You cannot select more than 25 topics Topics must start with a letter or number, can include dashes ('-') and can be up to 35 characters long.

702 lines
193 KiB
HTML

5 years ago
<!DOCTYPE html>
<html>
<head>
<meta http-equiv="content-type" content="text/html; charset=UTF-8">
<title> @@@ilinχ </title>
<script src="https://code.jquery.com/jquery-1.12.4.js"></script>
<script src="https://code.jquery.com/ui/1.12.1/jquery-ui.js"></script>
<style type="text/css">
body {
background-color: black;
5 years ago
font-family: "Lucida Console", Monaco, monospace;
5 years ago
overflow-x: hidden;
5 years ago
}
#page_1{
width: 2000px;
height: 8000px;
cursor: move;
5 years ago
margin-left: 20px;
5 years ago
}
.ocrx_word{
cursor: grab;
}
.b {color: red !important;}
.w {color: white !important;}
5 years ago
5 years ago
a.b{color: blue !important;}
5 years ago
</style>
</head>
<body>
<div class='ocr_page draggable' id='page_1' title='image "hypervirus2-01.tif"; bbox 0 0 1749 12409; ppageno 0'>
<div class='ocr_carea' id='block_1_1' title="bbox 78 91 352 146">
<p class='ocr_par' dir='ltr' id='par_1_1' title="bbox 78 91 352 146">
5 years ago
<span class='ocr_line' id='line_1_1' title="bbox 78 91 352 146; baseline 0 -12; x_size 55; x_descenders 12; x_ascenders 13"><span class='ocrx_word' id='word_1_1' title='bbox 78 91 352 146; x_wconf 84' lang='eng' dir='ltr' style="font-size: 30px; color: white;"><b><a id="t"href="https://s3.amazonaws.com/arena-attachments/406213/42bdb859549f609953a0ca61aca0bee3.pdf#page=396" onClick="return popup(this, '000', '1000', '800','1000','500')">Hypervirus</a></b></span>
5 years ago
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_2' title="bbox 348 247 1379 9101">
<p class='ocr_par' dir='ltr' id='par_1_2' title="bbox 349 247 1358 465">
<span class='ocr_line' id='line_1_2' title="bbox 350 247 1358 288; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_2' title='bbox 350 247 529 277; x_wconf 84' lang='eng' dir='ltr'>Whatever</span> <span class='ocrx_word' id='word_1_3' title='bbox 547 247 832 288; x_wconf 97' lang='eng' dir='ltr'>ultramodernity</span> <span class='ocrx_word' id='word_1_4' title='bbox 850 247 963 287; x_wconf 85' lang='eng' dir='ltr'>places</span> <span class='ocrx_word' id='word_1_5' title='bbox 983 247 1090 277; x_wconf 98' lang='eng' dir='ltr'>under</span> <span class='ocrx_word' id='word_1_6' title='bbox 1108 247 1163 277; x_wconf 85' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_7' title='bbox 1182 247 1358 277; x_wconf 87' lang='eng' dir='ltr'>dominion</span>
</span>
<span class='ocr_line' id='line_1_3' title="bbox 350 306 1358 347; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_8' title='bbox 350 306 389 336; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_9' title='bbox 401 306 494 347; x_wconf 85' lang='eng' dir='ltr'>signs</span> <span class='ocrx_word' id='word_1_10' title='bbox 509 306 782 347; x_wconf 97' lang='eng' dir='ltr'>postmodernity</span> <span class='ocrx_word' id='word_1_11' title='bbox 799 306 949 336; x_wconf 85' lang='eng' dir='ltr'>subverts</span> <span class='ocrx_word' id='word_1_12' title='bbox 966 306 1042 336; x_wconf 92' lang='eng' dir='ltr'>with</span> <span class='ocrx_word' id='word_1_13' title='bbox 1059 306 1156 336; x_wconf 89' lang='eng' dir='ltr'>virus.</span> <span class='ocrx_word' id='word_1_14' title='bbox 1171 307 1218 336; x_wconf 93' lang='eng' dir='ltr'>As</span> <span class='ocrx_word' id='word_1_15' title='bbox 1234 306 1358 336; x_wconf 90' lang='eng' dir='ltr'>culture</span>
</span>
<span class='ocr_line' id='line_1_4' title="bbox 350 363 1358 407; baseline 0 -13; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_16' title='bbox 350 364 504 405; x_wconf 84' lang='eng' dir='ltr'>migrates</span> <span class='ocrx_word' id='word_1_17' title='bbox 518 364 590 394; x_wconf 98' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_18' title='bbox 603 364 908 404; x_wconf 88' lang='eng' dir='ltr'>partial-machines</span> <span class='ocrx_word' id='word_1_19' title='bbox 923 363 1068 407; x_wconf 93' lang='eng' dir='ltr'>(lacking</span> <span class='ocrx_word' id='word_1_20' title='bbox 1082 374 1121 394; x_wconf 95' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_21' title='bbox 1136 370 1358 394; x_wconf 88' lang='eng' dir='ltr'>autonomous</span>
</span>
<span class='ocr_line' id='line_1_5' title="bbox 349 421 1357 465; baseline 0 -12; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_22' title='bbox 349 423 575 463; x_wconf 91' lang='eng' dir='ltr'>reproductive</span> <span class='ocrx_word' id='word_1_23' title='bbox 586 421 719 465; x_wconf 89' lang='eng' dir='ltr'>system)</span> <span class='ocrx_word' id='word_1_24' title='bbox 731 423 897 453; x_wconf 90' lang='eng' dir='ltr'>semiotics</span> <span class='ocrx_word' id='word_1_25' title='bbox 905 423 1052 453; x_wconf 94' lang='eng' dir='ltr'>subsides</span> <span class='ocrx_word' id='word_1_26' title='bbox 1060 423 1129 453; x_wconf 98' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_27' title='bbox 1139 423 1357 453; x_wconf 93' lang='eng' dir='ltr'>virotechnics.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_3' title="bbox 348 489 1358 813">
<span class='ocr_line' id='line_1_6' title="bbox 414 489 1356 511; baseline 0.001 -1; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_28' title='bbox 414 489 1356 511; x_wconf 96' lang='eng'>0010101011011100101101010101001100100010001010</span>
</span>
<span class='ocr_line' id='line_1_7' title="bbox 350 547 1357 569; baseline 0.001 -1; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_29' title='bbox 350 547 1357 569; x_wconf 96' lang='eng'>1011101000010101100101001010001100100111001000100</span>
</span>
<span class='ocr_line' id='line_1_8' title="bbox 350 606 1355 628; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_30' title='bbox 350 606 1355 628; x_wconf 94' lang='eng'>000000010011111100010010010101010100001000010101</span>
</span>
<span class='ocr_line' id='line_1_9' title="bbox 350 665 1354 687; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_31' title='bbox 350 665 1354 687; x_wconf 96' lang='eng'>00111111001001000100011010010001010010101111000101</span>
</span>
<span class='ocr_line' id='line_1_10' title="bbox 350 715 1358 756; baseline 0 -11; x_size 40; x_descenders 11; x_ascenders 9"><span class='ocrx_word' id='word_1_32' title='bbox 350 723 735 745; x_wconf 96' lang='eng'>001000010001110100</span> <span class='ocrx_word' id='word_1_33' title='bbox 748 716 807 745; x_wconf 94' lang='eng' dir='ltr'>Yes</span> <span class='ocrx_word' id='word_1_34' title='bbox 822 716 878 745; x_wconf 95' lang='eng' dir='ltr'>No</span> <span class='ocrx_word' id='word_1_35' title='bbox 891 716 950 745; x_wconf 94' lang='eng' dir='ltr'>Yes</span> <span class='ocrx_word' id='word_1_36' title='bbox 965 716 1018 745; x_wconf 96' lang='eng' dir='ltr'>No</span> <span class='ocrx_word' id='word_1_37' title='bbox 1031 716 1090 745; x_wconf 94' lang='eng' dir='ltr'>Yes</span> <span class='ocrx_word' id='word_1_38' title='bbox 1103 716 1162 745; x_wconf 98' lang='eng' dir='ltr'>Yes</span> <span class='ocrx_word' id='word_1_39' title='bbox 1175 716 1230 745; x_wconf 95' lang='eng' dir='ltr'>No</span> <span class='ocrx_word' id='word_1_40' title='bbox 1244 715 1358 756; x_wconf 85' lang='eng' dir='ltr'>longer</span>
</span>
<span class='ocr_line' id='line_1_11' title="bbox 348 773 1145 813; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_41' title='bbox 348 773 437 803; x_wconf 93' lang='eng' dir='ltr'>what</span> <span class='ocrx_word' id='word_1_42' title='bbox 451 773 531 803; x_wconf 98' lang='eng' dir='ltr'>does</span> <span class='ocrx_word' id='word_1_43' title='bbox 545 773 569 803; x_wconf 98' lang='eng' dir='ltr'>it</span> <span class='ocrx_word' id='word_1_44' title='bbox 582 773 700 803; x_wconf 82' lang='eng' dir='ltr'>mean?</span> <span class='ocrx_word' id='word_1_45' title='bbox 714 773 776 803; x_wconf 98' lang='eng' dir='ltr'>but</span> <span class='ocrx_word' id='word_1_46' title='bbox 789 773 866 803; x_wconf 96' lang='eng' dir='ltr'>how</span> <span class='ocrx_word' id='word_1_47' title='bbox 878 773 959 803; x_wconf 98' lang='eng' dir='ltr'>does</span> <span class='ocrx_word' id='word_1_48' title='bbox 973 773 997 803; x_wconf 98' lang='eng' dir='ltr'>it</span> <span class='ocrx_word' id='word_1_49' title='bbox 1010 773 1145 813; x_wconf 80' lang='eng' dir='ltr'>spread?</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_4' title="bbox 349 832 1356 978">
<span class='ocr_line' id='line_1_12' title="bbox 413 832 1356 873; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_50' title='bbox 413 832 548 873; x_wconf 84' lang='eng' dir='ltr'>Having</span> <span class='ocrx_word' id='word_1_51' title='bbox 557 842 603 862; x_wconf 98' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_52' title='bbox 612 842 738 872; x_wconf 97' lang='eng' dir='ltr'>proper</span> <span class='ocrx_word' id='word_1_53' title='bbox 747 832 935 868; x_wconf 79' lang='eng' dir='ltr'>substance,</span> <span class='ocrx_word' id='word_1_54' title='bbox 944 842 983 862; x_wconf 97' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_55' title='bbox 992 842 1082 862; x_wconf 98' lang='eng' dir='ltr'>sense</span> <span class='ocrx_word' id='word_1_56' title='bbox 1092 832 1225 873; x_wconf 88' lang='eng' dir='ltr'>beyond</span> <span class='ocrx_word' id='word_1_57' title='bbox 1234 832 1273 862; x_wconf 98' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_58' title='bbox 1279 842 1314 862; x_wconf 97' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_59' title='bbox 1322 842 1356 862; x_wconf 98' lang='eng' dir='ltr'>re</span>
</span>
<span class='ocr_line' id='line_1_13' title="bbox 349 890 1355 931; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_60' title='bbox 349 900 382 920; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_61' title='bbox 393 890 598 930; x_wconf 79' lang='eng' dir='ltr'>replication,</span> <span class='ocrx_word' id='word_1_62' title='bbox 608 900 665 931; x_wconf 89' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_63' title='bbox 676 900 723 920; x_wconf 98' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_64' title='bbox 734 900 779 920; x_wconf 98' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_65' title='bbox 790 900 891 931; x_wconf 98' lang='eng' dir='ltr'>usage</span> <span class='ocrx_word' id='word_1_66' title='bbox 902 890 941 920; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_67' title='bbox 945 890 1033 920; x_wconf 96' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_68' title='bbox 1043 890 1068 920; x_wconf 98' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_69' title='bbox 1076 900 1154 920; x_wconf 98' lang='eng' dir='ltr'>ever</span> <span class='ocrx_word' id='word_1_70' title='bbox 1162 890 1355 930; x_wconf 92' lang='eng' dir='ltr'>metaphori-</span>
</span>
<span class='ocr_line' id='line_1_14' title="bbox 350 946 1065 978; baseline 0 0; x_size 42.988487; x_descenders 10.988487; x_ascenders 12"><span class='ocrx_word' id='word_1_71' title='bbox 350 948 408 978; x_wconf 91' lang='eng' dir='ltr'>cal.</span> <span class='ocrx_word' id='word_1_72' title='bbox 423 949 490 978; x_wconf 92' lang='eng' dir='ltr'>The</span> <span class='ocrx_word' id='word_1_73' title='bbox 502 948 596 978; x_wconf 97' lang='eng' dir='ltr'>word</span> <span class='ocrx_word' id='word_1_74' title='bbox 610 946 719 978; x_wconf 73' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_75' title='bbox 734 948 761 978; x_wconf 99' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_76' title='bbox 774 958 866 978; x_wconf 97' lang='eng' dir='ltr'>more</span> <span class='ocrx_word' id='word_1_77' title='bbox 879 958 912 978; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_78' title='bbox 925 958 957 978; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_79' title='bbox 969 948 1065 978; x_wconf 89' lang='eng' dir='ltr'>virus.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_5' title="bbox 348 1006 1355 1281">
<span class='ocr_line' id='line_1_15' title="bbox 414 1006 1355 1036; baseline 0 0; x_size 40.988487; x_descenders 10.988487; x_ascenders 10"><span class='ocrx_word' id='word_1_80' title='bbox 414 1006 631 1036; x_wconf 92' lang='eng' dir='ltr'>Postmodern</span> <span class='ocrx_word' id='word_1_81' title='bbox 641 1006 769 1036; x_wconf 99' lang='eng' dir='ltr'>culture</span> <span class='ocrx_word' id='word_1_82' title='bbox 778 1016 813 1036; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_83' title='bbox 820 1016 855 1036; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_84' title='bbox 864 1006 1074 1036; x_wconf 89' lang='eng' dir='ltr'>chatters-out</span> <span class='ocrx_word' id='word_1_85' title='bbox 1082 1006 1168 1036; x_wconf 89' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_86' title='bbox 1177 1006 1262 1036; x_wconf 94' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_87' title='bbox 1269 1006 1355 1036; x_wconf 94' lang='eng' dir='ltr'>virus</span>
</span>
<span class='ocr_line' id='line_1_16' title="bbox 348 1064 1353 1094; baseline 0 0; x_size 42.087334; x_descenders 12.087336; x_ascenders 8"><span class='ocrx_word' id='word_1_88' title='bbox 348 1064 437 1094; x_wconf 91' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_89' title='bbox 453 1064 543 1094; x_wconf 91' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_90' title='bbox 560 1064 650 1094; x_wconf 92' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_91' title='bbox 668 1064 758 1094; x_wconf 92' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_92' title='bbox 776 1064 866 1094; x_wconf 92' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_93' title='bbox 883 1064 971 1094; x_wconf 92' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_94' title='bbox 987 1064 1075 1094; x_wconf 92' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_95' title='bbox 1092 1072 1353 1094; x_wconf 92' lang='eng'>0110001001001</span>
</span>
<span class='ocr_line' id='line_1_17' title="bbox 349 1120 1354 1165; baseline 0 -13; x_size 44.087334; x_descenders 12.087336; x_ascenders 10"><span class='ocrx_word' id='word_1_96' title='bbox 349 1130 985 1153; x_wconf 97' lang='eng'>011010010010110010010010010010</span> <span class='ocrx_word' id='word_1_97' title='bbox 1005 1120 1113 1152; x_wconf 87' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_98' title='bbox 1134 1121 1354 1165; x_wconf 88' lang='eng' dir='ltr'>(viroductile,</span>
</span>
<span class='ocr_line' id='line_1_18' title="bbox 348 1180 1355 1221; baseline 0 -11; x_size 36; x_descenders 6; x_ascenders 10"><span class='ocrx_word' id='word_1_99' title='bbox 348 1180 526 1221; x_wconf 97' lang='eng' dir='ltr'>virogenic,</span> <span class='ocrx_word' id='word_1_100' title='bbox 544 1180 900 1220; x_wconf 98' lang='eng' dir='ltr'>immunosuppressor</span> <span class='ocrx_word' id='word_1_101' title='bbox 913 1180 983 1210; x_wconf 98' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_102' title='bbox 998 1180 1062 1210; x_wconf 98' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_103' title='bbox 1079 1190 1125 1216; x_wconf 99' lang='eng' dir='ltr'>or,</span> <span class='ocrx_word' id='word_1_104' title='bbox 1143 1186 1248 1216; x_wconf 92' lang='eng' dir='ltr'>meta-,</span> <span class='ocrx_word' id='word_1_105' title='bbox 1264 1190 1300 1210; x_wconf 91' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_106' title='bbox 1316 1190 1355 1210; x_wconf 97' lang='eng' dir='ltr'>or</span>
</span>
<span class='ocr_line' id='line_1_19' title="bbox 349 1237 725 1281; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_107' title='bbox 349 1239 417 1269; x_wconf 98' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_108' title='bbox 429 1249 467 1269; x_wconf 98' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_109' title='bbox 479 1237 611 1281; x_wconf 89' lang='eng' dir='ltr'>hyper-)</span> <span class='ocrx_word' id='word_1_110' title='bbox 625 1239 725 1269; x_wconf 92' lang='eng' dir='ltr'>virus.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_6' title="bbox 353 1304 1364 1403">
<span class='ocr_line' id='line_1_20' title="bbox 353 1304 1364 1345; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 9"><span class='ocrx_word' id='word_1_111' title='bbox 353 1313 943 1334; x_wconf 89' lang='eng'>10110010010011101100001001001.</span> <span class='ocrx_word' id='word_1_112' title='bbox 955 1304 1146 1345; x_wconf 93' lang='eng' dir='ltr'>hypervirus</span> <span class='ocrx_word' id='word_1_113' title='bbox 1156 1310 1224 1334; x_wconf 94' lang='eng' dir='ltr'>eats</span> <span class='ocrx_word' id='word_1_114' title='bbox 1236 1304 1287 1334; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_115' title='bbox 1298 1304 1364 1334; x_wconf 92' lang='eng' dir='ltr'>end</span>
</span>
<span class='ocr_line' id='line_1_21' title="bbox 353 1362 524 1403; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_116' title='bbox 353 1362 391 1392; x_wconf 98' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_117' title='bbox 402 1362 524 1403; x_wconf 94' lang='eng' dir='ltr'>history</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_7' title="bbox 353 1429 1365 1857">
<span class='ocr_line' id='line_1_22' title="bbox 415 1429 1365 1450; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_118' title='bbox 415 1429 1365 1450; x_wconf 78' lang='eng'>00100100100010]1110100001001101010101010101000</span>
</span>
<span class='ocr_line' id='line_1_23' title="bbox 353 1487 1363 1508; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_119' title='bbox 353 1487 1363 1508; x_wconf 89' lang='eng'>10011010100100101001001010010110100100101111010001</span>
</span>
<span class='ocr_line' id='line_1_24' title="bbox 353 1545 1365 1566; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_120' title='bbox 353 1545 1365 1566; x_wconf 89' lang='eng'>0101010101010100101010010101101010010000001000101</span>
</span>
<span class='ocr_line' id='line_1_25' title="bbox 354 1603 1365 1624; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_121' title='bbox 354 1603 1365 1624; x_wconf 89' lang='eng'>1101010010010101001010010010101010010001001001001</span>
</span>
<span class='ocr_line' id='line_1_26' title="bbox 353 1661 1364 1682; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_122' title='bbox 353 1661 1364 1682; x_wconf 89' lang='eng'>00100100101001001010110101001001001010110101010101</span>
</span>
<span class='ocr_line' id='line_1_27' title="bbox 353 1719 1365 1740; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_123' title='bbox 353 1719 1365 1740; x_wconf 78' lang='eng'>0101111010000100]1010101010101000100110110101010100</span>
</span>
<span class='ocr_line' id='line_1_28' title="bbox 355 1776 1364 1798; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_124' title='bbox 355 1776 1364 1798; x_wconf 86' lang='eng'>11001000100010101011101000010101100101001010001100</span>
</span>
<span class='ocr_line' id='line_1_29' title="bbox 354 1836 1363 1857; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_125' title='bbox 354 1836 1363 1857; x_wconf 89' lang='eng'>1001110010001000000000000100111111100010010010101</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_8' title="bbox 354 1883 1365 2276">
<span class='ocr_line' id='line_1_30' title="bbox 416 1883 1365 1927; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 11"><span class='ocrx_word' id='word_1_126' title='bbox 416 1894 700 1915; x_wconf 90' lang='eng'>0101000010000</span> <span class='ocrx_word' id='word_1_127' title='bbox 723 1883 905 1927; x_wconf 87' lang='eng' dir='ltr'>K-(coding</span> <span class='ocrx_word' id='word_1_128' title='bbox 923 1885 976 1915; x_wconf 90' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_129' title='bbox 994 1883 1253 1927; x_wconf 93' lang='eng' dir='ltr'>cyber)p0sitive</span> <span class='ocrx_word' id='word_1_130' title='bbox 1272 1895 1365 1925; x_wconf 94' lang='eng' dir='ltr'>proc-</span>
</span>
