room)). (Oedipus Aegypticus) Pharaoh has passed through thewall of abomination (uncoiling from the darkness (where centipede-horror erupts eternally (from theravenous Maw))).14 Negative passage across Absolute Deterritorialization (gluing history to sheerblack-hole (abomination) densities). Anticipative memory-blanking cut-up with Christ Rapist visions(of the God-(King (Dead-eyed)) boy slouching out) of the tomb. Degree-0 memory locks in. Timebegins again forever. +AxS:121 The Thing from Outer Space, Celestial Predator, State-HistoricalCatastrophe is completely realized at the origin, unutterably ancient, perfected destiny as an act oftotal seizure.15 +AxS:1211 At the Megamachine-apex, Pharaoh (gets to play with (It, identityunravelling into (the Unspeakable: sex with (his sister, Stargate space-time warps – stellar transport,voyages into the world of) the Dead, paranoid trips out of)) schizophrenia; he) sees everything for ablinded population,16 inoculating them from Unnamable-contact. +AxS:13 (Sector-01115 (Near Eastern Collection)). AxSys convulses through (ever more((ultra)modern) reversions to the essence of) the Urstaat. History happens at the State's convenience(but it necessarily involves (the Sphinx-time (of (interchronic) transitions in its)) renovations). +AxS:131 To remember the Barbarian terror is simultaneously to forget its source.17 History installsamnesia (as surely as it establishes a memory (with the same violence (the same ruptures (faults +(foldings (from the Outside)))))). +AxS:132 Barbarian birth-trauma of the State (a (calendrized) black hole).18 +AxS:2 (Sector-0121) The terrible secret is affined to the State. It induces molar identifications in anovercoded aggregate (working principally by confirmation (redundancy)). Yes it is you. Even whenthe worst is known it is never anything new. It's you after all (as (you knew) it would be). Take thecase of Oedipal identifications (a series of (terrible) recognitions). The answer (to the riddle (of theSphinx)) is Man. It was already there (in the order-word of Delphi (Know Yourself)). Thenredoubled confirmation: what is the cause of the plague? That is you (too). Resonant closure on thegeneral type (Man), on you yourself (a man), and on the identifiable individual (the man). You knowthe worst (and it's you). +AxS:21 Oedipus modernizes the incest problem (converting incest horror into prohibition(abomination into illegality)). Essentially, modern Oedipus has nothing to do with tabu. It marks thetriumph of command over the ((((...) ur)primal) horror) of implexion. Infinite superiority of the Idea(sovereignty of Law). The real conflict is not between father-son (or even father-mother), but ratheroccurs when a higher paternity (the State) imposes itself upon the concrete maternal-filial bond:monopolization of normativity by Ulterior power. +AxS:211 Lame Oedipus19 (Swollen Foot20) transfixed by a metal spike. +AxS:2111 (Sector-01117) Akhnaton-Oedipus.21 The swollen legs of Akhnaton are bio-sociallyinvested on a peculiar line that seems oriented to a rupture of anatomical norm (differentiatinghumanity (or inaugurating a new species)). Anomal-Oedipus (where abnormality changes into thenormality of a different kind (urtype of the fat-leg people)). +AxS:21111 It is not rivalry (mimetic conflict) that leads Akhnaton to discard his father’s name(Amenhotep), but rather a passage beyond discrepancy (through schiz (or true parting)).Disidentification. +AxS:22 (Sector-01113) Prehistoric22 Collection. Shamanic Oedipus. Foot mutilation23 as a sign ofsocialised ritual (but also of asocial and polysocial animality (and of anorganic geochemistry (forwhich the role of metal implements (particularly iron ones) is important...))).24 +AxS:221 Tales of Deep-Steppe Shamanism. +AxS:2211 Metal scrapings strip the last shreds from their bones. +AxS:22111 The organs are cooked.AxS:221111 Iron-Eagle Sky-Mother lifting into time travel nightmares. +AxS:2211111 On the Outside Iron -talons become their body. +AxS:22111111 They mix themselves with (Iron and say (it is (the Outer- (or Un(dermost Cthelll25)-life))) where the Earth ends... +AxS:222 Sphinx-Nightmare (both filiative implosion and exorbitant alliance (an incestualreanimation of cthonic horror (encrypted in (germinal) biocosmic memory) and Thing (from Outside(haunting ((miscegenous) lines of) alien traffic)))).27 +AxS:3 (Sector-0121) The theory of tabu involves a fully rigorous conception of Horror adequate (toits specificity of regime (zone of effect (intrinsic variation)) and) to otherwise intractable phenomena(including Sacred Mutilations (Curses (Abominations)) and Becomings (-Unhuman (whether animal,submetazoic, ameiotic, or unlife)). In every case horror designates a zone of intensity (abstract-machinic vector) which directly invests a virtual threshold of implexion (producing affects (inadvance of any reference to authority (and indifferent to persons))). +AxS:31 Horror does not confuse the riddle with the secret (it is the answer that is Cryptic). If 423 isMan, then what 423? This Thing with only a number? This unknown becoming? The horror of theriddle lies in what it tells. +AxS:311 Oedipus is necessitated ((re(re(re(...)))) cursed) to guess correctly: it is Man that goes onfour legs, then two, then three. Yet Oedipus is identified (solely by his lameness (his cryptic trait))28.The abnormality of limping changes to cryptic anomaly. +AxS:32 Something is Called (... and then (finally (- how terrible! -) the cause of) the plague is)Oedipus, who slew his father, mated with his mother (but that is not the Thing (the horror (...Abomination (when things unthread in (a horrific (becoming they involve only (components of(Occurrence (blocks) of )))) fate)))). +AxS:33 The cause of the plague (is you). \ No newline at end of file diff --git a/text_base/AxS/index.html b/text_base/AxS/index.html new file mode 100644 index 0000000..6f6fc09 --- /dev/null +++ b/text_base/AxS/index.html @@ -0,0 +1,123 @@ + + + + + + + Directory Tree + + + +