<span class='ocr_line' id='line_1_31' title="bbox 354 1942 1365 1983; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_131' title='bbox 354 1952 438 1972; x_wconf 95' lang='eng' dir='ltr'>esses</span> <span class='ocrx_word' id='word_1_132' title='bbox 454 1942 700 1983; x_wconf 91' lang='eng' dir='ltr'>auto-intensify</span> <span class='ocrx_word' id='word_1_133' title='bbox 714 1942 759 1983; x_wconf 98' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_134' title='bbox 772 1942 959 1983; x_wconf 91' lang='eng' dir='ltr'>occurring.</span> <span class='ocrx_word' id='word_1_135' title='bbox 974 1943 1004 1972; x_wconf 93' lang='eng' dir='ltr'><strong>A</strong></span> <span class='ocrx_word' id='word_1_136' title='bbox 1017 1942 1157 1972; x_wconf 96' lang='eng' dir='ltr'>cultural</span> <span class='ocrx_word' id='word_1_137' title='bbox 1172 1942 1324 1982; x_wconf 89' lang='eng' dir='ltr'>example</span> <span class='ocrx_word' id='word_1_138' title='bbox 1339 1942 1365 1972; x_wconf 99' lang='eng' dir='ltr'>is</span>
</span>
<span class='ocr_line' id='line_1_32' title="bbox 355 2001 1365 2042; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_139' title='bbox 355 2001 451 2042; x_wconf 89' lang='eng' dir='ltr'>hype:</span> <span class='ocrx_word' id='word_1_140' title='bbox 464 2001 621 2042; x_wconf 91' lang='eng' dir='ltr'>products</span> <span class='ocrx_word' id='word_1_141' title='bbox 635 2001 704 2031; x_wconf 96' lang='eng' dir='ltr'>that</span> <span class='ocrx_word' id='word_1_142' title='bbox 714 2002 771 2031; x_wconf 89' lang='eng' dir='ltr'>AT</span> <span class='ocrx_word' id='word_1_143' title='bbox 780 2002 837 2031; x_wconf 89' lang='eng' dir='ltr'>AT</span> <span class='ocrx_word' id='word_1_144' title='bbox 849 2001 942 2031; x_wconf 95' lang='eng' dir='ltr'>trade</span> <span class='ocrx_word' id='word_1_145' title='bbox 953 2011 999 2031; x_wconf 98' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_146' title='bbox 1012 2001 1100 2031; x_wconf 92' lang='eng' dir='ltr'>what</span> <span class='ocrx_word' id='word_1_147' title='bbox 1112 2001 1188 2042; x_wconf 97' lang='eng' dir='ltr'>they</span> <span class='ocrx_word' id='word_1_148' title='bbox 1199 2001 1263 2031; x_wconf 98' lang='eng' dir='ltr'>will</span> <span class='ocrx_word' id='word_1_149' title='bbox 1277 2001 1319 2031; x_wconf 98' lang='eng' dir='ltr'>be</span> <span class='ocrx_word' id='word_1_150' title='bbox 1331 2001 1365 2031; x_wconf 98' lang='eng' dir='ltr'>in</span>
</span>
<span class='ocr_line' id='line_1_33' title="bbox 355 2059 1365 2096; baseline 0 -7; x_size 37; x_descenders 7; x_ascenders 10"><span class='ocrx_word' id='word_1_151' title='bbox 355 2059 408 2089; x_wconf 98' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_152' title='bbox 421 2059 538 2096; x_wconf 87' lang='eng' dir='ltr'>future,</span> <span class='ocrx_word' id='word_1_153' title='bbox 550 2059 600 2089; x_wconf 94' lang='eng' dir='ltr'>vir</span> <span class='ocrx_word' id='word_1_154' title='bbox 608 2059 729 2089; x_wconf 93' lang='eng' dir='ltr'>virtual</span> <span class='ocrx_word' id='word_1_155' title='bbox 741 2059 875 2089; x_wconf 90' lang='eng' dir='ltr'>fashion</span> <span class='ocrx_word' id='word_1_156' title='bbox 888 2069 933 2089; x_wconf 98' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_157' title='bbox 945 2059 1002 2096; x_wconf 84' lang='eng' dir='ltr'>off,</span> <span class='ocrx_word' id='word_1_158' title='bbox 1016 2059 1190 2089; x_wconf 92' lang='eng' dir='ltr'>imminent</span> <span class='ocrx_word' id='word_1_159' title='bbox 1204 2059 1365 2090; x_wconf 91' lang='eng' dir='ltr'>technical</span>
</span>
<span class='ocr_line' id='line_1_34' title="bbox 355 2117 1364 2158; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_160' title='bbox 355 2117 535 2154; x_wconf 89' lang='eng' dir='ltr'>standards,</span> <span class='ocrx_word' id='word_1_161' title='bbox 545 2117 776 2158; x_wconf 92' lang='eng' dir='ltr'>self-fulfilling</span> <span class='ocrx_word' id='word_1_162' title='bbox 784 2117 982 2157; x_wconf 94' lang='eng' dir='ltr'>prophecies</span> <span class='ocrx_word' id='word_1_163' title='bbox 993 2117 1060 2147; x_wconf 95' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_164' title='bbox 1069 2117 1136 2147; x_wconf 93' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_165' title='bbox 1145 2127 1183 2147; x_wconf 98' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_166' title='bbox 1192 2117 1257 2147; x_wconf 95' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_167' title='bbox 1268 2117 1364 2147; x_wconf 92' lang='eng' dir='ltr'>artifi-</span>
</span>
<span class='ocr_line' id='line_1_35' title="bbox 354 2176 1365 2217; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_168' title='bbox 354 2176 413 2207; x_wconf 91' lang='eng' dir='ltr'>cial</span> <span class='ocrx_word' id='word_1_169' title='bbox 422 2176 582 2206; x_wconf 88' lang='eng' dir='ltr'>destinies.</span> <span class='ocrx_word' id='word_1_170' title='bbox 592 2176 818 2217; x_wconf 93' lang='eng' dir='ltr'>Anticipating</span> <span class='ocrx_word' id='word_1_171' title='bbox 826 2186 844 2206; x_wconf 99' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_172' title='bbox 856 2176 949 2206; x_wconf 95' lang='eng' dir='ltr'>trend</span> <span class='ocrx_word' id='word_1_173' title='bbox 958 2176 1024 2206; x_wconf 95' lang='eng' dir='ltr'>end</span> <span class='ocrx_word' id='word_1_174' title='bbox 1034 2176 1099 2206; x_wconf 93' lang='eng' dir='ltr'>end</span> <span class='ocrx_word' id='word_1_175' title='bbox 1107 2176 1173 2206; x_wconf 95' lang='eng' dir='ltr'>end</span> <span class='ocrx_word' id='word_1_176' title='bbox 1179 2176 1270 2206; x_wconf 99' lang='eng' dir='ltr'>ACC</span> <span class='ocrx_word' id='word_1_177' title='bbox 1277 2176 1365 2206; x_wconf 99' lang='eng' dir='ltr'>ACC</span>
</span>
<span class='ocr_line' id='line_1_36' title="bbox 355 2232 1328 2276; baseline 0 -12; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_178' title='bbox 355 2234 544 2265; x_wconf 91' lang='eng' dir='ltr'>accelerates</span> <span class='ocrx_word' id='word_1_179' title='bbox 556 2234 579 2264; x_wconf 91' lang='eng' dir='ltr'>it</span> <span class='ocrx_word' id='word_1_180' title='bbox 595 2233 718 2276; x_wconf 85' lang='eng' dir='ltr'>(which</span> <span class='ocrx_word' id='word_1_181' title='bbox 732 2234 756 2264; x_wconf 98' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_182' title='bbox 770 2234 804 2264; x_wconf 98' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_183' title='bbox 818 2234 910 2264; x_wconf 82' lang='eng' dir='ltr'>itself</span> <span class='ocrx_word' id='word_1_184' title='bbox 918 2244 936 2264; x_wconf 99' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_185' title='bbox 951 2244 983 2264; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_186' title='bbox 997 2244 1030 2264; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_187' title='bbox 1044 2234 1204 2264; x_wconf 89' lang='eng' dir='ltr'>recursive</span> <span class='ocrx_word' id='word_1_188' title='bbox 1218 2232 1328 2276; x_wconf 91' lang='eng' dir='ltr'>trend)</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_9' title="bbox 355 2293 1367 2451">
<span class='ocr_line' id='line_1_37' title="bbox 416 2293 1365 2334; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_189' title='bbox 416 2293 554 2334; x_wconf 94' lang='eng' dir='ltr'>Hyping</span> <span class='ocrx_word' id='word_1_190' title='bbox 569 2293 731 2333; x_wconf 94' lang='eng' dir='ltr'>collapses</span> <span class='ocrx_word' id='word_1_191' title='bbox 751 2302 786 2323; x_wconf 87' lang='eng' dir='ltr'>SF</span> <span class='ocrx_word' id='word_1_192' title='bbox 808 2293 878 2323; x_wconf 98' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_193' title='bbox 898 2293 1010 2323; x_wconf 95' lang='eng' dir='ltr'>CATA</span> <span class='ocrx_word' id='word_1_194' title='bbox 1027 2293 1137 2323; x_wconf 95' lang='eng' dir='ltr'>CATA</span> <span class='ocrx_word' id='word_1_195' title='bbox 1154 2293 1305 2334; x_wconf 97' lang='eng' dir='ltr'>catalytic</span> <span class='ocrx_word' id='word_1_196' title='bbox 1324 2293 1365 2323; x_wconf 99' lang='eng' dir='ltr'>tic</span>
</span>
5 years ago
<span class='ocr_line' id='line_1_38' title="bbox 355 2351 1367 2392; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_197' title='bbox 355 2351 524 2392; x_wconf 84' lang='eng' dir='ltr'>efficiency,</span> <span class='ocrx_word' id='word_1_198' title='bbox 534 2351 713 2392; x_wconf 93' lang='eng' dir='ltr'>re-routing</span> <span class='ocrx_word' id='word_1_199' title='bbox 723 2357 903 2381; x_wconf 98' lang='eng' dir='ltr'>tomorrow</span> <span class='ocrx_word' id='word_1_200' title='bbox 912 2351 1057 2392; x_wconf 96' lang='eng' dir='ltr'>through</span> <span class='ocrx_word' id='word_1_201' title='bbox 1065 2351 1153 2381; x_wconf 98' lang='eng' dir='ltr'>what</span> <span class='ocrx_word' id='word_1_202' title='bbox 1162 2351 1202 2381; x_wconf 98' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_203' title='bbox 1211 2357 1367 2391; x_wconf 94' lang='eng' dir='ltr'>prospect</span>
5 years ago
</span>
<span class='ocr_line' id='line_1_39' title="bbox 356 2410 793 2451; baseline -0.002 -10; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_204' title='bbox 356 2411 412 2441; x_wconf 89' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_205' title='bbox 422 2410 482 2440; x_wconf 89' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_206' title='bbox 491 2410 551 2440; x_wconf 89' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_207' title='bbox 559 2410 673 2440; x_wconf 88' lang='eng' dir='ltr'>makes</span> <span class='ocrx_word' id='word_1_208' title='bbox 686 2410 793 2451; x_wconf 88' lang='eng' dir='ltr'>today.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_10' title="bbox 414 2468 1363 2509">
<span class='ocr_line' id='line_1_40' title="bbox 414 2468 1363 2509; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_209' title='bbox 414 2468 617 2509; x_wconf 93' lang='eng' dir='ltr'>Virohyping</span> <span class='ocrx_word' id='word_1_210' title='bbox 628 2478 754 2508; x_wconf 94' lang='eng' dir='ltr'>sweeps</span> <span class='ocrx_word' id='word_1_211' title='bbox 766 2468 913 2509; x_wconf 96' lang='eng' dir='ltr'>through</span> <span class='ocrx_word' id='word_1_212' title='bbox 927 2468 983 2498; x_wconf 98' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_213' title='bbox 995 2468 1197 2509; x_wconf 94' lang='eng' dir='ltr'>advertising</span> <span class='ocrx_word' id='word_1_214' title='bbox 1208 2468 1363 2509; x_wconf 95' lang='eng' dir='ltr'>industry.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_11' title="bbox 418 2526 883 2567">
<span class='ocr_line' id='line_1_41' title="bbox 418 2526 883 2567; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_215' title='bbox 418 2527 582 2567; x_wconf 90' lang='eng' dir='ltr'>Everyone</span> <span class='ocrx_word' id='word_1_216' title='bbox 596 2526 660 2556; x_wconf 95' lang='eng' dir='ltr'>will</span> <span class='ocrx_word' id='word_1_217' title='bbox 674 2526 716 2556; x_wconf 98' lang='eng' dir='ltr'>be</span> <span class='ocrx_word' id='word_1_218' title='bbox 729 2526 836 2567; x_wconf 95' lang='eng' dir='ltr'>doing</span> <span class='ocrx_word' id='word_1_219' title='bbox 848 2526 883 2556; x_wconf 98' lang='eng' dir='ltr'>it.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_12' title="bbox 355 2585 1369 3154">
<span class='ocr_line' id='line_1_42' title="bbox 414 2585 1367 2626; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_220' title='bbox 414 2585 508 2615; x_wconf 93' lang='eng' dir='ltr'>Virus</span> <span class='ocrx_word' id='word_1_221' title='bbox 524 2585 551 2615; x_wconf 99' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_222' title='bbox 566 2585 719 2625; x_wconf 94' lang='eng' dir='ltr'>parasitic</span> <span class='ocrx_word' id='word_1_223' title='bbox 737 2585 780 2615; x_wconf 98' lang='eng' dir='ltr'>tic</span> <span class='ocrx_word' id='word_1_224' title='bbox 797 2585 976 2625; x_wconf 94' lang='eng' dir='ltr'>replicator</span> <span class='ocrx_word' id='word_1_225' title='bbox 991 2585 1087 2615; x_wconf 90' lang='eng' dir='ltr'>code:</span> <span class='ocrx_word' id='word_1_226' title='bbox 1105 2595 1147 2615; x_wconf 99' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_227' title='bbox 1165 2585 1367 2626; x_wconf 94' lang='eng' dir='ltr'>asignifying</span>
</span>
5 years ago
<span class='ocr_line' id='line_1_43' title="bbox 356 2643 1365 2683; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_228' title='bbox 356 2653 515 2683; x_wconf 93' lang='eng' dir='ltr'>sequence</span> <span class='ocrx_word' id='word_1_229' title='bbox 529 2643 567 2673; x_wconf 94' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_230' title='bbox 578 2643 741 2673; x_wconf 98' lang='eng' dir='ltr'>machinic</span> <span class='ocrx_word' id='word_1_231' title='bbox 757 2643 833 2673; x_wconf 95' lang='eng' dir='ltr'>data</span> <span class='ocrx_word' id='word_1_232' title='bbox 846 2643 930 2673; x_wconf 91' lang='eng' dir='ltr'>ATA</span> <span class='ocrx_word' id='word_1_233' title='bbox 941 2644 1025 2673; x_wconf 95' lang='eng' dir='ltr'>ATA</span> <span class='ocrx_word' id='word_1_234' title='bbox 1040 2643 1229 2673; x_wconf 91' lang='eng' dir='ltr'>flow-break</span> <span class='ocrx_word' id='word_1_235' title='bbox 1243 2643 1365 2681; x_wconf 86' lang='eng' dir='ltr'>on/off,</span>
5 years ago
</span>
<span class='ocr_line' id='line_1_44' title="bbox 356 2703 1369 2744; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_236' title='bbox 356 2703 419 2741; x_wconf 94' lang='eng'>1/0,</span> <span class='ocrx_word' id='word_1_237' title='bbox 434 2703 594 2744; x_wconf 96' lang='eng' dir='ltr'>yang/yin</span> <span class='ocrx_word' id='word_1_238' title='bbox 609 2703 824 2744; x_wconf 93' lang='eng' dir='ltr'>intrinsically</span> <span class='ocrx_word' id='word_1_239' title='bbox 838 2703 994 2733; x_wconf 95' lang='eng' dir='ltr'>destined</span> <span class='ocrx_word' id='word_1_240' title='bbox 1010 2703 1062 2733; x_wconf 94' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_241' title='bbox 1076 2713 1148 2733; x_wconf 98' lang='eng' dir='ltr'>war.</span> <span class='ocrx_word' id='word_1_242' title='bbox 1167 2704 1206 2733; x_wconf 93' lang='eng' dir='ltr'>In</span> <span class='ocrx_word' id='word_1_243' title='bbox 1220 2703 1314 2743; x_wconf 94' lang='eng' dir='ltr'>place</span> <span class='ocrx_word' id='word_1_244' title='bbox 1330 2703 1369 2733; x_wconf 94' lang='eng' dir='ltr'>of</span>
</span>
<span class='ocr_line' id='line_1_45' title="bbox 355 2761 1365 2802; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_245' title='bbox 355 2771 441 2791; x_wconf 92' lang='eng' dir='ltr'>mess</span> <span class='ocrx_word' id='word_1_246' title='bbox 456 2767 752 2802; x_wconf 94' lang='eng' dir='ltr'>message-content</span> <span class='ocrx_word' id='word_1_247' title='bbox 768 2761 919 2791; x_wconf 93' lang='eng' dir='ltr'>virodata</span> <span class='ocrx_word' id='word_1_248' title='bbox 937 2761 963 2791; x_wconf 99' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_249' title='bbox 981 2761 1167 2791; x_wconf 95' lang='eng' dir='ltr'>assembled</span> <span class='ocrx_word' id='word_1_250' title='bbox 1182 2761 1263 2791; x_wconf 95' lang='eng' dir='ltr'>bled</span> <span class='ocrx_word' id='word_1_251' title='bbox 1279 2761 1365 2791; x_wconf 94' lang='eng' dir='ltr'>from</span>
</span>
<span class='ocr_line' id='line_1_46' title="bbox 357 2818 1366 2862; baseline 0 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_252' title='bbox 357 2818 552 2861; x_wconf 88' lang='eng' dir='ltr'>asignifying</span> <span class='ocrx_word' id='word_1_253' title='bbox 564 2820 727 2850; x_wconf 95' lang='eng' dir='ltr'>materials</span> <span class='ocrx_word' id='word_1_254' title='bbox 743 2820 818 2850; x_wconf 99' lang='eng' dir='ltr'>with</span> <span class='ocrx_word' id='word_1_255' title='bbox 834 2820 947 2851; x_wconf 91' lang='eng' dir='ltr'>CATA</span> <span class='ocrx_word' id='word_1_256' title='bbox 960 2820 1110 2861; x_wconf 91' lang='eng' dir='ltr'>catalytic</span> <span class='ocrx_word' id='word_1_257' title='bbox 1127 2818 1176 2862; x_wconf 93' lang='eng' dir='ltr'>(or</span> <span class='ocrx_word' id='word_1_258' title='bbox 1190 2820 1366 2861; x_wconf 93' lang='eng' dir='ltr'>positively</span>
</span>
<span class='ocr_line' id='line_1_47' title="bbox 358 2876 1368 2920; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_259' title='bbox 358 2876 671 2920; x_wconf 90' lang='eng' dir='ltr'>disproportionate)</span> <span class='ocrx_word' id='word_1_260' title='bbox 682 2878 856 2918; x_wconf 84' lang='eng' dir='ltr'>efficiency:</span> <span class='ocrx_word' id='word_1_261' title='bbox 867 2878 1012 2908; x_wconf 91' lang='eng' dir='ltr'>intruder</span> <span class='ocrx_word' id='word_1_262' title='bbox 1019 2878 1187 2918; x_wconf 93' lang='eng' dir='ltr'>passcode,</span> <span class='ocrx_word' id='word_1_263' title='bbox 1197 2878 1368 2908; x_wconf 92' lang='eng' dir='ltr'>locational</span>
</span>
<span class='ocr_line' id='line_1_48' title="bbox 359 2936 1367 2977; baseline 0 -11; x_size 37; x_descenders 7; x_ascenders 10"><span class='ocrx_word' id='word_1_264' title='bbox 359 2936 520 2973; x_wconf 83' lang='eng' dir='ltr'>ZIP-code,</span> <span class='ocrx_word' id='word_1_265' title='bbox 534 2936 824 2977; x_wconf 91' lang='eng' dir='ltr'>pseudogenomic</span> <span class='ocrx_word' id='word_1_266' title='bbox 838 2936 1016 2966; x_wconf 94' lang='eng' dir='ltr'>substitute</span> <span class='ocrx_word' id='word_1_267' title='bbox 1030 2936 1251 2973; x_wconf 86' lang='eng' dir='ltr'>instructions,</span> <span class='ocrx_word' id='word_1_268' title='bbox 1267 2942 1367 2966; x_wconf 92' lang='eng' dir='ltr'>muta-</span>
</span>
<span class='ocr_line' id='line_1_49' title="bbox 359 2993 1367 3038; baseline 0.003 -13; x_size 43; x_descenders 11; x_ascenders 12"><span class='ocrx_word' id='word_1_269' title='bbox 359 2995 462 3030; x_wconf 85' lang='eng' dir='ltr'>tional</span> <span class='ocrx_word' id='word_1_270' title='bbox 469 2995 557 3036; x_wconf 86' lang='eng' dir='ltr'>junk</span> <span class='ocrx_word' id='word_1_271' title='bbox 570 2993 743 3038; x_wconf 90' lang='eng' dir='ltr'>(complex</span> <span class='ocrx_word' id='word_1_272' title='bbox 754 2995 815 3025; x_wconf 94' lang='eng' dir='ltr'>but</span> <span class='ocrx_word' id='word_1_273' title='bbox 828 2995 931 3025; x_wconf 92' lang='eng' dir='ltr'>latent</span> <span class='ocrx_word' id='word_1_274' title='bbox 943 2993 1134 3037; x_wconf 86' lang='eng' dir='ltr'>segments),</span> <span class='ocrx_word' id='word_1_275' title='bbox 1148 2995 1214 3025; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_276' title='bbox 1225 2997 1367 3038; x_wconf 91' lang='eng' dir='ltr'>garbage</span>
</span>
<span class='ocr_line' id='line_1_50' title="bbox 359 3051 1367 3096; baseline 0 -13; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_277' title='bbox 359 3051 572 3096; x_wconf 91' lang='eng' dir='ltr'>(redundant</span> <span class='ocrx_word' id='word_1_278' title='bbox 591 3063 1367 3093; x_wconf 89' lang='eng' dir='ltr'>scrapcrapcrapcrapcrapcrapcrapcrapcrap-</span>
</span>
<span class='ocr_line' id='line_1_51' title="bbox 358 3110 708 3154; baseline 0 -12; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_279' title='bbox 358 3110 708 3154; x_wconf 92' lang='eng' dir='ltr'>crapcrapcrapcrap).</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_13' title="bbox 357 3171 1368 3563">
<span class='ocr_line' id='line_1_52' title="bbox 423 3171 1368 3212; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_280' title='bbox 423 3171 572 3201; x_wconf 94' lang='eng' dir='ltr'>Biovirus</span> <span class='ocrx_word' id='word_1_281' title='bbox 586 3171 646 3201; x_wconf 90' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_282' title='bbox 655 3171 716 3201; x_wconf 92' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_283' title='bbox 724 3171 785 3201; x_wconf 92' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_284' title='bbox 799 3177 918 3212; x_wconf 94' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_285' title='bbox 935 3171 1126 3212; x_wconf 86' lang='eng' dir='ltr'>organisms,</span> <span class='ocrx_word' id='word_1_286' title='bbox 1145 3171 1287 3212; x_wconf 85' lang='eng' dir='ltr'>hacking</span> <span class='ocrx_word' id='word_1_287' title='bbox 1299 3171 1368 3201; x_wconf 92' lang='eng' dir='ltr'>and</span>
</span>
<span class='ocr_line' id='line_1_53' title="bbox 358 3229 1368 3270; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_288' title='bbox 358 3229 641 3270; x_wconf 92' lang='eng' dir='ltr'>reprogramming</span> <span class='ocrx_word' id='word_1_289' title='bbox 647 3229 1368 3259; x_wconf 71' lang='eng' dir='ltr'>ATGAC&#39;ITATCCACGGTACATTCAGT</span>
</span>
<span class='ocr_line' id='line_1_54' title="bbox 358 3287 1366 3327; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_290' title='bbox 358 3287 492 3317; x_wconf 94' lang='eng' dir='ltr'>cellular</span> <span class='ocrx_word' id='word_1_291' title='bbox 502 3296 578 3317; x_wconf 89' lang='eng' dir='ltr'>DNA</span> <span class='ocrx_word' id='word_1_292' title='bbox 592 3293 624 3317; x_wconf 99' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_293' title='bbox 634 3287 784 3327; x_wconf 92' lang='eng' dir='ltr'>produce</span> <span class='ocrx_word' id='word_1_294' title='bbox 795 3297 887 3317; x_wconf 94' lang='eng' dir='ltr'>more</span> <span class='ocrx_word' id='word_1_295' title='bbox 896 3287 984 3317; x_wconf 93' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_296' title='bbox 994 3287 1079 3317; x_wconf 94' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_297' title='bbox 1089 3287 1176 3317; x_wconf 94' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_298' title='bbox 1185 3287 1271 3317; x_wconf 95' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_299' title='bbox 1280 3287 1366 3317; x_wconf 94' lang='eng' dir='ltr'>virus</span>
</span>
<span class='ocr_line' id='line_1_55' title="bbox 358 3345 1365 3385; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_300' title='bbox 358 3345 445 3375; x_wconf 93' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_301' title='bbox 459 3345 547 3375; x_wconf 93' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_302' title='bbox 563 3345 660 3375; x_wconf 92' lang='eng' dir='ltr'>virus.</span> <span class='ocrx_word' id='word_1_303' title='bbox 680 3346 726 3375; x_wconf 95' lang='eng' dir='ltr'>Its</span> <span class='ocrx_word' id='word_1_304' title='bbox 740 3345 889 3385; x_wconf 92' lang='eng' dir='ltr'>enzymic</span> <span class='ocrx_word' id='word_1_305' title='bbox 905 3345 1127 3385; x_wconf 91' lang='eng' dir='ltr'>cut-and-past</span> <span class='ocrx_word' id='word_1_306' title='bbox 1141 3345 1365 3375; x_wconf 91' lang='eng' dir='ltr'>recombinant</span>
</span>
<span class='ocr_line' id='line_1_56' title="bbox 357 3404 1365 3445; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_307' title='bbox 357 3404 678 3445; x_wconf 92' lang='eng' dir='ltr'>wetware-splicing</span> <span class='ocrx_word' id='word_1_308' title='bbox 699 3414 829 3434; x_wconf 94' lang='eng' dir='ltr'>crosses</span> <span class='ocrx_word' id='word_1_309' title='bbox 852 3404 1054 3445; x_wconf 91' lang='eng' dir='ltr'>singularity</span> <span class='ocrx_word' id='word_1_310' title='bbox 1074 3404 1173 3434; x_wconf 92' lang='eng' dir='ltr'>when</span> <span class='ocrx_word' id='word_1_311' title='bbox 1195 3404 1365 3434; x_wconf 94' lang='eng' dir='ltr'>retroviral</span>
</span>
<span class='ocr_line' id='line_1_57' title="bbox 358 3460 1364 3505; baseline 0 -13; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_312' title='bbox 358 3462 723 3502; x_wconf 91' lang='eng' dir='ltr'>reverse-transcriptase</span> <span class='ocrx_word' id='word_1_313' title='bbox 733 3462 832 3492; x_wconf 92' lang='eng' dir='ltr'>clicks</span> <span class='ocrx_word' id='word_1_314' title='bbox 841 3462 876 3492; x_wconf 91' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_315' title='bbox 887 3460 1057 3505; x_wconf 91' lang='eng' dir='ltr'>(enabling</span> <span class='ocrx_word' id='word_1_316' title='bbox 1065 3462 1271 3503; x_wconf 91' lang='eng' dir='ltr'>ontogenetic</span> <span class='ocrx_word' id='word_1_317' title='bbox 1281 3471 1364 3492; x_wconf 91' lang='eng' dir='ltr'>DNA-</span>
</span>
<span class='ocr_line' id='line_1_58' title="bbox 360 3519 1187 3563; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_318' title='bbox 360 3530 433 3551; x_wconf 90' lang='eng' dir='ltr'>RNA</span> <span class='ocrx_word' id='word_1_319' title='bbox 446 3521 599 3561; x_wconf 92' lang='eng' dir='ltr'>circuitry</span> <span class='ocrx_word' id='word_1_320' title='bbox 611 3521 680 3551; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_321' title='bbox 692 3521 920 3551; x_wconf 91' lang='eng' dir='ltr'>endocellular</span> <span class='ocrx_word' id='word_1_322' title='bbox 932 3519 1187 3563; x_wconf 91' lang='eng' dir='ltr'>computation).</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_14' title="bbox 357 3579 1364 3901">
<span class='ocr_line' id='line_1_59' title="bbox 419 3579 1364 3609; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_323' title='bbox 419 3579 1364 3609; x_wconf 92' lang='eng' dir='ltr'>ATAGGTCATGAATCTACCGATTGCAGCTGC</span>
</span>
<span class='ocr_line' id='line_1_60' title="bbox 357 3637 1363 3667; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_324' title='bbox 357 3637 1363 3667; x_wconf 90' lang='eng' dir='ltr'>TATTCCTCGATGATCGCATGGGCTGTGATG</span>
</span>
5 years ago
<span class='ocr_line' id='line_1_61' title="bbox 358 3696 1363 3726; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_325' title='bbox 358 3696 1363 3726; x_wconf 77' lang='eng' dir='ltr'>GCATCGTATCCGATCGATTCGAGCGATTGCAGC</span>
5 years ago
</span>
<span class='ocr_line' id='line_1_62' title="bbox 357 3754 1362 3784; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_326' title='bbox 357 3754 1362 3784; x_wconf 75' lang='eng' dir='ltr'>TACGCTATTCCTCCGAGGGATTGCAGCTACGTC</span>
</span>
<span class='ocr_line' id='line_1_63' title="bbox 358 3812 1363 3843; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_327' title='bbox 358 3812 1363 3843; x_wconf 91' lang='eng' dir='ltr'>GCATCGGGCTCAGATGTAGGTCATGAATCTACC</span>
</span>
<span class='ocr_line' id='line_1_64' title="bbox 359 3871 1327 3901; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_328' title='bbox 359 3871 747 3901; x_wconf 79' lang='eng' dir='ltr'>GATTGCATGACTT</span> <span class='ocrx_word' id='word_1_329' title='bbox 743 3871 1298 3901; x_wconf 79' lang='eng' dir='ltr'>ATCCACGGTACAITCGACT</span> <span class='ocrx_word' id='word_1_330' title='bbox 1299 3871 1327 3901; x_wconf 96' lang='eng' dir='ltr'>C</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_15' title="bbox 358 3929 1372 4539">
<span class='ocr_line' id='line_1_65' title="bbox 423 3929 1362 3970; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_331' title='bbox 423 3929 623 3959; x_wconf 90' lang='eng' dir='ltr'>Ethnovirus</span> <span class='ocrx_word' id='word_1_332' title='bbox 639 3935 759 3970; x_wconf 93' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_333' title='bbox 774 3929 884 3959; x_wconf 92' lang='eng' dir='ltr'>brains</span> <span class='ocrx_word' id='word_1_334' title='bbox 897 3929 1117 3959; x_wconf 92' lang='eng' dir='ltr'>Technovirus</span> <span class='ocrx_word' id='word_1_335' title='bbox 1132 3935 1248 3970; x_wconf 92' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_336' title='bbox 1262 3929 1362 3959; x_wconf 94' lang='eng' dir='ltr'>socio-</span>
</span>
<span class='ocr_line' id='line_1_66' title="bbox 358 3988 1361 4028; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_337' title='bbox 358 3988 531 4018; x_wconf 92' lang='eng' dir='ltr'>economic</span> <span class='ocrx_word' id='word_1_338' title='bbox 549 3998 611 4028; x_wconf 93' lang='eng' dir='ltr'>pro</span> <span class='ocrx_word' id='word_1_339' title='bbox 628 3998 690 4028; x_wconf 93' lang='eng' dir='ltr'>pro</span> <span class='ocrx_word' id='word_1_340' title='bbox 707 3988 912 4028; x_wconf 91' lang='eng' dir='ltr'>production</span> <span class='ocrx_word' id='word_1_341' title='bbox 929 3998 990 4028; x_wconf 93' lang='eng' dir='ltr'>pro</span> <span class='ocrx_word' id='word_1_342' title='bbox 1007 3998 1182 4028; x_wconf 92' lang='eng' dir='ltr'>processes.</span> <span class='ocrx_word' id='word_1_343' title='bbox 1202 3988 1361 4018; x_wconf 91' lang='eng' dir='ltr'>Infovirus</span>
</span>
<span class='ocr_line' id='line_1_67' title="bbox 360 4046 1361 4087; baseline -0.001 -11; x_size 41; x_descenders 11; x_ascenders 9"><span class='ocrx_word' id='word_1_344' title='bbox 360 4052 474 4087; x_wconf 90' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_345' title='bbox 484 4046 597 4087; x_wconf 91' lang='eng' dir='ltr'>digital</span> <span class='ocrx_word' id='word_1_346' title='bbox 606 4054 1361 4076; x_wconf 94' lang='eng'>010010010001011110100001001101010101010</span>
</span>
<span class='ocr_line' id='line_1_68' title="bbox 360 4111 1360 4145; baseline 0 -10; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_347' title='bbox 360 4111 1360 4145; x_wconf 91' lang='eng' dir='ltr'>10001001101010010010100computers100101001011010010</span>
</span>
<span class='ocr_line' id='line_1_69' title="bbox 360 4171 1360 4192; baseline 0.001 -1; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_348' title='bbox 360 4171 1360 4192; x_wconf 89' lang='eng'>101111010001010101010101010010101001010110101001</span>
</span>
<span class='ocr_line' id='line_1_70' title="bbox 358 4228 1359 4250; baseline -0.001 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_349' title='bbox 358 4228 1359 4250; x_wconf 94' lang='eng'>000000100010111010100100101010010100100101010101</span>
</span>
<span class='ocr_line' id='line_1_71' title="bbox 359 4286 1358 4308; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_350' title='bbox 359 4286 1358 4308; x_wconf 91' lang='eng'>00100010010010010010010010100100101011010100100</span>
</span>
<span class='ocr_line' id='line_1_72' title="bbox 360 4344 1358 4366; baseline 0.001 -1; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_351' title='bbox 360 4344 1358 4366; x_wconf 94' lang='eng'>10010101101010101010111101000010011010101010101000</span>
</span>
<span class='ocr_line' id='line_1_73' title="bbox 361 4403 1359 4425; baseline 0.001 -1; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_352' title='bbox 361 4403 1359 4425; x_wconf 91' lang='eng'>1001101101010101001100100010001010101110100001010</span>
</span>
<span class='ocr_line' id='line_1_74' title="bbox 360 4461 1372 4482; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_353' title='bbox 360 4461 1372 4482; x_wconf 96' lang='eng'>110010100101000110010011100100010000000001001111</span>
</span>
<span class='ocr_line' id='line_1_75' title="bbox 360 4517 680 4539; baseline -0.003 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_354' title='bbox 360 4517 680 4539; x_wconf 94' lang='eng'>1100010010010101</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_16' title="bbox 360 4568 1375 5015">
<span class='ocr_line' id='line_1_76' title="bbox 425 4568 1372 4609; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_355' title='bbox 425 4568 626 4608; x_wconf 92' lang='eng' dir='ltr'>Hypervirus</span> <span class='ocrx_word' id='word_1_356' title='bbox 639 4574 759 4609; x_wconf 94' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_357' title='bbox 770 4568 957 4609; x_wconf 91' lang='eng' dir='ltr'>intelligent</span> <span class='ocrx_word' id='word_1_358' title='bbox 968 4568 1264 4608; x_wconf 91' lang='eng' dir='ltr'>immunosecurity</span> <span class='ocrx_word' id='word_1_359' title='bbox 1274 4574 1372 4598; x_wconf 94' lang='eng' dir='ltr'>struc-</span>
</span>
<span class='ocr_line' id='line_1_77' title="bbox 361 4626 1372 4667; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_360' title='bbox 361 4633 458 4656; x_wconf 89' lang='eng' dir='ltr'>tures:</span> <span class='ocrx_word' id='word_1_361' title='bbox 470 4636 525 4666; x_wconf 91' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_362' title='bbox 535 4636 589 4666; x_wconf 92' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_363' title='bbox 601 4636 646 4656; x_wconf 92' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_364' title='bbox 656 4636 712 4666; x_wconf 91' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_365' title='bbox 724 4636 769 4656; x_wconf 92' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_366' title='bbox 782 4626 1003 4666; x_wconf 91' lang='eng' dir='ltr'>nomadically</span> <span class='ocrx_word' id='word_1_367' title='bbox 1015 4626 1219 4667; x_wconf 91' lang='eng' dir='ltr'>abstracting</span> <span class='ocrx_word' id='word_1_368' title='bbox 1229 4626 1269 4656; x_wconf 94' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_369' title='bbox 1280 4636 1372 4666; x_wconf 93' lang='eng' dir='ltr'>proc-</span>
</span>
<span class='ocr_line' id='line_1_78' title="bbox 362 4682 1372 4726; baseline 0 -12; x_size 37; x_descenders 7; x_ascenders 10"><span class='ocrx_word' id='word_1_370' title='bbox 362 4694 444 4714; x_wconf 94' lang='eng' dir='ltr'>esses</span> <span class='ocrx_word' id='word_1_371' title='bbox 457 4684 540 4714; x_wconf 90' lang='eng' dir='ltr'>from</span> <span class='ocrx_word' id='word_1_372' title='bbox 552 4684 681 4724; x_wconf 88' lang='eng' dir='ltr'>specific</span> <span class='ocrx_word' id='word_1_373' title='bbox 694 4684 803 4714; x_wconf 95' lang='eng' dir='ltr'>media</span> <span class='ocrx_word' id='word_1_374' title='bbox 816 4682 918 4726; x_wconf 88' lang='eng' dir='ltr'>(DNA,</span> <span class='ocrx_word' id='word_1_375' title='bbox 928 4684 1050 4721; x_wconf 94' lang='eng' dir='ltr'>words,</span> <span class='ocrx_word' id='word_1_376' title='bbox 1061 4684 1222 4724; x_wconf 91' lang='eng' dir='ltr'>symbolic</span> <span class='ocrx_word' id='word_1_377' title='bbox 1232 4684 1372 4721; x_wconf 94' lang='eng' dir='ltr'>models,</span>
</span>
<span class='ocr_line' id='line_1_79' title="bbox 361 4741 1373 4784; baseline 0 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_378' title='bbox 361 4741 632 4784; x_wconf 91' lang='eng' dir='ltr'>bit-sequences),</span> <span class='ocrx_word' id='word_1_379' title='bbox 653 4742 722 4772; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_380' title='bbox 739 4742 921 4782; x_wconf 92' lang='eng' dir='ltr'>operantly</span> <span class='ocrx_word' id='word_1_381' title='bbox 938 4742 1207 4783; x_wconf 92' lang='eng' dir='ltr'>re-engineering</span> <span class='ocrx_word' id='word_1_382' title='bbox 1224 4742 1321 4772; x_wconf 82' lang='eng' dir='ltr'>itself.</span> <span class='ocrx_word' id='word_1_383' title='bbox 1345 4743 1373 4772; x_wconf 95' lang='eng' dir='ltr'>It</span>
</span>
<span class='ocr_line' id='line_1_80' title="bbox 361 4800 1375 4841; baseline 0 -11; x_size 37; x_descenders 7; x_ascenders 10"><span class='ocrx_word' id='word_1_384' title='bbox 361 4800 448 4830; x_wconf 82' lang='eng' dir='ltr'>folds</span> <span class='ocrx_word' id='word_1_385' title='bbox 462 4800 532 4830; x_wconf 92' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_386' title='bbox 544 4800 639 4837; x_wconf 82' lang='eng' dir='ltr'>itself,</span> <span class='ocrx_word' id='word_1_387' title='bbox 653 4800 828 4837; x_wconf 92' lang='eng' dir='ltr'>involutes,</span> <span class='ocrx_word' id='word_1_388' title='bbox 843 4810 881 4830; x_wconf 95' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_389' title='bbox 893 4800 1018 4840; x_wconf 90' lang='eng' dir='ltr'>plexes,</span> <span class='ocrx_word' id='word_1_390' title='bbox 1033 4800 1077 4840; x_wconf 93' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_391' title='bbox 1089 4800 1375 4841; x_wconf 91' lang='eng' dir='ltr'>reprogramming</span>
</span>
<span class='ocr_line' id='line_1_81' title="bbox 360 4858 1372 4899; baseline 0 -11; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_392' title='bbox 360 4858 573 4898; x_wconf 89' lang='eng' dir='ltr'>corpuscular</span> <span class='ocrx_word' id='word_1_393' title='bbox 590 4858 674 4888; x_wconf 92' lang='eng' dir='ltr'>code</span> <span class='ocrx_word' id='word_1_394' title='bbox 696 4864 730 4888; x_wconf 97' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_395' title='bbox 749 4868 940 4899; x_wconf 92' lang='eng' dir='ltr'>reprogram</span> <span class='ocrx_word' id='word_1_396' title='bbox 960 4858 1247 4899; x_wconf 91' lang='eng' dir='ltr'>reprogramming</span> <span class='ocrx_word' id='word_1_397' title='bbox 1265 4868 1372 4898; x_wconf 92' lang='eng' dir='ltr'>repro-</span>
</span>
<span class='ocr_line' id='line_1_82' title="bbox 360 4916 1373 4958; baseline -0.001 -11; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_398' title='bbox 360 4917 547 4958; x_wconf 90' lang='eng' dir='ltr'>gramming</span> <span class='ocrx_word' id='word_1_399' title='bbox 556 4916 849 4957; x_wconf 92' lang='eng' dir='ltr'>reprogramming.</span> <span class='ocrx_word' id='word_1_400' title='bbox 865 4925 945 4946; x_wconf 90' lang='eng' dir='ltr'>ROM</span> <span class='ocrx_word' id='word_1_401' title='bbox 959 4916 986 4946; x_wconf 95' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_402' title='bbox 997 4916 1121 4946; x_wconf 95' lang='eng' dir='ltr'>melted</span> <span class='ocrx_word' id='word_1_403' title='bbox 1130 4916 1202 4946; x_wconf 91' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_404' title='bbox 1213 4916 1373 4946; x_wconf 94' lang='eng' dir='ltr'>recursive</span>
</span>
<span class='ocr_line' id='line_1_83' title="bbox 361 4975 666 5015; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_405' title='bbox 361 4975 666 5015; x_wconf 90' lang='eng' dir='ltr'>experimentation.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_17' title="bbox 363 5041 1374 5364">
<span class='ocr_line' id='line_1_84' title="bbox 423 5041 1373 5062; baseline -0.001 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_406' title='bbox 423 5041 1373 5062; x_wconf 96' lang='eng'>001010010010010110000101010101011101010010100</span>
</span>
<span class='ocr_line' id='line_1_85' title="bbox 363 5100 1373 5121; baseline 0.001 -1; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_407' title='bbox 363 5100 1373 5121; x_wconf 96' lang='eng'>10010101000011011001101001011000010001001001000</span>
</span>
<span class='ocr_line' id='line_1_86' title="bbox 363 5149 1374 5190; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_408' title='bbox 363 5149 548 5190; x_wconf 91' lang='eng' dir='ltr'>Recording</span> <span class='ocrx_word' id='word_1_409' title='bbox 556 5149 695 5179; x_wconf 94' lang='eng' dir='ltr'>devices.</span> <span class='ocrx_word' id='word_1_410' title='bbox 707 5149 856 5189; x_wconf 93' lang='eng' dir='ltr'>Copiers.</span> <span class='ocrx_word' id='word_1_411' title='bbox 869 5150 979 5179; x_wconf 90' lang='eng' dir='ltr'>Faxes.</span> <span class='ocrx_word' id='word_1_412' title='bbox 992 5149 1167 5189; x_wconf 92' lang='eng' dir='ltr'>Samplers.</span> <span class='ocrx_word' id='word_1_413' title='bbox 1181 5155 1374 5179; x_wconf 90' lang='eng' dir='ltr'>K-stammer</span>
</span>