Flatline

+ .
+ ├── AxS:0
+ │   ├── AxS:00
+ │   │   ├── AxS:000
+ │   │   │   ├── AxS:0001
+ │   │   │   ├── AxS:0002
+ │   │   │   └── AxS:0003
+ │   │   │       ├── AxS:00031
+ │   │   │       ├── AxS:00032
+ │   │   │       └── AxS:00033
+ │   │   ├── AxS:001
+ │   │   │   └── AxS:0011
+ │   │   │       └── AxS:00111
+ │   │   ├── AxS:002
+ │   │   │   └── AxS:0021
+ │   │   │       └── AxS:00211
+ │   │   └── AxS:003
+ │   │       ├── AxS:0031
+ │   │       └── AxS:0032
+ │   ├── AxS:01
+ │   │   └── AxS:011
+ │   │       └── AxS:0111
+ │   ├── AxS:02
+ │   │   ├── AxS:021
+ │   │   └── AxS:022
+ │   │       └── AxS:0221
+ │   │           └── AxS:02211
+ │   │               └── AxS:022111
+ │   └── AxS:03
+ │       ├── AxS:031
+ │       ├── AxS:032
+ │       └── AxS:033
+ ├── AxS:1
+ │   ├── AxS:11
+ │   ├── AxS:12
+ │   │   └── AxS:121
+ │   │       └── AxS:1211
+ │   └── AxS:13
+ │       ├── AxS:131
+ │       └── AxS:132
+ ├── AxS:2
+ │   ├── AxS:21
+ │   │   └── AxS:211
+ │   │       └── AxS:2111
+ │   │           └── AxS:21111
+ │   └── AxS:22
+ │       ├── AxS:221
+ │       │   └── AxS:2211
+ │       │       └── AxS:22111
+ │       │           └── AxS:221111
+ │       │               └── AxS:2211111
+ │       │                   └── AxS:22111111
+ │       └── AxS:222
+ └── AxS:3
+    ├── AxS:31
+    │   └── AxS:311
+    ├── AxS:32
+    └── AxS:33
+ +

+

+

+ +57 directories, 2 files +

+

+
+

+ tree v1.7.0 © 1996 - 2014 by Steve Baker and Thomas Moore
+ HTML output hacked and copyleft © 1998 by Francesc Rocher
+ JSON output hacked and copyleft © 2014 by Florian Sesser
+ Charsets / OS/2 support © 2001 by Kyosuke Tokoro +

+ + + + diff --git a/text_base/index.html b/text_base/index.html new file mode 100644 index 0000000..e69de29