<span class='ocr_line' id='line_1_87' title="bbox 363 5207 1372 5252; baseline 0 -14; x_size 43; x_descenders 12; x_ascenders 11"><span class='ocrx_word' id='word_1_414' title='bbox 363 5207 639 5252; x_wconf 90' lang='eng' dir='ltr'>(((re)re)reruns)</span> <span class='ocrx_word' id='word_1_415' title='bbox 656 5214 814 5238; x_wconf 90' lang='eng' dir='ltr'>cross-cut</span> <span class='ocrx_word' id='word_1_416' title='bbox 829 5208 873 5248; x_wconf 92' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_417' title='bbox 886 5208 1016 5248; x_wconf 91' lang='eng' dir='ltr'>orphan</span> <span class='ocrx_word' id='word_1_418' title='bbox 1032 5207 1117 5238; x_wconf 82' lang='eng' dir='ltr'>drift.</span> <span class='ocrx_word' id='word_1_419' title='bbox 1136 5209 1261 5248; x_wconf 90' lang='eng' dir='ltr'>Repeat</span> <span class='ocrx_word' id='word_1_420' title='bbox 1274 5208 1372 5238; x_wconf 91' lang='eng' dir='ltr'>infec-</span>
</span>
<span class='ocr_line' id='line_1_88' title="bbox 363 5266 1372 5306; baseline 0 -10; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_421' title='bbox 363 5266 442 5296; x_wconf 91' lang='eng' dir='ltr'>tion.</span> <span class='ocrx_word' id='word_1_422' title='bbox 462 5266 515 5296; x_wconf 95' lang='eng' dir='ltr'>All</span> <span class='ocrx_word' id='word_1_423' title='bbox 533 5266 619 5306; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_424' title='bbox 638 5266 728 5306; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_425' title='bbox 747 5266 834 5306; x_wconf 91' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_426' title='bbox 854 5266 942 5306; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_427' title='bbox 963 5266 1051 5306; x_wconf 91' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_428' title='bbox 1070 5266 1160 5306; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_429' title='bbox 1179 5266 1266 5306; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_430' title='bbox 1286 5266 1372 5306; x_wconf 92' lang='eng' dir='ltr'>hype</span>
</span>
<span class='ocr_line' id='line_1_89' title="bbox 363 5324 1238 5364; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_431' title='bbox 363 5324 551 5364; x_wconf 92' lang='eng' dir='ltr'>hypervirus</span> <span class='ocrx_word' id='word_1_432' title='bbox 564 5324 682 5354; x_wconf 91' lang='eng' dir='ltr'>strains</span> <span class='ocrx_word' id='word_1_433' title='bbox 696 5334 748 5354; x_wconf 95' lang='eng' dir='ltr'>are</span> <span class='ocrx_word' id='word_1_434' title='bbox 761 5324 879 5364; x_wconf 91' lang='eng' dir='ltr'>plastic</span> <span class='ocrx_word' id='word_1_435' title='bbox 894 5324 959 5354; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_436' title='bbox 973 5324 1238 5364; x_wconf 91' lang='eng' dir='ltr'>interoperative.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_18' title="bbox 361 5382 1376 6063">
<span class='ocr_line' id='line_1_90' title="bbox 425 5382 1371 5423; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_437' title='bbox 425 5383 587 5412; x_wconf 70' lang='eng' dir='ltr'>INSERT.</span> <span class='ocrx_word' id='word_1_438' title='bbox 602 5382 885 5423; x_wconf 80' lang='eng' dir='ltr'>hyper-prefixing</span> <span class='ocrx_word' id='word_1_439' title='bbox 896 5382 1045 5413; x_wconf 84' lang='eng' dir='ltr'>semiotic</span> <span class='ocrx_word' id='word_1_440' title='bbox 1058 5388 1178 5412; x_wconf 84' lang='eng' dir='ltr'>sectors</span> <span class='ocrx_word' id='word_1_441' title='bbox 1186 5382 1278 5412; x_wconf 86' lang='eng' dir='ltr'>TAG</span> <span class='ocrx_word' id='word_1_442' title='bbox 1285 5382 1371 5412; x_wconf 92' lang='eng' dir='ltr'>TAG</span>
</span>
<span class='ocr_line' id='line_1_91' title="bbox 361 5438 1372 5482; baseline 0 -12; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_443' title='bbox 361 5440 446 5470; x_wconf 90' lang='eng' dir='ltr'>TAG</span> <span class='ocrx_word' id='word_1_444' title='bbox 455 5446 521 5481; x_wconf 89' lang='eng' dir='ltr'>tags</span> <span class='ocrx_word' id='word_1_445' title='bbox 529 5440 616 5470; x_wconf 93' lang='eng' dir='ltr'>them</span> <span class='ocrx_word' id='word_1_446' title='bbox 624 5440 675 5470; x_wconf 95' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_447' title='bbox 683 5440 817 5470; x_wconf 92' lang='eng' dir='ltr'>transfer</span> <span class='ocrx_word' id='word_1_448' title='bbox 824 5440 894 5470; x_wconf 92' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_449' title='bbox 902 5440 1041 5470; x_wconf 94' lang='eng' dir='ltr'>abstract</span> <span class='ocrx_word' id='word_1_450' title='bbox 1048 5440 1134 5470; x_wconf 89' lang='eng' dir='ltr'>ACT</span> <span class='ocrx_word' id='word_1_451' title='bbox 1140 5440 1225 5470; x_wconf 89' lang='eng' dir='ltr'>ACT</span> <span class='ocrx_word' id='word_1_452' title='bbox 1234 5438 1372 5482; x_wconf 91' lang='eng' dir='ltr'>(nonlin-</span>
</span>
<span class='ocr_line' id='line_1_92' title="bbox 363 5497 1375 5540; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_453' title='bbox 363 5508 415 5528; x_wconf 91' lang='eng' dir='ltr'>ear</span> <span class='ocrx_word' id='word_1_454' title='bbox 423 5497 657 5540; x_wconf 91' lang='eng' dir='ltr'>transcodable)</span> <span class='ocrx_word' id='word_1_455' title='bbox 667 5498 829 5528; x_wconf 92' lang='eng' dir='ltr'>machinic</span> <span class='ocrx_word' id='word_1_456' title='bbox 837 5504 980 5538; x_wconf 91' lang='eng' dir='ltr'>systems,</span> <span class='ocrx_word' id='word_1_457' title='bbox 992 5498 1094 5528; x_wconf 92' lang='eng' dir='ltr'>tuned</span> <span class='ocrx_word' id='word_1_458' title='bbox 1103 5504 1136 5528; x_wconf 97' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_459' title='bbox 1144 5498 1329 5528; x_wconf 94' lang='eng' dir='ltr'>virtualities</span> <span class='ocrx_word' id='word_1_460' title='bbox 1338 5508 1375 5528; x_wconf 95' lang='eng' dir='ltr'>or</span>
</span>
<span class='ocr_line' id='line_1_93' title="bbox 364 5556 1371 5600; baseline 0 -13; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_461' title='bbox 364 5557 576 5597; x_wconf 91' lang='eng' dir='ltr'>hyperspeeds</span> <span class='ocrx_word' id='word_1_462' title='bbox 586 5556 720 5600; x_wconf 95' lang='eng' dir='ltr'>(futural</span> <span class='ocrx_word' id='word_1_463' title='bbox 728 5557 906 5587; x_wconf 91' lang='eng' dir='ltr'>currencies</span> <span class='ocrx_word' id='word_1_464' title='bbox 914 5557 1137 5597; x_wconf 91' lang='eng' dir='ltr'>independent</span> <span class='ocrx_word' id='word_1_465' title='bbox 1146 5557 1184 5587; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_466' title='bbox 1189 5557 1246 5587; x_wconf 95' lang='eng' dir='ltr'>def</span> <span class='ocrx_word' id='word_1_467' title='bbox 1248 5557 1371 5587; x_wconf 94' lang='eng' dir='ltr'>uturali-</span>
</span>
<span class='ocr_line' id='line_1_94' title="bbox 365 5614 1373 5657; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_468' title='bbox 365 5614 494 5657; x_wconf 91' lang='eng' dir='ltr'>zation).</span> <span class='ocrx_word' id='word_1_469' title='bbox 507 5615 725 5655; x_wconf 91' lang='eng' dir='ltr'>Hypermedia</span> <span class='ocrx_word' id='word_1_470' title='bbox 734 5615 900 5656; x_wconf 88' lang='eng' dir='ltr'>configure</span> <span class='ocrx_word' id='word_1_471' title='bbox 910 5625 942 5645; x_wconf 95' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_472' title='bbox 952 5625 983 5645; x_wconf 95' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_473' title='bbox 992 5625 1087 5655; x_wconf 92' lang='eng' dir='ltr'>every</span> <span class='ocrx_word' id='word_1_474' title='bbox 1095 5615 1373 5655; x_wconf 92' lang='eng' dir='ltr'>implementation</span>
</span>
<span class='ocr_line' id='line_1_95' title="bbox 362 5674 1376 5714; baseline 0.001 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_475' title='bbox 362 5674 476 5704; x_wconf 91' lang='eng' dir='ltr'>within</span> <span class='ocrx_word' id='word_1_476' title='bbox 487 5684 505 5704; x_wconf 96' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_477' title='bbox 517 5674 647 5714; x_wconf 88' lang='eng' dir='ltr'>specific</span> <span class='ocrx_word' id='word_1_478' title='bbox 661 5674 806 5704; x_wconf 95' lang='eng' dir='ltr'>medium</span> <span class='ocrx_word' id='word_1_479' title='bbox 820 5684 858 5704; x_wconf 95' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_480' title='bbox 870 5674 1022 5714; x_wconf 92' lang='eng' dir='ltr'>territory</span> <span class='ocrx_word' id='word_1_481' title='bbox 1032 5684 1066 5704; x_wconf 94' lang='eng' dir='ltr'>as</span> <span class='ocrx_word' id='word_1_482' title='bbox 1078 5684 1096 5704; x_wconf 96' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_483' title='bbox 1108 5674 1327 5704; x_wconf 91' lang='eng' dir='ltr'>subfunction</span> <span class='ocrx_word' id='word_1_484' title='bbox 1339 5674 1376 5704; x_wconf 98' lang='eng' dir='ltr'>of</span>
</span>
<span class='ocr_line' id='line_1_96' title="bbox 364 5730 1371 5776; baseline -0.001 -13; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_485' title='bbox 364 5732 624 5763; x_wconf 89' lang='eng' dir='ltr'>extraterritorial</span> <span class='ocrx_word' id='word_1_486' title='bbox 635 5742 815 5772; x_wconf 87' lang='eng' dir='ltr'>processes.</span> <span class='ocrx_word' id='word_1_487' title='bbox 830 5732 946 5773; x_wconf 92' lang='eng' dir='ltr'>Going</span> <span class='ocrx_word' id='word_1_488' title='bbox 959 5730 987 5775; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_489' title='bbox 1002 5730 1014 5774; x_wconf 96' lang='eng'>(</span> <span class='ocrx_word' id='word_1_490' title='bbox 1028 5730 1074 5775; x_wconf 92' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_491' title='bbox 1089 5730 1101 5774; x_wconf 96' lang='eng'>(</span> <span class='ocrx_word' id='word_1_492' title='bbox 1115 5730 1127 5774; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_493' title='bbox 1143 5730 1154 5774; x_wconf 91' lang='eng'>(</span> <span class='ocrx_word' id='word_1_494' title='bbox 1167 5730 1179 5774; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_495' title='bbox 1195 5731 1223 5775; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_496' title='bbox 1236 5730 1248 5774; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_497' title='bbox 1273 5730 1285 5774; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_498' title='bbox 1300 5731 1328 5776; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_499' title='bbox 1342 5731 1371 5776; x_wconf 89' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_97' title="bbox 367 5790 1373 5834; baseline 0 -13; x_size 42; x_descenders 11; x_ascenders 11"><span class='ocrx_word' id='word_1_500' title='bbox 367 5790 378 5834; x_wconf 91' lang='eng'>(</span> <span class='ocrx_word' id='word_1_501' title='bbox 392 5790 404 5834; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_502' title='bbox 419 5791 519 5831; x_wconf 92' lang='eng' dir='ltr'>hyper</span> <span class='ocrx_word' id='word_1_503' title='bbox 531 5791 690 5821; x_wconf 93' lang='eng' dir='ltr'>dissolves</span> <span class='ocrx_word' id='word_1_504' title='bbox 703 5791 806 5832; x_wconf 91' lang='eng' dir='ltr'>being</span> <span class='ocrx_word' id='word_1_505' title='bbox 818 5791 889 5821; x_wconf 91' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_506' title='bbox 900 5791 990 5821; x_wconf 93' lang='eng' dir='ltr'>ACT</span> <span class='ocrx_word' id='word_1_507' title='bbox 999 5791 1089 5821; x_wconf 93' lang='eng' dir='ltr'>ACT</span> <span class='ocrx_word' id='word_1_508' title='bbox 1099 5791 1187 5821; x_wconf 89' lang='eng' dir='ltr'>ACT</span> <span class='ocrx_word' id='word_1_509' title='bbox 1199 5791 1340 5831; x_wconf 87' lang='eng' dir='ltr'>activity;</span> <span class='ocrx_word' id='word_1_510' title='bbox 1355 5801 1373 5821; x_wconf 96' lang='eng' dir='ltr'>a</span>
</span>
<span class='ocr_line' id='line_1_98' title="bbox 365 5850 1372 5890; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_511' title='bbox 365 5850 508 5880; x_wconf 90' lang='eng' dir='ltr'>material</span> <span class='ocrx_word' id='word_1_512' title='bbox 523 5850 886 5880; x_wconf 91' lang='eng' dir='ltr'>desubstantialisation</span> <span class='ocrx_word' id='word_1_513' title='bbox 902 5860 945 5880; x_wconf 92' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_514' title='bbox 964 5850 1013 5880; x_wconf 83' lang='eng' dir='ltr'>off</span> <span class='ocrx_word' id='word_1_515' title='bbox 1027 5860 1070 5880; x_wconf 92' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_516' title='bbox 1087 5850 1145 5880; x_wconf 82' lang='eng' dir='ltr'>off.</span> <span class='ocrx_word' id='word_1_517' title='bbox 1164 5851 1372 5890; x_wconf 91' lang='eng' dir='ltr'>Hyperproc-</span>
</span>
<span class='ocr_line' id='line_1_99' title="bbox 363 5906 1372 5950; baseline 0 -12; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_518' title='bbox 363 5918 450 5938; x_wconf 93' lang='eng' dir='ltr'>esses</span> <span class='ocrx_word' id='word_1_519' title='bbox 460 5908 575 5948; x_wconf 93' lang='eng' dir='ltr'>spread</span> <span class='ocrx_word' id='word_1_520' title='bbox 585 5908 651 5938; x_wconf 92' lang='eng' dir='ltr'>like</span> <span class='ocrx_word' id='word_1_521' title='bbox 664 5908 878 5938; x_wconf 91' lang='eng' dir='ltr'>Heraklitean</span> <span class='ocrx_word' id='word_1_522' title='bbox 888 5908 947 5938; x_wconf 95' lang='eng' dir='ltr'>fire</span> <span class='ocrx_word' id='word_1_523' title='bbox 956 5918 991 5938; x_wconf 95' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_524' title='bbox 1001 5918 1036 5938; x_wconf 95' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_525' title='bbox 1046 5918 1081 5938; x_wconf 95' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_526' title='bbox 1094 5906 1271 5950; x_wconf 92' lang='eng' dir='ltr'>(although</span> <span class='ocrx_word' id='word_1_527' title='bbox 1284 5908 1372 5938; x_wconf 95' lang='eng' dir='ltr'>there</span>
</span>
<span class='ocr_line' id='line_1_100' title="bbox 361 5962 1370 6003; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_528' title='bbox 361 5972 418 5992; x_wconf 94' lang='eng' dir='ltr'>are</span> <span class='ocrx_word' id='word_1_529' title='bbox 431 5972 476 5992; x_wconf 94' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_530' title='bbox 490 5962 660 6003; x_wconf 89' lang='eng' dir='ltr'>analogies</span> <span class='ocrx_word' id='word_1_531' title='bbox 675 5972 714 5992; x_wconf 94' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_532' title='bbox 728 5962 919 6002; x_wconf 91' lang='eng' dir='ltr'>metaphors</span> <span class='ocrx_word' id='word_1_533' title='bbox 935 5962 970 5992; x_wconf 94' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_534' title='bbox 984 5962 1069 6003; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_535' title='bbox 1085 5962 1171 6003; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_536' title='bbox 1186 5962 1270 6003; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_537' title='bbox 1287 5962 1370 6003; x_wconf 91' lang='eng' dir='ltr'>hype</span>
</span>
<span class='ocr_line' id='line_1_101' title="bbox 364 6019 594 6063; baseline 0.004 -13; x_size 42; x_descenders 10; x_ascenders 12"><span class='ocrx_word' id='word_1_538' title='bbox 364 6019 594 6063; x_wconf 92' lang='eng' dir='ltr'>hyperspace).</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_19' title="bbox 359 6079 1372 6939">
<span class='ocr_line' id='line_1_102' title="bbox 428 6079 1370 6120; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_539' title='bbox 428 6079 530 6120; x_wconf 89' lang='eng' dir='ltr'>Being</span> <span class='ocrx_word' id='word_1_540' title='bbox 538 6079 629 6109; x_wconf 93' lang='eng' dir='ltr'>CAG</span> <span class='ocrx_word' id='word_1_541' title='bbox 637 6079 729 6109; x_wconf 93' lang='eng' dir='ltr'>CAG</span> <span class='ocrx_word' id='word_1_542' title='bbox 738 6089 829 6120; x_wconf 90' lang='eng' dir='ltr'>cages</span> <span class='ocrx_word' id='word_1_543' title='bbox 841 6079 917 6109; x_wconf 96' lang='eng' dir='ltr'>flow</span> <span class='ocrx_word' id='word_1_544' title='bbox 927 6079 1035 6109; x_wconf 94' lang='eng' dir='ltr'>within</span> <span class='ocrx_word' id='word_1_545' title='bbox 1046 6089 1193 6120; x_wconf 90' lang='eng' dir='ltr'>memory.</span> <span class='ocrx_word' id='word_1_546' title='bbox 1206 6079 1370 6109; x_wconf 90' lang='eng' dir='ltr'>Function-</span>
</span>
<span class='ocr_line' id='line_1_103' title="bbox 364 6138 1372 6179; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_547' title='bbox 364 6138 421 6179; x_wconf 89' lang='eng' dir='ltr'>ing</span> <span class='ocrx_word' id='word_1_548' title='bbox 432 6148 466 6168; x_wconf 91' lang='eng' dir='ltr'>as</span> <span class='ocrx_word' id='word_1_549' title='bbox 478 6148 510 6168; x_wconf 94' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_550' title='bbox 522 6148 556 6168; x_wconf 94' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_551' title='bbox 568 6138 634 6168; x_wconf 94' lang='eng' dir='ltr'>real</span> <span class='ocrx_word' id='word_1_552' title='bbox 647 6138 887 6179; x_wconf 90' lang='eng' dir='ltr'>antiontology,</span> <span class='ocrx_word' id='word_1_553' title='bbox 899 6138 980 6168; x_wconf 94' lang='eng' dir='ltr'>viral</span> <span class='ocrx_word' id='word_1_554' title='bbox 993 6138 1133 6168; x_wconf 91' lang='eng' dir='ltr'>amnesia</span> <span class='ocrx_word' id='word_1_555' title='bbox 1146 6138 1372 6179; x_wconf 89' lang='eng' dir='ltr'>machinically</span>
</span>
<span class='ocr_line' id='line_1_104' title="bbox 364 6196 1370 6237; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_556' title='bbox 364 6196 496 6226; x_wconf 91' lang='eng' dir='ltr'>realizes</span> <span class='ocrx_word' id='word_1_557' title='bbox 516 6196 583 6226; x_wconf 94' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_558' title='bbox 602 6196 764 6226; x_wconf 92' lang='eng' dir='ltr'>dissolves</span> <span class='ocrx_word' id='word_1_559' title='bbox 784 6196 965 6237; x_wconf 89' lang='eng' dir='ltr'>biological</span> <span class='ocrx_word' id='word_1_560' title='bbox 982 6196 1370 6226; x_wconf 65' lang='eng' dir='ltr'>TGACTCACI&#39;ITAC-</span>
</span>
<span class='ocr_line' id='line_1_105' title="bbox 364 6254 1369 6290; baseline 0 -6; x_size 36; x_descenders 6; x_ascenders 8"><span class='ocrx_word' id='word_1_561' title='bbox 364 6254 549 6290; x_wconf 76' lang='eng' dir='ltr'>CGA&#39;ITG,</span> <span class='ocrx_word' id='word_1_562' title='bbox 559 6254 707 6290; x_wconf 90' lang='eng' dir='ltr'>cultural,</span> <span class='ocrx_word' id='word_1_563' title='bbox 718 6254 784 6284; x_wconf 91' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_564' title='bbox 794 6254 953 6284; x_wconf 91' lang='eng' dir='ltr'>technical</span> <span class='ocrx_word' id='word_1_565' title='bbox 963 6262 1369 6284; x_wconf 91' lang='eng'>010110100100010110100</span>
</span>
<span class='ocr_line' id='line_1_106' title="bbox 364 6313 1368 6343; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_566' title='bbox 364 6321 1031 6343; x_wconf 93' lang='eng'>101001001011101001010100100100100</span> <span class='ocrx_word' id='word_1_567' title='bbox 1038 6313 1181 6343; x_wconf 92' lang='eng' dir='ltr'>mnemic</span> <span class='ocrx_word' id='word_1_568' title='bbox 1189 6319 1368 6343; x_wconf 89' lang='eng' dir='ltr'>structures:</span>
</span>
<span class='ocr_line' id='line_1_107' title="bbox 363 6371 1369 6412; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_569' title='bbox 363 6371 598 6412; x_wconf 90' lang='eng' dir='ltr'>chopping-up</span> <span class='ocrx_word' id='word_1_570' title='bbox 618 6371 1038 6412; x_wconf 90' lang='eng' dir='ltr'>hierarchic-generational</span> <span class='ocrx_word' id='word_1_571' title='bbox 1056 6371 1288 6412; x_wconf 92' lang='eng' dir='ltr'>descendency,</span> <span class='ocrx_word' id='word_1_572' title='bbox 1307 6371 1369 6402; x_wconf 89' lang='eng' dir='ltr'>col-</span>
</span>
<span class='ocr_line' id='line_1_108' title="bbox 364 6430 1370 6471; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_573' title='bbox 364 6430 495 6471; x_wconf 89' lang='eng' dir='ltr'>lapsing</span> <span class='ocrx_word' id='word_1_574' title='bbox 505 6430 743 6471; x_wconf 89' lang='eng' dir='ltr'>phylogenetic</span> <span class='ocrx_word' id='word_1_575' title='bbox 756 6430 799 6460; x_wconf 97' lang='eng' dir='ltr'>tic</span> <span class='ocrx_word' id='word_1_576' title='bbox 812 6430 1024 6460; x_wconf 89' lang='eng' dir='ltr'>frozen-code</span> <span class='ocrx_word' id='word_1_577' title='bbox 1037 6430 1107 6460; x_wconf 94' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_578' title='bbox 1119 6436 1291 6471; x_wconf 90' lang='eng' dir='ltr'>ontogeny,</span> <span class='ocrx_word' id='word_1_579' title='bbox 1304 6430 1370 6460; x_wconf 94' lang='eng' dir='ltr'>and</span>
</span>
<span class='ocr_line' id='line_1_109' title="bbox 364 6488 1369 6529; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_580' title='bbox 364 6488 639 6529; x_wconf 90' lang='eng' dir='ltr'>immanentizing</span> <span class='ocrx_word' id='word_1_581' title='bbox 659 6488 713 6518; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_582' title='bbox 730 6494 805 6528; x_wconf 92' lang='eng' dir='ltr'>past</span> <span class='ocrx_word' id='word_1_583' title='bbox 825 6494 860 6518; x_wconf 96' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_584' title='bbox 878 6488 1045 6528; x_wconf 91' lang='eng' dir='ltr'>operative</span> <span class='ocrx_word' id='word_1_585' title='bbox 1064 6494 1202 6518; x_wconf 87' lang='eng' dir='ltr'>current.</span> <span class='ocrx_word' id='word_1_586' title='bbox 1223 6489 1265 6518; x_wconf 93' lang='eng' dir='ltr'>Its</span> <span class='ocrx_word' id='word_1_587' title='bbox 1285 6498 1369 6518; x_wconf 90' lang='eng' dir='ltr'>com-</span>
</span>
<span class='ocr_line' id='line_1_110' title="bbox 363 6547 1371 6588; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_588' title='bbox 363 6547 498 6587; x_wconf 94' lang='eng' dir='ltr'>petitive</span> <span class='ocrx_word' id='word_1_589' title='bbox 511 6547 723 6588; x_wconf 86' lang='eng' dir='ltr'>just-in-time</span> <span class='ocrx_word' id='word_1_590' title='bbox 741 6547 955 6577; x_wconf 92' lang='eng' dir='ltr'>innovations</span> <span class='ocrx_word' id='word_1_591' title='bbox 973 6547 1078 6577; x_wconf 96' lang='eng' dir='ltr'>delete</span> <span class='ocrx_word' id='word_1_592' title='bbox 1096 6553 1224 6588; x_wconf 89' lang='eng' dir='ltr'>storage</span> <span class='ocrx_word' id='word_1_593' title='bbox 1240 6547 1298 6577; x_wconf 93' lang='eng' dir='ltr'>CA</span> <span class='ocrx_word' id='word_1_594' title='bbox 1312 6547 1371 6577; x_wconf 95' lang='eng' dir='ltr'>CA</span>
</span>
<span class='ocr_line' id='line_1_111' title="bbox 364 6605 1369 6646; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_595' title='bbox 364 6605 517 6645; x_wconf 92' lang='eng' dir='ltr'>capacity,</span> <span class='ocrx_word' id='word_1_596' title='bbox 529 6605 576 6635; x_wconf 89' lang='eng' dir='ltr'>flu</span> <span class='ocrx_word' id='word_1_597' title='bbox 587 6605 632 6635; x_wconf 90' lang='eng' dir='ltr'>flu</span> <span class='ocrx_word' id='word_1_598' title='bbox 643 6605 689 6635; x_wconf 89' lang='eng' dir='ltr'>flu</span> <span class='ocrx_word' id='word_1_599' title='bbox 700 6605 849 6635; x_wconf 94' lang='eng' dir='ltr'>fluidizin</span> <span class='ocrx_word' id='word_1_600' title='bbox 851 6615 874 6646; x_wconf 90' lang='eng' dir='ltr'>g</span> <span class='ocrx_word' id='word_1_601' title='bbox 882 6605 1045 6646; x_wconf 89' lang='eng' dir='ltr'>energetic</span> <span class='ocrx_word' id='word_1_602' title='bbox 1054 6605 1119 6635; x_wconf 94' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_603' title='bbox 1128 6605 1369 6635; x_wconf 87' lang='eng' dir='ltr'>informational</span>
</span>
<span class='ocr_line' id='line_1_112' title="bbox 364 6663 1369 6703; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_604' title='bbox 364 6663 474 6693; x_wconf 92' lang='eng' dir='ltr'>stocks</span> <span class='ocrx_word' id='word_1_605' title='bbox 488 6663 560 6693; x_wconf 94' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_606' title='bbox 573 6663 642 6693; x_wconf 94' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_607' title='bbox 654 6663 722 6693; x_wconf 94' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_608' title='bbox 734 6673 772 6693; x_wconf 94' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_609' title='bbox 785 6663 854 6693; x_wconf 94' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_610' title='bbox 866 6663 934 6693; x_wconf 94' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_611' title='bbox 946 6673 984 6693; x_wconf 94' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_612' title='bbox 996 6663 1280 6703; x_wconf 92' lang='eng' dir='ltr'>orphan-vampire</span> <span class='ocrx_word' id='word_1_613' title='bbox 1290 6673 1324 6693; x_wconf 94' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_614' title='bbox 1337 6673 1369 6693; x_wconf 94' lang='eng' dir='ltr'>re</span>
</span>
<span class='ocr_line' id='line_1_113' title="bbox 365 6721 1370 6751; baseline 0 0; x_size 42.087334; x_descenders 12.087336; x_ascenders 8"><span class='ocrx_word' id='word_1_615' title='bbox 365 6721 556 6751; x_wconf 91' lang='eng' dir='ltr'>transversal</span> <span class='ocrx_word' id='word_1_616' title='bbox 566 6729 908 6751; x_wconf 91' lang='eng'>110111100010101010</span> <span class='ocrx_word' id='word_1_617' title='bbox 917 6721 963 6751; x_wconf 89' lang='eng' dir='ltr'>vir</span> <span class='ocrx_word' id='word_1_618' title='bbox 972 6721 1020 6751; x_wconf 91' lang='eng' dir='ltr'>vir</span> <span class='ocrx_word' id='word_1_619' title='bbox 1026 6721 1370 6751; x_wconf 85' lang='eng' dir='ltr'>virocommunication</span>
</span>
<span class='ocr_line' id='line_1_114' title="bbox 363 6778 1366 6822; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_620' title='bbox 363 6790 509 6820; x_wconf 92' lang='eng' dir='ltr'>process,</span> <span class='ocrx_word' id='word_1_621' title='bbox 529 6780 726 6821; x_wconf 89' lang='eng' dir='ltr'>expressing</span> <span class='ocrx_word' id='word_1_622' title='bbox 743 6790 761 6810; x_wconf 97' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_623' title='bbox 781 6780 914 6820; x_wconf 93' lang='eng' dir='ltr'>surplus</span> <span class='ocrx_word' id='word_1_624' title='bbox 934 6780 1028 6810; x_wconf 94' lang='eng' dir='ltr'>value</span> <span class='ocrx_word' id='word_1_625' title='bbox 1047 6780 1085 6810; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_626' title='bbox 1099 6780 1184 6810; x_wconf 96' lang='eng' dir='ltr'>code</span> <span class='ocrx_word' id='word_1_627' title='bbox 1203 6778 1366 6822; x_wconf 90' lang='eng' dir='ltr'>(content)</span>
</span>
<span class='ocr_line' id='line_1_115' title="bbox 364 6836 1367 6880; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_628' title='bbox 364 6848 398 6868; x_wconf 92' lang='eng' dir='ltr'>as</span> <span class='ocrx_word' id='word_1_629' title='bbox 417 6838 905 6878; x_wconf 94' lang='eng' dir='ltr'>xenoreplication-behaviour</span> <span class='ocrx_word' id='word_1_630' title='bbox 924 6836 1063 6880; x_wconf 94' lang='eng' dir='ltr'>(and/0r</span> <span class='ocrx_word' id='word_1_631' title='bbox 1079 6836 1284 6880; x_wconf 94' lang='eng' dir='ltr'>c0n(nective</span> <span class='ocrx_word' id='word_1_632' title='bbox 1302 6836 1367 6880; x_wconf 91' lang='eng' dir='ltr'>dis)</span>
</span>
<span class='ocr_line' id='line_1_116' title="bbox 359 6895 542 6939; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_633' title='bbox 359 6895 542 6939; x_wconf 86' lang='eng' dir='ltr'>junction).</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_20' title="bbox 362 6955 1377 8107">
<span class='ocr_line' id='line_1_117' title="bbox 425 6955 1366 6996; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_634' title='bbox 425 6956 468 6985; x_wconf 91' lang='eng' dir='ltr'>As</span> <span class='ocrx_word' id='word_1_635' title='bbox 478 6965 543 6985; x_wconf 94' lang='eng' dir='ltr'>war</span> <span class='ocrx_word' id='word_1_636' title='bbox 552 6955 710 6985; x_wconf 92' lang='eng' dir='ltr'>increases</span> <span class='ocrx_word' id='word_1_637' title='bbox 721 6955 753 6985; x_wconf 92' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_638' title='bbox 763 6955 797 6985; x_wconf 94' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_639' title='bbox 807 6955 840 6985; x_wconf 94' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_640' title='bbox 849 6955 1065 6996; x_wconf 90' lang='eng' dir='ltr'>intelligence,</span> <span class='ocrx_word' id='word_1_641' title='bbox 1074 6955 1097 6985; x_wconf 98' lang='eng' dir='ltr'>it</span> <span class='ocrx_word' id='word_1_642' title='bbox 1106 6955 1254 6985; x_wconf 92' lang='eng' dir='ltr'>becomes</span> <span class='ocrx_word' id='word_1_643' title='bbox 1265 6955 1366 6985; x_wconf 87' lang='eng' dir='ltr'>softer.</span>
</span>
<span class='ocr_line' id='line_1_118' title="bbox 367 7014 1369 7055; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_644' title='bbox 367 7015 412 7055; x_wconf 92' lang='eng' dir='ltr'>By</span> <span class='ocrx_word' id='word_1_645' title='bbox 423 7014 571 7055; x_wconf 89' lang='eng' dir='ltr'>trashing</span> <span class='ocrx_word' id='word_1_646' title='bbox 582 7014 666 7044; x_wconf 94' lang='eng' dir='ltr'>their</span> <span class='ocrx_word' id='word_1_647' title='bbox 676 7014 766 7044; x_wconf 92' lang='eng' dir='ltr'>hosts</span> <span class='ocrx_word' id='word_1_648' title='bbox 779 7014 877 7044; x_wconf 94' lang='eng' dir='ltr'>crude</span> <span class='ocrx_word' id='word_1_649' title='bbox 888 7014 1011 7044; x_wconf 93' lang='eng' dir='ltr'>viruses</span> <span class='ocrx_word' id='word_1_650' title='bbox 1023 7014 1181 7044; x_wconf 88' lang='eng' dir='ltr'>feedback</span> <span class='ocrx_word' id='word_1_651' title='bbox 1189 7014 1369 7055; x_wconf 89' lang='eng' dir='ltr'>negatively</span>
</span>
<span class='ocr_line' id='line_1_119' title="bbox 365 7071 1367 7112; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_652' title='bbox 365 7081 459 7111; x_wconf 94' lang='eng' dir='ltr'>upon</span> <span class='ocrx_word' id='word_1_653' title='bbox 477 7071 684 7107; x_wconf 92' lang='eng' dir='ltr'>themselves,</span> <span class='ocrx_word' id='word_1_654' title='bbox 703 7071 930 7112; x_wconf 89' lang='eng' dir='ltr'>autolimiting</span> <span class='ocrx_word' id='word_1_655' title='bbox 949 7071 1028 7101; x_wconf 94' lang='eng' dir='ltr'>their</span> <span class='ocrx_word' id='word_1_656' title='bbox 1045 7081 1143 7112; x_wconf 89' lang='eng' dir='ltr'>range</span> <span class='ocrx_word' id='word_1_657' title='bbox 1160 7071 1198 7101; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_658' title='bbox 1211 7081 1243 7101; x_wconf 94' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_659' title='bbox 1259 7081 1367 7112; x_wconf 91' lang='eng' dir='ltr'>regen-</span>
</span>
<span class='ocr_line' id='line_1_120' title="bbox 364 7130 1368 7170; baseline -0.001 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_660' title='bbox 364 7130 484 7160; x_wconf 94' lang='eng' dir='ltr'>erative</span> <span class='ocrx_word' id='word_1_661' title='bbox 501 7130 719 7160; x_wconf 90' lang='eng' dir='ltr'>infilitration.</span> <span class='ocrx_word' id='word_1_662' title='bbox 739 7130 847 7170; x_wconf 92' lang='eng' dir='ltr'>Crazy</span> <span class='ocrx_word' id='word_1_663' title='bbox 861 7130 999 7160; x_wconf 92' lang='eng' dir='ltr'>vandals</span> <span class='ocrx_word' id='word_1_664' title='bbox 1017 7130 1079 7160; x_wconf 93' lang='eng' dir='ltr'>like</span> <span class='ocrx_word' id='word_1_665' title='bbox 1097 7130 1201 7160; x_wconf 90' lang='eng' dir='ltr'>Ebola</span> <span class='ocrx_word' id='word_1_666' title='bbox 1217 7130 1368 7161; x_wconf 90' lang='eng' dir='ltr'>CGCGT</span>
</span>
<span class='ocr_line' id='line_1_121' title="bbox 364 7187 1366 7231; baseline 0 -12; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_667' title='bbox 364 7189 1222 7219; x_wconf 78' lang='eng' dir='ltr'>GAGCAATCGGACTCGGCTGCTGTGC&#39;ITG</span> <span class='ocrx_word' id='word_1_668' title='bbox 1238 7187 1366 7231; x_wconf 92' lang='eng' dir='ltr'>(bodies</span>
</span>
<span class='ocr_line' id='line_1_122' title="bbox 364 7245 1367 7289; baseline 0 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_669' title='bbox 364 7247 533 7277; x_wconf 92' lang='eng' dir='ltr'>dissolved</span> <span class='ocrx_word' id='word_1_670' title='bbox 543 7247 679 7287; x_wconf 92' lang='eng' dir='ltr'>quickly</span> <span class='ocrx_word' id='word_1_671' title='bbox 688 7247 760 7277; x_wconf 94' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_672' title='bbox 772 7245 879 7289; x_wconf 92' lang='eng' dir='ltr'>slime)</span> <span class='ocrx_word' id='word_1_673' title='bbox 891 7245 992 7277; x_wconf 78' lang='eng' dir='ltr'>arent</span> <span class='ocrx_word' id='word_1_674' title='bbox 1000 7257 1077 7277; x_wconf 94' lang='eng' dir='ltr'>ever</span> <span class='ocrx_word' id='word_1_675' title='bbox 1083 7247 1186 7288; x_wconf 89' lang='eng' dir='ltr'>going</span> <span class='ocrx_word' id='word_1_676' title='bbox 1197 7253 1229 7277; x_wconf 96' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_677' title='bbox 1239 7247 1333 7277; x_wconf 85' lang='eng' dir='ltr'>make</span> <span class='ocrx_word' id='word_1_678' title='bbox 1342 7247 1367 7277; x_wconf 98' lang='eng' dir='ltr'>it</span>
</span>
<span class='ocr_line' id='line_1_123' title="bbox 364 7304 1367 7345; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_679' title='bbox 364 7304 428 7345; x_wconf 90' lang='eng' dir='ltr'>big.</span> <span class='ocrx_word' id='word_1_680' title='bbox 439 7304 581 7334; x_wconf 93' lang='eng' dir='ltr'>General</span> <span class='ocrx_word' id='word_1_681' title='bbox 589 7304 748 7344; x_wconf 94' lang='eng' dir='ltr'>principle</span> <span class='ocrx_word' id='word_1_682' title='bbox 758 7304 810 7334; x_wconf 89' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_683' title='bbox 816 7304 895 7334; x_wconf 94' lang='eng' dir='ltr'>viral</span> <span class='ocrx_word' id='word_1_684' title='bbox 906 7304 1079 7334; x_wconf 89' lang='eng' dir='ltr'>take-overs</span> <span class='ocrx_word' id='word_1_685' title='bbox 1088 7304 1121 7334; x_wconf 94' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_686' title='bbox 1129 7304 1184 7334; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_687' title='bbox 1191 7304 1301 7334; x_wconf 86' lang='eng' dir='ltr'>media:</span> <span class='ocrx_word' id='word_1_688' title='bbox 1312 7304 1367 7334; x_wconf 96' lang='eng' dir='ltr'>the</span>
</span>
<span class='ocr_line' id='line_1_124' title="bbox 362 7363 1366 7404; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_689' title='bbox 362 7373 455 7393; x_wconf 92' lang='eng' dir='ltr'>more</span> <span class='ocrx_word' id='word_1_690' title='bbox 464 7363 746 7403; x_wconf 92' lang='eng' dir='ltr'>unsophisticated</span> <span class='ocrx_word' id='word_1_691' title='bbox 755 7363 810 7393; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_692' title='bbox 819 7363 1007 7404; x_wconf 89' lang='eng' dir='ltr'>contagion,</span> <span class='ocrx_word' id='word_1_693' title='bbox 1016 7363 1071 7393; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_694' title='bbox 1079 7363 1190 7404; x_wconf 90' lang='eng' dir='ltr'>bigger</span> <span class='ocrx_word' id='word_1_695' title='bbox 1200 7363 1250 7393; x_wconf 90' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_696' title='bbox 1259 7363 1366 7403; x_wconf 89' lang='eng' dir='ltr'>splash</span>
</span>
<span class='ocr_line' id='line_1_125' title="bbox 366 7419 1367 7463; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_697' title='bbox 366 7419 614 7463; x_wconf 89' lang='eng' dir='ltr'>(diversionary</span> <span class='ocrx_word' id='word_1_698' title='bbox 634 7421 750 7451; x_wconf 92' lang='eng' dir='ltr'>tactics</span> <span class='ocrx_word' id='word_1_699' title='bbox 770 7419 965 7463; x_wconf 94' lang='eng' dir='ltr'>excepted).</span> <span class='ocrx_word' id='word_1_700' title='bbox 986 7421 1367 7451; x_wconf 82' lang='eng' dir='ltr'>CAGCTACGCTATT</span>
</span>
<span class='ocr_line' id='line_1_126' title="bbox 365 7479 1366 7509; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_701' title='bbox 365 7479 1366 7509; x_wconf 90' lang='eng' dir='ltr'>CTCCGAGGCTAGATTGCAGCTACGTCGCATCG</span>
</span>
<span class='ocr_line' id='line_1_127' title="bbox 364 7543 1377 7573; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_702' title='bbox 364 7543 1377 7573; x_wconf 77' lang='eng' dir='ltr'>GGCTGACCGATGTAGGTCATGAATCTACCGAIT</span>
</span>
<span class='ocr_line' id='line_1_128' title="bbox 364 7601 1377 7632; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_703' title='bbox 364 7601 1377 7632; x_wconf 85' lang='eng' dir='ltr'>GCACATGACTTATCCACGGTCTATTCCTCGAT</span>
</span>
<span class='ocr_line' id='line_1_129' title="bbox 365 7660 1373 7690; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_704' title='bbox 365 7660 717 7690; x_wconf 90' lang='eng' dir='ltr'>GATCGCATCGGG</span> <span class='ocrx_word' id='word_1_705' title='bbox 720 7660 777 7690; x_wconf 92' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_706' title='bbox 777 7660 1248 7690; x_wconf 89' lang='eng' dir='ltr'>GACCGATGGCATCGTA</span> <span class='ocrx_word' id='word_1_707' title='bbox 1253 7660 1373 7690; x_wconf 88' lang='eng' dir='ltr'>COPY.</span>
</span>
<span class='ocr_line' id='line_1_130' title="bbox 365 7717 1375 7759; baseline -0.001 -10; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_708' title='bbox 365 7719 462 7749; x_wconf 89' lang='eng' dir='ltr'>CUT.</span> <span class='ocrx_word' id='word_1_709' title='bbox 478 7718 615 7748; x_wconf 86' lang='eng' dir='ltr'>PASTE.</span> <span class='ocrx_word' id='word_1_710' title='bbox 632 7718 748 7748; x_wconf 92' lang='eng' dir='ltr'>Subtle</span> <span class='ocrx_word' id='word_1_711' title='bbox 761 7718 886 7748; x_wconf 91' lang='eng' dir='ltr'>viruses</span> <span class='ocrx_word' id='word_1_712' title='bbox 900 7728 953 7748; x_wconf 93' lang='eng' dir='ltr'>are</span> <span class='ocrx_word' id='word_1_713' title='bbox 968 7718 1056 7755; x_wconf 92' lang='eng' dir='ltr'>slow,</span> <span class='ocrx_word' id='word_1_714' title='bbox 1071 7718 1228 7759; x_wconf 90' lang='eng' dir='ltr'>synergic,</span> <span class='ocrx_word' id='word_1_715' title='bbox 1245 7717 1375 7748; x_wconf 87' lang='eng' dir='ltr'>flexible</span>
</span>
<span class='ocr_line' id='line_1_131' title="bbox 365 7777 1374 7818; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_716' title='bbox 365 7777 432 7807; x_wconf 89' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_717' title='bbox 452 7777 585 7807; x_wconf 86' lang='eng' dir='ltr'>elusive.</span> <span class='ocrx_word' id='word_1_718' title='bbox 606 7777 697 7818; x_wconf 90' lang='eng' dir='ltr'>They</span> <span class='ocrx_word' id='word_1_719' title='bbox 716 7783 856 7807; x_wconf 90' lang='eng' dir='ltr'>execute</span> <span class='ocrx_word' id='word_1_720' title='bbox 876 7777 1036 7807; x_wconf 92' lang='eng' dir='ltr'>sensitive</span> <span class='ocrx_word' id='word_1_721' title='bbox 1056 7777 1276 7807; x_wconf 89' lang='eng' dir='ltr'>behavioural</span> <span class='ocrx_word' id='word_1_722' title='bbox 1296 7787 1374 7807; x_wconf 90' lang='eng' dir='ltr'>con-</span>
</span>
<span class='ocr_line' id='line_1_132' title="bbox 367 7834 1374 7875; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_723' title='bbox 367 7834 426 7864; x_wconf 94' lang='eng' dir='ltr'>trol</span> <span class='ocrx_word' id='word_1_724' title='bbox 442 7834 513 7864; x_wconf 89' lang='eng' dir='ltr'>that</span> <span class='ocrx_word' id='word_1_725' title='bbox 523 7834 684 7875; x_wconf 92' lang='eng' dir='ltr'>prolongs</span> <span class='ocrx_word' id='word_1_726' title='bbox 700 7834 754 7864; x_wconf 95' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_727' title='bbox 769 7834 824 7864; x_wconf 93' lang='eng' dir='ltr'>life</span> <span class='ocrx_word' id='word_1_728' title='bbox 838 7834 877 7864; x_wconf 93' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_729' title='bbox 889 7834 944 7864; x_wconf 95' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_730' title='bbox 959 7834 1183 7864; x_wconf 91' lang='eng' dir='ltr'>biomachinic</span> <span class='ocrx_word' id='word_1_731' title='bbox 1198 7844 1374 7871; x_wconf 91' lang='eng' dir='ltr'>resources,</span>
</span>
<span class='ocr_line' id='line_1_133' title="bbox 366 7892 1375 7933; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_732' title='bbox 366 7892 553 7922; x_wconf 92' lang='eng' dir='ltr'>maximizes</span> <span class='ocrx_word' id='word_1_733' title='bbox 562 7892 810 7932; x_wconf 92' lang='eng' dir='ltr'>opportunities</span> <span class='ocrx_word' id='word_1_734' title='bbox 820 7892 872 7922; x_wconf 93' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_735' title='bbox 879 7892 1118 7933; x_wconf 92' lang='eng' dir='ltr'>propogation,</span> <span class='ocrx_word' id='word_1_736' title='bbox 1129 7892 1299 7922; x_wconf 91' lang='eng' dir='ltr'>infiltrates</span> <span class='ocrx_word' id='word_1_737' title='bbox 1309 7892 1375 7922; x_wconf 92' lang='eng' dir='ltr'>and</span>
</span>
<span class='ocr_line' id='line_1_134' title="bbox 365 7951 1374 7992; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_738' title='bbox 365 7951 508 7981; x_wconf 93' lang='eng' dir='ltr'>disables</span> <span class='ocrx_word' id='word_1_739' title='bbox 526 7951 643 7981; x_wconf 94' lang='eng' dir='ltr'>hostile</span> <span class='ocrx_word' id='word_1_740' title='bbox 663 7951 806 7992; x_wconf 91' lang='eng' dir='ltr'>security</span> <span class='ocrx_word' id='word_1_741' title='bbox 824 7957 973 7992; x_wconf 94' lang='eng' dir='ltr'>systems,</span> <span class='ocrx_word' id='word_1_742' title='bbox 993 7951 1060 7981; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_743' title='bbox 1080 7951 1271 7981; x_wconf 91' lang='eng' dir='ltr'>feeds-back</span> <span class='ocrx_word' id='word_1_744' title='bbox 1287 7951 1374 7991; x_wconf 88' lang='eng' dir='ltr'>posi-</span>
</span>
<span class='ocr_line' id='line_1_135' title="bbox 367 8009 1376 8039; baseline 0 0; x_size 40.988487; x_descenders 10.988487; x_ascenders 10"><span class='ocrx_word' id='word_1_745' title='bbox 367 8009 428 8039; x_wconf 94' lang='eng' dir='ltr'>tive</span> <span class='ocrx_word' id='word_1_746' title='bbox 446 8020 608 8037; x_wconf 91' lang='eng'>-+-++-+-++</span> <span class='ocrx_word' id='word_1_747' title='bbox 625 8009 659 8039; x_wconf 88' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_748' title='bbox 675 8009 708 8039; x_wconf 92' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_749' title='bbox 724 8009 758 8039; x_wconf 92' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_750' title='bbox 774 8009 971 8039; x_wconf 89' lang='eng' dir='ltr'>innovation</span> <span class='ocrx_word' id='word_1_751' title='bbox 987 8009 1247 8039; x_wconf 91' lang='eng' dir='ltr'>technoscience.</span> <span class='ocrx_word' id='word_1_752' title='bbox 1267 8010 1305 8039; x_wconf 88' lang='eng' dir='ltr'>In</span> <span class='ocrx_word' id='word_1_753' title='bbox 1321 8009 1376 8039; x_wconf 94' lang='eng' dir='ltr'>the</span>
</span>
<span class='ocr_line' id='line_1_136' title="bbox 366 8064 1372 8107; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_754' title='bbox 366 8066 614 8103; x_wconf 91' lang='eng' dir='ltr'>macroversion,</span> <span class='ocrx_word' id='word_1_755' title='bbox 628 8076 646 8096; x_wconf 95' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_756' title='bbox 658 8075 706 8096; x_wconf 83' lang='eng' dir='ltr'>VR</span> <span class='ocrx_word' id='word_1_757' title='bbox 718 8076 800 8107; x_wconf 93' lang='eng' dir='ltr'>prey</span> <span class='ocrx_word' id='word_1_758' title='bbox 812 8066 933 8096; x_wconf 92' lang='eng' dir='ltr'>animal</span> <span class='ocrx_word' id='word_1_759' title='bbox 948 8066 1006 8096; x_wconf 95' lang='eng' dir='ltr'>hid</span> <span class='ocrx_word' id='word_1_760' title='bbox 1020 8066 1054 8096; x_wconf 88' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_761' title='bbox 1068 8066 1108 8096; x_wconf 92' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_762' title='bbox 1121 8064 1263 8107; x_wconf 79' lang='eng' dir='ltr'>enemys</span> <span class='ocrx_word' id='word_1_763' title='bbox 1276 8066 1372 8096; x_wconf 95' lang='eng' dir='ltr'>head.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_21' title="bbox 367 8124 1377 8924">
<span class='ocr_line' id='line_1_137' title="bbox 426 8124 1377 8165; baseline 0.001 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_764' title='bbox 426 8124 532 8154; x_wconf 92' lang='eng' dir='ltr'>When</span> <span class='ocrx_word' id='word_1_765' title='bbox 545 8124 687 8165; x_wconf 89' lang='eng' dir='ltr'>hunting</span> <span class='ocrx_word' id='word_1_766' title='bbox 699 8124 751 8154; x_wconf 93' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_767' title='bbox 761 8124 849 8165; x_wconf 93' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_768' title='bbox 861 8124 1056 8165; x_wconf 93' lang='eng' dir='ltr'>hypervirus</span> <span class='ocrx_word' id='word_1_769' title='bbox 1068 8124 1148 8154; x_wconf 94' lang='eng' dir='ltr'>look</span> <span class='ocrx_word' id='word_1_770' title='bbox 1158 8124 1204 8154; x_wconf 94' lang='eng' dir='ltr'>0k</span> <span class='ocrx_word' id='word_1_771' title='bbox 1215 8124 1258 8154; x_wconf 97' lang='eng' dir='ltr'>0k</span> <span class='ocrx_word' id='word_1_772' title='bbox 1269 8124 1314 8154; x_wconf 94' lang='eng' dir='ltr'>ok</span> <span class='ocrx_word' id='word_1_773' title='bbox 1325 8124 1377 8154; x_wconf 93' lang='eng' dir='ltr'>for</span>
</span>
<span class='ocr_line' id='line_1_138' title="bbox 367 8182 1374 8225; baseline -0.002 -11; x_size 41; x_descenders 11; x_ascenders 9"><span class='ocrx_word' id='word_1_774' title='bbox 367 8184 404 8214; x_wconf 89' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_775' title='bbox 416 8184 559 8225; x_wconf 91' lang='eng' dir='ltr'>primary</span> <span class='ocrx_word' id='word_1_776' title='bbox 569 8184 644 8214; x_wconf 93' lang='eng' dir='ltr'>host</span> <span class='ocrx_word' id='word_1_777' title='bbox 655 8184 793 8224; x_wconf 90' lang='eng' dir='ltr'>species,</span> <span class='ocrx_word' id='word_1_778' title='bbox 804 8184 912 8214; x_wconf 90' lang='eng' dir='ltr'>which</span> <span class='ocrx_word' id='word_1_779' title='bbox 924 8184 990 8214; x_wconf 94' lang='eng' dir='ltr'>will</span> <span class='ocrx_word' id='word_1_780' title='bbox 1004 8184 1043 8214; x_wconf 91' lang='eng' dir='ltr'>be</span> <span class='ocrx_word' id='word_1_781' title='bbox 1057 8182 1268 8224; x_wconf 85' lang='eng' dir='ltr'>undergoing</span> <span class='ocrx_word' id='word_1_782' title='bbox 1280 8183 1374 8224; x_wconf 88' lang='eng' dir='ltr'>logis-</span>
</span>
<span class='ocr_line' id='line_1_139' title="bbox 367 8241 1375 8282; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_783' title='bbox 367 8241 440 8271; x_wconf 90' lang='eng' dir='ltr'>tical</span> <span class='ocrx_word' id='word_1_784' title='bbox 454 8241 644 8271; x_wconf 93' lang='eng' dir='ltr'>behavioral</span> <span class='ocrx_word' id='word_1_785' title='bbox 659 8241 914 8281; x_wconf 90' lang='eng' dir='ltr'>sophistication</span> <span class='ocrx_word' id='word_1_786' title='bbox 932 8241 1073 8271; x_wconf 92' lang='eng' dir='ltr'>indexed</span> <span class='ocrx_word' id='word_1_787' title='bbox 1092 8241 1135 8282; x_wconf 96' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_788' title='bbox 1149 8251 1191 8271; x_wconf 92' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_789' title='bbox 1207 8241 1375 8281; x_wconf 93' lang='eng' dir='ltr'>explosive</span>
</span>
<span class='ocr_line' id='line_1_140' title="bbox 368 8300 1374 8341; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_790' title='bbox 368 8300 505 8330; x_wconf 91' lang='eng' dir='ltr'>increase</span> <span class='ocrx_word' id='word_1_791' title='bbox 518 8300 552 8330; x_wconf 88' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_792' title='bbox 562 8300 839 8330; x_wconf 90' lang='eng' dir='ltr'>communicative</span> <span class='ocrx_word' id='word_1_793' title='bbox 850 8300 1013 8341; x_wconf 92' lang='eng' dir='ltr'>intensity,</span> <span class='ocrx_word' id='word_1_794' title='bbox 1025 8300 1228 8340; x_wconf 92' lang='eng' dir='ltr'>population</span> <span class='ocrx_word' id='word_1_795' title='bbox 1238 8300 1374 8341; x_wconf 92' lang='eng' dir='ltr'>density,</span>
</span>
<span class='ocr_line' id='line_1_141' title="bbox 367 8358 1375 8399; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_796' title='bbox 367 8358 473 8388; x_wconf 92' lang='eng' dir='ltr'>sexual</span> <span class='ocrx_word' id='word_1_797' title='bbox 482 8358 761 8399; x_wconf 92' lang='eng' dir='ltr'>disorganisation,</span> <span class='ocrx_word' id='word_1_798' title='bbox 771 8358 908 8388; x_wconf 90' lang='eng' dir='ltr'>cultural</span> <span class='ocrx_word' id='word_1_799' title='bbox 917 8358 1135 8399; x_wconf 91' lang='eng' dir='ltr'>promiscuity,</span> <span class='ocrx_word' id='word_1_800' title='bbox 1144 8358 1209 8388; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_801' title='bbox 1220 8358 1375 8388; x_wconf 90' lang='eng' dir='ltr'>technical</span>
</span>
<span class='ocr_line' id='line_1_142' title="bbox 367 8415 1376 8459; baseline 0 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_802' title='bbox 367 8417 427 8447; x_wconf 94' lang='eng' dir='ltr'>sub</span> <span class='ocrx_word' id='word_1_803' title='bbox 437 8417 498 8447; x_wconf 93' lang='eng' dir='ltr'>sub</span> <span class='ocrx_word' id='word_1_804' title='bbox 508 8417 732 8447; x_wconf 92' lang='eng' dir='ltr'>subtilization</span> <span class='ocrx_word' id='word_1_805' title='bbox 743 8415 892 8459; x_wconf 92' lang='eng' dir='ltr'>(leading</span> <span class='ocrx_word' id='word_1_806' title='bbox 902 8423 936 8447; x_wconf 94' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_807' title='bbox 945 8417 1205 8458; x_wconf 91' lang='eng' dir='ltr'>neurogenomic</span> <span class='ocrx_word' id='word_1_808' title='bbox 1215 8417 1376 8447; x_wconf 91' lang='eng' dir='ltr'>feedback</span>
</span>
<span class='ocr_line' id='line_1_143' title="bbox 367 8474 1377 8515; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_809' title='bbox 367 8474 431 8504; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_810' title='bbox 450 8474 653 8504; x_wconf 88' lang='eng' dir='ltr'>fluidization</span> <span class='ocrx_word' id='word_1_811' title='bbox 671 8484 717 8504; x_wconf 92' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_812' title='bbox 733 8474 785 8504; x_wconf 82' lang='eng' dir='ltr'>off</span> <span class='ocrx_word' id='word_1_813' title='bbox 798 8484 844 8504; x_wconf 89' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_814' title='bbox 861 8474 912 8504; x_wconf 82' lang='eng' dir='ltr'>off</span> <span class='ocrx_word' id='word_1_815' title='bbox 925 8474 976 8504; x_wconf 82' lang='eng' dir='ltr'>off</span> <span class='ocrx_word' id='word_1_816' title='bbox 989 8484 1035 8504; x_wconf 92' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_817' title='bbox 1052 8474 1091 8504; x_wconf 93' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_818' title='bbox 1104 8474 1147 8504; x_wconf 95' lang='eng' dir='ltr'>all</span> <span class='ocrx_word' id='word_1_819' title='bbox 1165 8474 1377 8515; x_wconf 87' lang='eng' dir='ltr'>hard-wiring</span>
</span>
<span class='ocr_line' id='line_1_144' title="bbox 367 8531 1376 8575; baseline 0 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_820' title='bbox 367 8533 437 8563; x_wconf 92' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_821' title='bbox 456 8533 525 8563; x_wconf 92' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_822' title='bbox 543 8533 731 8574; x_wconf 89' lang='eng' dir='ltr'>cybernetic</span> <span class='ocrx_word' id='word_1_823' title='bbox 751 8531 883 8575; x_wconf 91' lang='eng' dir='ltr'>fluxes).</span> <span class='ocrx_word' id='word_1_824' title='bbox 901 8533 976 8574; x_wconf 89' lang='eng' dir='ltr'>Any</span> <span class='ocrx_word' id='word_1_825' title='bbox 994 8533 1094 8573; x_wconf 92' lang='eng' dir='ltr'>plane</span> <span class='ocrx_word' id='word_1_826' title='bbox 1112 8533 1227 8573; x_wconf 89' lang='eng' dir='ltr'>planet</span> <span class='ocrx_word' id='word_1_827' title='bbox 1245 8539 1301 8563; x_wconf 92' lang='eng' dir='ltr'>net</span> <span class='ocrx_word' id='word_1_828' title='bbox 1318 8539 1376 8563; x_wconf 92' lang='eng' dir='ltr'>net</span>
</span>
<span class='ocr_line' id='line_1_145' title="bbox 367 8591 1376 8632; baseline 0.001 -12; x_size 41; x_descenders 11; x_ascenders 8"><span class='ocrx_word' id='word_1_829' title='bbox 367 8599 820 8621; x_wconf 91' lang='eng'>00011011010010010101011</span> <span class='ocrx_word' id='word_1_830' title='bbox 832 8591 968 8632; x_wconf 87' lang='eng' dir='ltr'>hosting</span> <span class='ocrx_word' id='word_1_831' title='bbox 977 8591 1063 8621; x_wconf 90' lang='eng' dir='ltr'>such</span> <span class='ocrx_word' id='word_1_832' title='bbox 1073 8601 1115 8621; x_wconf 90' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_833' title='bbox 1126 8597 1223 8621; x_wconf 92' lang='eng' dir='ltr'>event</span> <span class='ocrx_word' id='word_1_834' title='bbox 1233 8591 1259 8621; x_wconf 92' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_835' title='bbox 1271 8591 1376 8621; x_wconf 90' lang='eng' dir='ltr'>about</span>
</span>
<span class='ocr_line' id='line_1_146' title="bbox 368 8648 1376 8692; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_836' title='bbox 368 8656 401 8680; x_wconf 97' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_837' title='bbox 412 8649 470 8690; x_wconf 88' lang='eng' dir='ltr'>flip</span> <span class='ocrx_word' id='word_1_838' title='bbox 479 8660 561 8680; x_wconf 93' lang='eng' dir='ltr'>over.</span> <span class='ocrx_word' id='word_1_839' title='bbox 573 8650 684 8680; x_wconf 92' lang='eng' dir='ltr'>CATA</span> <span class='ocrx_word' id='word_1_840' title='bbox 693 8650 915 8690; x_wconf 91' lang='eng' dir='ltr'>catastrophic</span> <span class='ocrx_word' id='word_1_841' title='bbox 925 8650 1163 8680; x_wconf 92' lang='eng' dir='ltr'>OKOOKOK</span> <span class='ocrx_word' id='word_1_842' title='bbox 1174 8650 1241 8680; x_wconf 93' lang='eng' dir='ltr'>OK</span> <span class='ocrx_word' id='word_1_843' title='bbox 1251 8660 1326 8680; x_wconf 93' lang='eng' dir='ltr'>zero</span> <span class='ocrx_word' id='word_1_844' title='bbox 1338 8648 1376 8692; x_wconf 93' lang='eng'>(0</span>
</span>
<span class='ocr_line' id='line_1_147' title="bbox 369 8706 1375 8751; baseline 0 -13; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_845' title='bbox 369 8706 431 8750; x_wconf 93' lang='eng' dir='ltr'>(or</span> <span class='ocrx_word' id='word_1_846' title='bbox 443 8706 488 8751; x_wconf 90' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_847' title='bbox 501 8706 514 8750; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_848' title='bbox 527 8706 554 8750; x_wconf 93' lang='eng'>))</span> <span class='ocrx_word' id='word_1_849' title='bbox 570 8706 598 8750; x_wconf 89' lang='eng'>((</span> <span class='ocrx_word' id='word_1_850' title='bbox 612 8706 624 8750; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_851' title='bbox 638 8706 650 8750; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_852' title='bbox 666 8706 679 8750; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_853' title='bbox 694 8706 721 8750; x_wconf 93' lang='eng'>))</span> <span class='ocrx_word' id='word_1_854' title='bbox 737 8706 748 8750; x_wconf 93' lang='eng'>)</span> <span class='ocrx_word' id='word_1_855' title='bbox 762 8706 835 8750; x_wconf 89' lang='eng' dir='ltr'>o°))</span> <span class='ocrx_word' id='word_1_856' title='bbox 848 8708 977 8738; x_wconf 87' lang='eng' dir='ltr'>K-virus</span> <span class='ocrx_word' id='word_1_857' title='bbox 989 8708 1057 8738; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_858' title='bbox 1070 8706 1156 8750; x_wconf 90' lang='eng' dir='ltr'>(RT)</span> <span class='ocrx_word' id='word_1_859' title='bbox 1171 8708 1375 8748; x_wconf 89' lang='eng' dir='ltr'>retroscripts</span>
</span>
<span class='ocr_line' id='line_1_148' title="bbox 369 8764 1374 8809; baseline 0 -13; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_860' title='bbox 369 8765 490 8809; x_wconf 93' lang='eng' dir='ltr'>(Kobe,</span> <span class='ocrx_word' id='word_1_861' title='bbox 504 8766 626 8807; x_wconf 93' lang='eng' dir='ltr'>Tokyo,</span> <span class='ocrx_word' id='word_1_862' title='bbox 643 8766 836 8796; x_wconf 93' lang='eng' dir='ltr'>Oklahoma</span> <span class='ocrx_word' id='word_1_863' title='bbox 854 8764 1010 8808; x_wconf 93' lang='eng' dir='ltr'>(Koresh,</span> <span class='ocrx_word' id='word_1_864' title='bbox 1028 8764 1227 8808; x_wconf 92' lang='eng' dir='ltr'>Koernke)).</span> <span class='ocrx_word' id='word_1_865' title='bbox 1244 8766 1374 8806; x_wconf 93' lang='eng' dir='ltr'>Apoka-</span>
</span>
<span class='ocr_line' id='line_1_149' title="bbox 368 8822 1375 8865; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_866' title='bbox 368 8824 459 8865; x_wconf 92' lang='eng' dir='ltr'>lypse</span> <span class='ocrx_word' id='word_1_867' title='bbox 478 8824 596 8864; x_wconf 92' lang='eng' dir='ltr'>spread</span> <span class='ocrx_word' id='word_1_868' title='bbox 615 8824 660 8865; x_wconf 96' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_869' title='bbox 681 8824 734 8854; x_wconf 94' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_870' title='bbox 756 8824 838 8854; x_wconf 91' lang='eng' dir='ltr'>coke</span> <span class='ocrx_word' id='word_1_871' title='bbox 859 8824 1026 8854; x_wconf 89' lang='eng' dir='ltr'>machine.</span> <span class='ocrx_word' id='word_1_872' title='bbox 1046 8822 1267 8854; x_wconf 83' lang='eng' dir='ltr'>Tomorrows</span> <span class='ocrx_word' id='word_1_873' title='bbox 1286 8834 1375 8854; x_wconf 88' lang='eng' dir='ltr'>news</span>
</span>
<span class='ocr_line' id='line_1_150' title="bbox 367 8884 858 8924; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_874' title='bbox 367 8884 529 8924; x_wconf 93' lang='eng' dir='ltr'>brews-up</span> <span class='ocrx_word' id='word_1_875' title='bbox 541 8884 575 8914; x_wconf 88' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_876' title='bbox 587 8884 706 8921; x_wconf 93' lang='eng' dir='ltr'>Korea,</span> <span class='ocrx_word' id='word_1_877' title='bbox 721 8884 858 8914; x_wconf 92' lang='eng' dir='ltr'>Kosovo</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_22' title="bbox 367 8941 1379 9101">
<span class='ocr_line' id='line_1_151' title="bbox 429 8941 1379 8982; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_878' title='bbox 429 8941 598 8982; x_wconf 92' lang='eng' dir='ltr'>Climbing</span> <span class='ocrx_word' id='word_1_879' title='bbox 615 8947 676 8971; x_wconf 94' lang='eng' dir='ltr'>out</span> <span class='ocrx_word' id='word_1_880' title='bbox 692 8941 734 8971; x_wconf 93' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_881' title='bbox 748 8951 766 8971; x_wconf 95' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_882' title='bbox 785 8941 1053 8971; x_wconf 90' lang='eng' dir='ltr'>recombination</span> <span class='ocrx_word' id='word_1_883' title='bbox 1072 8947 1251 8981; x_wconf 93' lang='eng' dir='ltr'>apparatus</span> <span class='ocrx_word' id='word_1_884' title='bbox 1269 8941 1307 8971; x_wconf 93' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_885' title='bbox 1322 8941 1379 8971; x_wconf 92' lang='eng' dir='ltr'>TA</span>
</span>
<span class='ocr_line' id='line_1_152' title="bbox 367 9001 1375 9042; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_886' title='bbox 367 9001 420 9031; x_wconf 92' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_887' title='bbox 434 9001 488 9031; x_wconf 92' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_888' title='bbox 504 9001 759 9041; x_wconf 91' lang='eng' dir='ltr'>tape-recorders</span> <span class='ocrx_word' id='word_1_889' title='bbox 778 9001 841 9031; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_890' title='bbox 859 9007 1004 9041; x_wconf 90' lang='eng' dir='ltr'>cut-ups,</span> <span class='ocrx_word' id='word_1_891' title='bbox 1021 9001 1215 9042; x_wconf 93' lang='eng' dir='ltr'>hypervirus</span> <span class='ocrx_word' id='word_1_892' title='bbox 1231 9001 1375 9031; x_wconf 91' lang='eng' dir='ltr'>infected</span>
</span>
<span class='ocr_line' id='line_1_153' title="bbox 369 9057 1375 9101; baseline 0 -12; x_size 43; x_descenders 11; x_ascenders 12"><span class='ocrx_word' id='word_1_893' title='bbox 369 9059 556 9100; x_wconf 93' lang='eng' dir='ltr'>Burroughs</span> <span class='ocrx_word' id='word_1_894' title='bbox 571 9059 605 9089; x_wconf 92' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_895' title='bbox 621 9067 706 9100; x_wconf 83' lang='eng'>1972,</span> <span class='ocrx_word' id='word_1_896' title='bbox 723 9065 757 9089; x_wconf 95' lang='eng' dir='ltr'>at</span> <span class='ocrx_word' id='word_1_897' title='bbox 772 9059 828 9089; x_wconf 94' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_898' title='bbox 843 9069 925 9099; x_wconf 91' lang='eng' dir='ltr'>cusp</span> <span class='ocrx_word' id='word_1_899' title='bbox 941 9059 980 9089; x_wconf 93' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_900' title='bbox 993 9057 1340 9101; x_wconf 83' lang='eng' dir='ltr'>K(ondratieff)-wave</span> <span class='ocrx_word' id='word_1_901' title='bbox 1355 9067 1375 9100; x_wconf 85' lang='eng'><em>9</em></span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_3' title="bbox 362 9127 1374 10513">
<p class='ocr_par' dir='ltr' id='par_1_23' title="bbox 362 9127 1374 9803">
<span class='ocr_line' id='line_1_154' title="bbox 365 9127 1374 9172; baseline 0 -13; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_902' title='bbox 365 9127 435 9172; x_wconf 94' lang='eng' dir='ltr'>(the</span> <span class='ocrx_word' id='word_1_903' title='bbox 448 9129 620 9159; x_wconf 93' lang='eng' dir='ltr'>threshold</span> <span class='ocrx_word' id='word_1_904' title='bbox 632 9129 669 9159; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_905' title='bbox 677 9128 974 9172; x_wconf 92' lang='eng' dir='ltr'>postmodernity).</span> <span class='ocrx_word' id='word_1_906' title='bbox 990 9130 1015 9159; x_wconf 95' lang='eng' dir='ltr'>It</span> <span class='ocrx_word' id='word_1_907' title='bbox 1027 9129 1155 9169; x_wconf 92' lang='eng' dir='ltr'>rapidly</span> <span class='ocrx_word' id='word_1_908' title='bbox 1164 9129 1374 9169; x_wconf 89' lang='eng' dir='ltr'>reprocessed</span>
</span>
<span class='ocr_line' id='line_1_155' title="bbox 364 9189 1374 9230; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_909' title='bbox 364 9189 405 9219; x_wconf 94' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_910' title='bbox 420 9195 523 9230; x_wconf 94' lang='eng' dir='ltr'>target</span> <span class='ocrx_word' id='word_1_911' title='bbox 536 9189 610 9219; x_wconf 93' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_912' title='bbox 623 9199 667 9219; x_wconf 93' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_913' title='bbox 681 9189 884 9230; x_wconf 93' lang='eng' dir='ltr'>intelligenic</span> <span class='ocrx_word' id='word_1_914' title='bbox 900 9199 944 9219; x_wconf 93' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_915' title='bbox 955 9199 1013 9229; x_wconf 93' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_916' title='bbox 1024 9199 1079 9229; x_wconf 91' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_917' title='bbox 1094 9199 1138 9219; x_wconf 93' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_918' title='bbox 1153 9199 1197 9219; x_wconf 93' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_919' title='bbox 1212 9199 1374 9219; x_wconf 90' lang='eng' dir='ltr'>nova-war</span>
</span>
<span class='ocr_line' id='line_1_156' title="bbox 365 9246 1372 9287; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_920' title='bbox 365 9246 561 9286; x_wconf 91' lang='eng' dir='ltr'>laboratory,</span> <span class='ocrx_word' id='word_1_921' title='bbox 570 9246 779 9287; x_wconf 93' lang='eng' dir='ltr'>volatilizing</span> <span class='ocrx_word' id='word_1_922' title='bbox 788 9246 842 9276; x_wconf 94' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_923' title='bbox 854 9246 980 9286; x_wconf 92' lang='eng' dir='ltr'>history</span> <span class='ocrx_word' id='word_1_924' title='bbox 988 9246 1026 9276; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_925' title='bbox 1032 9246 1194 9287; x_wconf 93' lang='eng' dir='ltr'>language</span> <span class='ocrx_word' id='word_1_926' title='bbox 1204 9246 1275 9276; x_wconf 93' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_927' title='bbox 1284 9246 1372 9276; x_wconf 92' lang='eng' dir='ltr'>invo-</span>
</span>
<span class='ocr_line' id='line_1_157' title="bbox 364 9305 1370 9346; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_928' title='bbox 364 9305 530 9345; x_wconf 91' lang='eng' dir='ltr'>lutionary</span> <span class='ocrx_word' id='word_1_929' title='bbox 539 9305 745 9335; x_wconf 94' lang='eng' dir='ltr'>word-virus.</span> <span class='ocrx_word' id='word_1_930' title='bbox 759 9305 931 9335; x_wconf 93' lang='eng' dir='ltr'>Mutation</span> <span class='ocrx_word' id='word_1_931' title='bbox 941 9311 990 9335; x_wconf 95' lang='eng' dir='ltr'>rat</span> <span class='ocrx_word' id='word_1_932' title='bbox 1000 9311 1047 9335; x_wconf 95' lang='eng' dir='ltr'>rat</span> <span class='ocrx_word' id='word_1_933' title='bbox 1058 9311 1106 9335; x_wconf 95' lang='eng' dir='ltr'>rat</span> <span class='ocrx_word' id='word_1_934' title='bbox 1116 9311 1164 9335; x_wconf 95' lang='eng' dir='ltr'>rat</span> <span class='ocrx_word' id='word_1_935' title='bbox 1175 9311 1259 9335; x_wconf 94' lang='eng' dir='ltr'>rates</span> <span class='ocrx_word' id='word_1_936' title='bbox 1264 9305 1370 9346; x_wconf 80' lang='eng' dir='ltr'>jump.</span>
</span>
<span class='ocr_line' id='line_1_158' title="bbox 362 9363 1373 9404; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_937' title='bbox 362 9364 479 9393; x_wconf 94' lang='eng' dir='ltr'>Vector</span> <span class='ocrx_word' id='word_1_938' title='bbox 498 9363 650 9393; x_wconf 94' lang='eng' dir='ltr'>switches</span> <span class='ocrx_word' id='word_1_939' title='bbox 670 9363 817 9404; x_wconf 94' lang='eng' dir='ltr'>through</span> <span class='ocrx_word' id='word_1_940' title='bbox 838 9363 958 9400; x_wconf 94' lang='eng' dir='ltr'>Butler,</span> <span class='ocrx_word' id='word_1_941' title='bbox 977 9363 1117 9400; x_wconf 93' lang='eng' dir='ltr'>Gibson,</span> <span class='ocrx_word' id='word_1_942' title='bbox 1136 9363 1206 9393; x_wconf 93' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_943' title='bbox 1222 9363 1373 9404; x_wconf 92' lang='eng' dir='ltr'>Cadigan</span>
</span>
<span class='ocr_line' id='line_1_159' title="bbox 364 9422 1371 9463; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_944' title='bbox 364 9422 523 9452; x_wconf 93' lang='eng' dir='ltr'>fine-tune</span> <span class='ocrx_word' id='word_1_945' title='bbox 540 9422 581 9452; x_wconf 94' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_946' title='bbox 596 9422 750 9463; x_wconf 92' lang='eng' dir='ltr'>synergic</span> <span class='ocrx_word' id='word_1_947' title='bbox 765 9422 1039 9459; x_wconf 90' lang='eng' dir='ltr'>interexcitation,</span> <span class='ocrx_word' id='word_1_948' title='bbox 1057 9422 1169 9462; x_wconf 93' lang='eng' dir='ltr'>silt-up</span> <span class='ocrx_word' id='word_1_949' title='bbox 1185 9422 1371 9462; x_wconf 90' lang='eng' dir='ltr'>cybershift-</span>
</span>
<span class='ocr_line' id='line_1_160' title="bbox 364 9478 1370 9523; baseline 0 -13; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_950' title='bbox 364 9480 527 9521; x_wconf 93' lang='eng' dir='ltr'>inducing</span> <span class='ocrx_word' id='word_1_951' title='bbox 543 9478 887 9523; x_wconf 89' lang='eng' dir='ltr'>K(uang)-potential,</span> <span class='ocrx_word' id='word_1_952' title='bbox 905 9480 972 9510; x_wconf 93' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_953' title='bbox 988 9480 1171 9510; x_wconf 92' lang='eng' dir='ltr'>trend-lock</span> <span class='ocrx_word' id='word_1_954' title='bbox 1184 9486 1267 9510; x_wconf 93' lang='eng' dir='ltr'>onto</span> <span class='ocrx_word' id='word_1_955' title='bbox 1284 9488 1370 9511; x_wconf 85' lang='eng'>11001</span>
</span>
<span class='ocr_line' id='line_1_161' title="bbox 364 9547 1371 9569; baseline 0.001 -1; x_size 41.848484; x_descenders 10.848485; x_ascenders 10.450311"><span class='ocrx_word' id='word_1_956' title='bbox 364 9547 1371 9569; x_wconf 91' lang='eng'>01001001010111101001011101011001000100010100100010</span>
</span>
<span class='ocr_line' id='line_1_162' title="bbox 364 9606 1371 9628; baseline 0 0; x_size 41.848484; x_descenders 10.848485; x_ascenders 10.450311"><span class='ocrx_word' id='word_1_957' title='bbox 364 9606 1371 9628; x_wconf 94' lang='eng'>01001001001001010010110100100100100100100100111010</span>
</span>
<span class='ocr_line' id='line_1_163' title="bbox 364 9656 1371 9696; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 9"><span class='ocrx_word' id='word_1_958' title='bbox 364 9665 1011 9686; x_wconf 97' lang='eng'>0100100100011001000101100101010</span> <span class='ocrx_word' id='word_1_959' title='bbox 1026 9656 1157 9696; x_wconf 88' lang='eng' dir='ltr'>K-punk</span> <span class='ocrx_word' id='word_1_960' title='bbox 1168 9656 1281 9696; x_wconf 91' lang='eng' dir='ltr'>pulses</span> <span class='ocrx_word' id='word_1_961' title='bbox 1291 9656 1371 9686; x_wconf 94' lang='eng' dir='ltr'>with</span>
</span>
<span class='ocr_line' id='line_1_164' title="bbox 365 9714 1372 9755; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_962' title='bbox 365 9714 828 9755; x_wconf 93' lang='eng' dir='ltr'>telematically-accelerating</span> <span class='ocrx_word' id='word_1_963' title='bbox 839 9714 1077 9754; x_wconf 93' lang='eng' dir='ltr'>neoreplicator</span> <span class='ocrx_word' id='word_1_964' title='bbox 1086 9714 1225 9754; x_wconf 93' lang='eng' dir='ltr'>plicator</span> <span class='ocrx_word' id='word_1_965' title='bbox 1234 9714 1372 9754; x_wconf 93' lang='eng' dir='ltr'>plicator</span>
</span>
<span class='ocr_line' id='line_1_165' title="bbox 363 9773 639 9803; baseline 0 0; x_size 40.558296; x_descenders 10.558295; x_ascenders 10"><span class='ocrx_word' id='word_1_966' title='bbox 363 9773 639 9803; x_wconf 93' lang='eng' dir='ltr'>contamination.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_24' title="bbox 362 9828 1370 10095">
<span class='ocr_line' id='line_1_166' title="bbox 428 9828 1370 9872; baseline 0.001 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_967' title='bbox 428 9828 595 9872; x_wconf 78' lang='eng' dir='ltr'>Looking</span> <span class='ocrx_word' id='word_1_968' title='bbox 605 9831 661 9861; x_wconf 95' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_969' title='bbox 672 9841 691 9861; x_wconf 94' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_970' title='bbox 705 9831 753 9861; x_wconf 96' lang='eng' dir='ltr'>hit</span> <span class='ocrx_word' id='word_1_971' title='bbox 766 9831 805 9861; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_972' title='bbox 815 9829 1032 9861; x_wconf 81' lang='eng' dir='ltr'>snowcrash?</span> <span class='ocrx_word' id='word_1_973' title='bbox 1045 9835 1065 9861; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_974' title='bbox 1077 9835 1138 9861; x_wconf 47' lang='eng' dir='ltr'>Wit</span> <span class='ocrx_word' id='word_1_975' title='bbox 1149 9835 1169 9861; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_976' title='bbox 1202 9835 1244 9861; x_wconf 72' lang='eng'>##</span> <span class='ocrx_word' id='word_1_977' title='bbox 1267 9836 1284 9861; x_wconf 74' lang='eng'>#</span> <span class='ocrx_word' id='word_1_978' title='bbox 1306 9836 1326 9862; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_979' title='bbox 1350 9836 1370 9862; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_167' title="bbox 362 9894 1370 9920; baseline 0 0; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_980' title='bbox 362 9894 446 9920; x_wconf 72' lang='eng'>###</span> <span class='ocrx_word' id='word_1_981' title='bbox 478 9894 849 9920; x_wconf 55' lang='eng' dir='ltr'>##W########</span> <span class='ocrx_word' id='word_1_982' title='bbox 882 9894 988 9920; x_wconf 44' lang='eng'>##1##</span> <span class='ocrx_word' id='word_1_983' title='bbox 1040 9894 1204 9920; x_wconf 69' lang='eng'>######</span> <span class='ocrx_word' id='word_1_984' title='bbox 1247 9894 1267 9920; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_985' title='bbox 1296 9894 1317 9920; x_wconf 70' lang='eng'>#</span> <span class='ocrx_word' id='word_1_986' title='bbox 1350 9894 1370 9920; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_168' title="bbox 362 9952 1369 9979; baseline 0 -1; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_987' title='bbox 362 9952 467 9978; x_wconf 70' lang='eng'>####</span> <span class='ocrx_word' id='word_1_988' title='bbox 502 9952 522 9978; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_989' title='bbox 557 9952 663 9978; x_wconf 54' lang='eng'>##1##</span> <span class='ocrx_word' id='word_1_990' title='bbox 697 9952 717 9978; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_991' title='bbox 752 9952 772 9978; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_992' title='bbox 807 9952 827 9978; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_993' title='bbox 861 9952 968 9978; x_wconf 71' lang='eng'>###</span> <span class='ocrx_word' id='word_1_994' title='bbox 1002 9952 1242 9978; x_wconf 71' lang='eng'>#######</span> <span class='ocrx_word' id='word_1_995' title='bbox 1275 9954 1293 9978; x_wconf 73' lang='eng'>#</span> <span class='ocrx_word' id='word_1_996' title='bbox 1349 9953 1369 9979; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_169' title="bbox 363 10011 1370 10037; baseline 0 0; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_997' title='bbox 363 10011 529 10037; x_wconf 71' lang='eng'>#######</span> <span class='ocrx_word' id='word_1_998' title='bbox 585 10011 732 10037; x_wconf 64' lang='eng'>#####=#</span> <span class='ocrx_word' id='word_1_999' title='bbox 798 10011 840 10037; x_wconf 70' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1000' title='bbox 861 10011 1008 10037; x_wconf 69' lang='eng'>#####</span> <span class='ocrx_word' id='word_1_1001' title='bbox 1040 10011 1080 10037; x_wconf 70' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1002' title='bbox 1112 10011 1132 10037; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1003' title='bbox 1185 10011 1205 10037; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1004' title='bbox 1238 10011 1370 10037; x_wconf 68' lang='eng'>#####</span>
</span>
<span class='ocr_line' id='line_1_170' title="bbox 362 10069 1191 10095; baseline 0 0; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_1005' title='bbox 362 10069 446 10095; x_wconf 71' lang='eng'>###</span> <span class='ocrx_word' id='word_1_1006' title='bbox 480 10069 1002 10095; x_wconf 70' lang='eng'>###############</span> <span class='ocrx_word' id='word_1_1007' title='bbox 1044 10069 1084 10095; x_wconf 70' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1008' title='bbox 1117 10069 1137 10095; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1009' title='bbox 1170 10069 1191 10095; x_wconf 70' lang='eng'>#</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_25' title="bbox 362 10123 1370 10513">
<span class='ocr_line' id='line_1_171' title="bbox 424 10123 1369 10163; baseline 0.001 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_1010' title='bbox 424 10123 469 10153; x_wconf 90' lang='eng' dir='ltr'>As</span> <span class='ocrx_word' id='word_1_1011' title='bbox 478 10123 699 10163; x_wconf 93' lang='eng' dir='ltr'>postmodern</span> <span class='ocrx_word' id='word_1_1012' title='bbox 708 10123 834 10153; x_wconf 94' lang='eng' dir='ltr'>culture</span> <span class='ocrx_word' id='word_1_1013' title='bbox 844 10133 967 10153; x_wconf 94' lang='eng' dir='ltr'>crosses</span> <span class='ocrx_word' id='word_1_1014' title='bbox 978 10129 1011 10153; x_wconf 97' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_1015' title='bbox 1020 10123 1228 10163; x_wconf 90' lang='eng' dir='ltr'>hypermania</span> <span class='ocrx_word' id='word_1_1016' title='bbox 1239 10123 1297 10153; x_wconf 91' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_1017' title='bbox 1307 10128 1369 10154; x_wconf 51' lang='eng'>##1##</span>
</span>
<span class='ocr_line' id='line_1_172' title="bbox 362 10186 1370 10213; baseline 0 -1; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_1018' title='bbox 362 10186 1288 10212; x_wconf 56' lang='eng' dir='ltr'>######################W#</span> <span class='ocrx_word' id='word_1_1019' title='bbox 1350 10187 1370 10213; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_173' title="bbox 363 10244 1368 10270; baseline 0 0; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_1020' title='bbox 363 10244 384 10270; x_wconf 70' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1021' title='bbox 416 10244 510 10270; x_wconf 71' lang='eng'>####</span> <span class='ocrx_word' id='word_1_1022' title='bbox 544 10244 779 10270; x_wconf 69' lang='eng'>#######</span> <span class='ocrx_word' id='word_1_1023' title='bbox 814 10244 834 10270; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1024' title='bbox 868 10244 1314 10270; x_wconf 56' lang='eng' dir='ltr'>##########W#</span> <span class='ocrx_word' id='word_1_1025' title='bbox 1348 10244 1368 10270; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_174' title="bbox 363 10302 1369 10329; baseline 0 -1; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_1026' title='bbox 363 10302 941 10328; x_wconf 68' lang='eng'>#################</span> <span class='ocrx_word' id='word_1_1027' title='bbox 983 10302 1043 10328; x_wconf 71' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1028' title='bbox 1084 10302 1104 10328; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1029' title='bbox 1146 10302 1305 10328; x_wconf 43' lang='eng' dir='ltr'>##fitfi</span> <span class='ocrx_word' id='word_1_1030' title='bbox 1349 10303 1369 10329; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_175' title="bbox 362 10361 1369 10387; baseline 0 0; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_1031' title='bbox 362 10361 476 10387; x_wconf 72' lang='eng'>#####</span> <span class='ocrx_word' id='word_1_1032' title='bbox 533 10361 574 10387; x_wconf 72' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1033' title='bbox 594 10361 738 10387; x_wconf 56' lang='eng'>######</span> <span class='ocrx_word' id='word_1_1034' title='bbox 777 10361 827 10387; x_wconf 71' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1035' title='bbox 847 10361 868 10387; x_wconf 70' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1036' title='bbox 888 10361 949 10387; x_wconf 51' lang='eng' dir='ltr'><em>W</em></span> <span class='ocrx_word' id='word_1_1037' title='bbox 969 10361 1009 10387; x_wconf 70' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1038' title='bbox 1036 10361 1076 10387; x_wconf 70' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1039' title='bbox 1104 10361 1124 10387; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1040' title='bbox 1143 10361 1251 10387; x_wconf 71' lang='eng'>####</span> <span class='ocrx_word' id='word_1_1041' title='bbox 1270 10361 1369 10387; x_wconf 69' lang='eng'>####</span>
</span>
<span class='ocr_line' id='line_1_176' title="bbox 362 10414 1368 10455; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_1042' title='bbox 362 10418 383 10444; x_wconf 70' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1043' title='bbox 395 10420 472 10454; x_wconf 92' lang='eng' dir='ltr'>stop</span> <span class='ocrx_word' id='word_1_1044' title='bbox 484 10420 561 10454; x_wconf 92' lang='eng' dir='ltr'>stop</span> <span class='ocrx_word' id='word_1_1045' title='bbox 573 10424 618 10455; x_wconf 94' lang='eng' dir='ltr'>go</span> <span class='ocrx_word' id='word_1_1046' title='bbox 631 10420 708 10454; x_wconf 92' lang='eng' dir='ltr'>stop</span> <span class='ocrx_word' id='word_1_1047' title='bbox 720 10424 765 10455; x_wconf 94' lang='eng' dir='ltr'>go</span> <span class='ocrx_word' id='word_1_1048' title='bbox 778 10420 854 10454; x_wconf 92' lang='eng' dir='ltr'>stop</span> <span class='ocrx_word' id='word_1_1049' title='bbox 866 10424 912 10455; x_wconf 94' lang='eng' dir='ltr'>go</span> <span class='ocrx_word' id='word_1_1050' title='bbox 924 10424 968 10455; x_wconf 93' lang='eng' dir='ltr'>go</span> <span class='ocrx_word' id='word_1_1051' title='bbox 980 10424 1059 10455; x_wconf 94' lang='eng' dir='ltr'>goes</span> <span class='ocrx_word' id='word_1_1052' title='bbox 1073 10424 1163 10451; x_wconf 92' lang='eng' dir='ltr'>nova,</span> <span class='ocrx_word' id='word_1_1053' title='bbox 1179 10414 1201 10444; x_wconf 95' lang='eng' dir='ltr'>it</span> <span class='ocrx_word' id='word_1_1054' title='bbox 1214 10414 1368 10455; x_wconf 85' lang='eng' dir='ltr'>singular-</span>
</span>
<span class='ocr_line' id='line_1_177' title="bbox 364 10472 1370 10513; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_1055' title='bbox 364 10472 429 10502; x_wconf 94' lang='eng' dir='ltr'>izes</span> <span class='ocrx_word' id='word_1_1056' title='bbox 437 10472 675 10512; x_wconf 93' lang='eng' dir='ltr'>multiplicities</span> <span class='ocrx_word' id='word_1_1057' title='bbox 682 10472 772 10502; x_wconf 94' lang='eng' dir='ltr'>cities</span> <span class='ocrx_word' id='word_1_1058' title='bbox 782 10472 871 10502; x_wconf 94' lang='eng' dir='ltr'>cities</span> <span class='ocrx_word' id='word_1_1059' title='bbox 881 10472 919 10502; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_1060' title='bbox 926 10472 1095 10512; x_wconf 92' lang='eng' dir='ltr'>invasively</span> <span class='ocrx_word' id='word_1_1061' title='bbox 1103 10472 1370 10513; x_wconf 90' lang='eng' dir='ltr'>autoreplicating</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_4' title="bbox 364 10529 1370 10634">
<p class='ocr_par' dir='ltr' id='par_1_26' title="bbox 364 10529 1370 10634">
<span class='ocr_line' id='line_1_178' title="bbox 364 10529 1365 10575; baseline -0.002 -14; x_size 42; x_descenders 11; x_ascenders 11"><span class='ocrx_word' id='word_1_1062' title='bbox 364 10531 644 10572; x_wconf 93' lang='eng' dir='ltr'>autoreplicating</span> <span class='ocrx_word' id='word_1_1063' title='bbox 652 10531 897 10571; x_wconf 89' lang='eng' dir='ltr'>plexoweapon</span> <span class='ocrx_word' id='word_1_1064' title='bbox 908 10547 930 10551; x_wconf 98' lang='eng'><em>-</em></span> <span class='ocrx_word' id='word_1_1065' title='bbox 941 10537 1074 10571; x_wconf 93' lang='eng' dir='ltr'>systems</span> <span class='ocrx_word' id='word_1_1066' title='bbox 1086 10529 1138 10574; x_wconf 70' lang='eng'>(0</span> <span class='ocrx_word' id='word_1_1067' title='bbox 1152 10530 1163 10574; x_wconf 91' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1068' title='bbox 1175 10530 1244 10575; x_wconf 89' lang='eng'>((()</span> <span class='ocrx_word' id='word_1_1069' title='bbox 1258 10529 1298 10574; x_wconf 91' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_1070' title='bbox 1312 10529 1324 10574; x_wconf 92' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1071' title='bbox 1337 10530 1365 10575; x_wconf 86' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_179' title="bbox 365 10586 1370 10634; baseline -0.006 0; x_size 59.8125; x_descenders 15.8125; x_ascenders 15.8125"><span class='ocrx_word' id='word_1_1072' title='bbox 365 10587 420 10634; x_wconf 86' lang='eng'>())</span> <span class='ocrx_word' id='word_1_1073' title='bbox 435 10589 481 10634; x_wconf 90' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_1074' title='bbox 494 10589 506 10633; x_wconf 91' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1075' title='bbox 521 10587 550 10632; x_wconf 89' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1076' title='bbox 562 10588 601 10632; x_wconf 88' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1077' title='bbox 617 10587 629 10632; x_wconf 91' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1078' title='bbox 643 10586 722 10632; x_wconf 69' lang='eng' dir='ltr'>D»)</span> <span class='ocrx_word' id='word_1_1079' title='bbox 737 10587 749 10632; x_wconf 93' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1080' title='bbox 763 10588 776 10632; x_wconf 90' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1081' title='bbox 790 10587 802 10632; x_wconf 93' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1082' title='bbox 816 10586 862 10630; x_wconf 85' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1083' title='bbox 885 10586 898 10630; x_wconf 88' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1084' title='bbox 914 10587 982 10617; x_wconf 65' lang='eng' dir='ltr'>that</span> <span class='ocrx_word' id='word_1_1085' title='bbox 993 10597 1044 10617; x_wconf 66' lang='eng' dir='ltr'>are</span> <span class='ocrx_word' id='word_1_1086' title='bbox 1056 10597 1087 10617; x_wconf 70' lang='eng' dir='ltr'>r6</span> <span class='ocrx_word' id='word_1_1087' title='bbox 1098 10597 1130 10617; x_wconf 70' lang='eng' dir='ltr'>r6</span> <span class='ocrx_word' id='word_1_1088' title='bbox 1142 10597 1174 10617; x_wconf 70' lang='eng' dir='ltr'>r6</span> <span class='ocrx_word' id='word_1_1089' title='bbox 1185 10597 1216 10617; x_wconf 70' lang='eng' dir='ltr'>r6</span> <span class='ocrx_word' id='word_1_1090' title='bbox 1229 10587 1370 10628; x_wconf 72' lang='eng' dir='ltr'>nothing</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_5' title="bbox 360 10647 1376 11679">
<p class='ocr_par' dir='ltr' id='par_1_27' title="bbox 360 10647 1376 11679">
<span class='ocr_line' id='line_1_180' title="bbox 365 10647 1367 10688; baseline -0.001 -10; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_1091' title='bbox 365 10648 500 10688; x_wconf 92' lang='eng' dir='ltr'>beyond</span> <span class='ocrx_word' id='word_1_1092' title='bbox 516 10647 598 10677; x_wconf 94' lang='eng' dir='ltr'>their</span> <span class='ocrx_word' id='word_1_1093' title='bbox 611 10657 679 10677; x_wconf 94' lang='eng' dir='ltr'>war</span> <span class='ocrx_word' id='word_1_1094' title='bbox 689 10647 786 10677; x_wconf 94' lang='eng' dir='ltr'>AGA</span> <span class='ocrx_word' id='word_1_1095' title='bbox 792 10647 889 10677; x_wconf 94' lang='eng' dir='ltr'>AGA</span> <span class='ocrx_word' id='word_1_1096' title='bbox 900 10647 1027 10688; x_wconf 93' lang='eng' dir='ltr'>against</span> <span class='ocrx_word' id='word_1_1097' title='bbox 1040 10647 1181 10687; x_wconf 92' lang='eng' dir='ltr'>security.</span> <span class='ocrx_word' id='word_1_1098' title='bbox 1195 10647 1269 10677; x_wconf 88' lang='eng' dir='ltr'>This</span> <span class='ocrx_word' id='word_1_1099' title='bbox 1281 10647 1307 10677; x_wconf 95' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_1100' title='bbox 1324 10657 1367 10677; x_wconf 93' lang='eng' dir='ltr'>no</span>
</span>
<span class='ocr_line' id='line_1_181' title="bbox 361 10706 1373 10747; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_1101' title='bbox 361 10706 478 10747; x_wconf 91' lang='eng' dir='ltr'>longer</span> <span class='ocrx_word' id='word_1_1102' title='bbox 487 10716 505 10736; x_wconf 97' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_1103' title='bbox 514 10706 668 10746; x_wconf 90' lang='eng' dir='ltr'>question</span> <span class='ocrx_word' id='word_1_1104' title='bbox 677 10716 723 10736; x_wconf 94' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_1105' title='bbox 733 10706 785 10736; x_wconf 85' lang='eng' dir='ltr'>off</span> <span class='ocrx_word' id='word_1_1106' title='bbox 790 10716 837 10736; x_wconf 94' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_1107' title='bbox 846 10706 885 10736; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_1108' title='bbox 892 10706 1092 10747; x_wconf 91' lang='eng' dir='ltr'>ideological</span> <span class='ocrx_word' id='word_1_1109' title='bbox 1103 10706 1373 10746; x_wconf 92' lang='eng' dir='ltr'>representation,</span>
</span>
<span class='ocr_line' id='line_1_182' title="bbox 361 10762 1375 10803; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_1110' title='bbox 361 10772 567 10803; x_wconf 90' lang='eng' dir='ltr'>exogeneous</span> <span class='ocrx_word' id='word_1_1111' title='bbox 577 10762 723 10802; x_wconf 94' lang='eng' dir='ltr'>political</span> <span class='ocrx_word' id='word_1_1112' title='bbox 733 10762 972 10799; x_wconf 92' lang='eng' dir='ltr'>mobilization,</span> <span class='ocrx_word' id='word_1_1113' title='bbox 984 10762 1170 10792; x_wconf 94' lang='eng' dir='ltr'>theoretical</span> <span class='ocrx_word' id='word_1_1114' title='bbox 1180 10762 1326 10802; x_wconf 94' lang='eng' dir='ltr'>critique,</span> <span class='ocrx_word' id='word_1_1115' title='bbox 1335 10767 1375 10792; x_wconf 75' lang='eng'>##</span>
</span>
<span class='ocr_line' id='line_1_183' title="bbox 360 10826 1374 10851; baseline 0 0; x_size 34.235298; x_descenders 9.2352991; x_ascenders 8.5866337"><span class='ocrx_word' id='word_1_1116' title='bbox 360 10826 555 10851; x_wconf 74' lang='eng'>########</span> <span class='ocrx_word' id='word_1_1117' title='bbox 577 10826 597 10851; x_wconf 76' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1118' title='bbox 618 10826 1227 10851; x_wconf 64' lang='eng'>######################</span> <span class='ocrx_word' id='word_1_1119' title='bbox 1271 10826 1374 10851; x_wconf 73' lang='eng'>####</span>
</span>
<span class='ocr_line' id='line_1_184' title="bbox 361 10880 1373 10921; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_1120' title='bbox 361 10885 402 10911; x_wconf 73' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1121' title='bbox 435 10885 455 10910; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1122' title='bbox 467 10885 487 10910; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1123' title='bbox 499 10885 519 10910; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1124' title='bbox 551 10885 571 10910; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1125' title='bbox 583 10885 603 10910; x_wconf 76' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1126' title='bbox 615 10885 677 10910; x_wconf 76' lang='eng'>###</span> <span class='ocrx_word' id='word_1_1127' title='bbox 734 10885 754 10910; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1128' title='bbox 777 10885 797 10910; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1129' title='bbox 844 10885 864 10910; x_wconf 76' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1130' title='bbox 876 10884 939 10910; x_wconf 54' lang='eng' dir='ltr'>#W</span> <span class='ocrx_word' id='word_1_1131' title='bbox 985 10885 1005 10910; x_wconf 76' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1132' title='bbox 1018 10890 1057 10910; x_wconf 94' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_1133' title='bbox 1070 10880 1222 10921; x_wconf 90' lang='eng' dir='ltr'>strategic</span> <span class='ocrx_word' id='word_1_1134' title='bbox 1235 10880 1373 10910; x_wconf 93' lang='eng' dir='ltr'>orienta-</span>
</span>
<span class='ocr_line' id='line_1_185' title="bbox 364 10938 1376 10979; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_1135' title='bbox 364 10938 443 10974; x_wconf 94' lang='eng' dir='ltr'>tion,</span> <span class='ocrx_word' id='word_1_1136' title='bbox 456 10938 516 10968; x_wconf 94' lang='eng' dir='ltr'>but</span> <span class='ocrx_word' id='word_1_1137' title='bbox 528 10938 564 10968; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_1138' title='bbox 573 10938 818 10968; x_wconf 94' lang='eng' dir='ltr'>decentralized</span> <span class='ocrx_word' id='word_1_1139' title='bbox 829 10938 971 10968; x_wconf 94' lang='eng' dir='ltr'>cultural</span> <span class='ocrx_word' id='word_1_1140' title='bbox 983 10938 1148 10979; x_wconf 90' lang='eng' dir='ltr'>diagrams</span> <span class='ocrx_word' id='word_1_1141' title='bbox 1163 10938 1376 10979; x_wconf 88' lang='eng' dir='ltr'>functioning</span>
</span>
<span class='ocr_line' id='line_1_186' title="bbox 362 10996 1373 11037; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_1142' title='bbox 362 11006 396 11026; x_wconf 92' lang='eng' dir='ltr'>as</span> <span class='ocrx_word' id='word_1_1143' title='bbox 407 10996 588 11026; x_wconf 92' lang='eng' dir='ltr'>immanent</span> <span class='ocrx_word' id='word_1_1144' title='bbox 599 10996 704 11026; x_wconf 89' lang='eng' dir='ltr'>forces</span> <span class='ocrx_word' id='word_1_1145' title='bbox 716 10996 755 11026; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_1146' title='bbox 762 10996 986 11037; x_wconf 90' lang='eng' dir='ltr'>antagonism.</span> <span class='ocrx_word' id='word_1_1147' title='bbox 1000 11005 1105 11026; x_wconf 89' lang='eng' dir='ltr'>K-war</span> <span class='ocrx_word' id='word_1_1148' title='bbox 1113 10996 1242 11026; x_wconf 92' lang='eng' dir='ltr'>derives</span> <span class='ocrx_word' id='word_1_1149' title='bbox 1253 10996 1292 11026; x_wconf 92' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_1150' title='bbox 1305 10996 1373 11026; x_wconf 92' lang='eng' dir='ltr'>sole</span>
</span>
<span class='ocr_line' id='line_1_187' title="bbox 362 11054 1207 11094; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_1151' title='bbox 362 11054 541 11084; x_wconf 94' lang='eng' dir='ltr'>coherence</span> <span class='ocrx_word' id='word_1_1152' title='bbox 555 11054 638 11084; x_wconf 88' lang='eng' dir='ltr'>from</span> <span class='ocrx_word' id='word_1_1153' title='bbox 653 11054 708 11084; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_1154' title='bbox 722 11054 815 11094; x_wconf 93' lang='eng' dir='ltr'>unity</span> <span class='ocrx_word' id='word_1_1155' title='bbox 828 11054 867 11084; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_1156' title='bbox 877 11054 916 11084; x_wconf 92' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_1157' title='bbox 933 11054 996 11084; x_wconf 88' lang='eng' dir='ltr'>foe.</span> <span class='ocrx_word' id='word_1_1158' title='bbox 1013 11055 1207 11084; x_wconf 92' lang='eng' dir='ltr'><a href="0.html"> RETURN.</a></span>
</span>
<span class='ocr_line' id='line_1_188' title="bbox 423 11109 1371 11155; baseline 0 -13; x_size 45; x_descenders 12; x_ascenders 13"><span class='ocrx_word' id='word_1_1159' title='bbox 423 11111 598 11150; x_wconf 92' lang='eng' dir='ltr'>Ana/Cata.</span> <span class='ocrx_word' id='word_1_1160' title='bbox 610 11112 728 11142; x_wconf 97' lang='eng' dir='ltr'>Switch</span> <span class='ocrx_word' id='word_1_1161' title='bbox 735 11110 1004 11155; x_wconf 89' lang='eng' dir='ltr'>cur((re)re)rent.</span> <span class='ocrx_word' id='word_1_1162' title='bbox 1016 11110 1044 11155; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1163' title='bbox 1054 11110 1066 11154; x_wconf 89' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1164' title='bbox 1078 11109 1106 11154; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1165' title='bbox 1116 11109 1159 11154; x_wconf 88' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1166' title='bbox 1170 11110 1235 11155; x_wconf 93' lang='eng' dir='ltr'>O(r</span> <span class='ocrx_word' id='word_1_1167' title='bbox 1241 11110 1338 11155; x_wconf 89' lang='eng' dir='ltr'>an)d(</span> <span class='ocrx_word' id='word_1_1168' title='bbox 1348 11111 1371 11155; x_wconf 89' lang='eng'>).</span>
</span>
<span class='ocr_line' id='line_1_189' title="bbox 365 11167 1372 11213; baseline 0 -13; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_1169' title='bbox 365 11168 430 11213; x_wconf 90' lang='eng' dir='ltr'>K0(</span> <span class='ocrx_word' id='word_1_1170' title='bbox 448 11171 461 11199; x_wconf 95' lang='eng' dir='ltr'>I</span> <span class='ocrx_word' id='word_1_1171' title='bbox 477 11170 588 11211; x_wconf 91' lang='eng' dir='ltr'>Ching</span> <span class='ocrx_word' id='word_1_1172' title='bbox 603 11170 781 11211; x_wconf 91' lang='eng' dir='ltr'>hexagram</span> <span class='ocrx_word' id='word_1_1173' title='bbox 811 11179 862 11211; x_wconf 78' lang='eng'>49:</span> <span class='ocrx_word' id='word_1_1174' title='bbox 882 11170 1085 11200; x_wconf 93' lang='eng' dir='ltr'>Revolution</span> <span class='ocrx_word' id='word_1_1175' title='bbox 1100 11167 1266 11212; x_wconf 91' lang='eng' dir='ltr'>(Molting</span> <span class='ocrx_word' id='word_1_1176' title='bbox 1280 11168 1309 11212; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1177' title='bbox 1326 11168 1372 11213; x_wconf 89' lang='eng'>)))</span>
</span>
<span class='ocr_line' id='line_1_190' title="bbox 363 11225 1372 11271; baseline 0 -13; x_size 45; x_descenders 12; x_ascenders 13"><span class='ocrx_word' id='word_1_1178' title='bbox 363 11228 466 11258; x_wconf 93' lang='eng' dir='ltr'>leaves</span> <span class='ocrx_word' id='word_1_1179' title='bbox 483 11225 495 11270; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1180' title='bbox 512 11226 524 11270; x_wconf 91' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1181' title='bbox 540 11228 684 11269; x_wconf 91' lang='eng' dir='ltr'>nothing</span> <span class='ocrx_word' id='word_1_1182' title='bbox 697 11227 816 11271; x_wconf 89' lang='eng' dir='ltr'>i)ntact</span> <span class='ocrx_word' id='word_1_1183' title='bbox 829 11228 945 11258; x_wconf 93' lang='eng' dir='ltr'>TACT</span> <span class='ocrx_word' id='word_1_1184' title='bbox 957 11228 1078 11258; x_wconf 91' lang='eng' dir='ltr'>TACT.</span> <span class='ocrx_word' id='word_1_1185' title='bbox 1097 11226 1141 11271; x_wconf 92' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_1186' title='bbox 1159 11226 1187 11270; x_wconf 92' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1187' title='bbox 1205 11226 1234 11270; x_wconf 92' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1188' title='bbox 1251 11227 1263 11271; x_wconf 89' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1189' title='bbox 1280 11226 1309 11270; x_wconf 92' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1190' title='bbox 1327 11226 1372 11271; x_wconf 89' lang='eng'>)))</span>
</span>
<span class='ocr_line' id='line_1_191' title="bbox 364 11284 1375 11330; baseline -0.003 0; x_size 80.018547; x_descenders 13; x_ascenders 23.018549"><span class='ocrx_word' id='word_1_1191' title='bbox 364 11286 392 11330; x_wconf 81' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1192' title='bbox 411 11285 423 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1193' title='bbox 440 11285 452 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1194' title='bbox 471 11286 515 11330; x_wconf 79' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1195' title='bbox 534 11284 561 11329; x_wconf 83' lang='eng'>(&lt;</span> <span class='ocrx_word' id='word_1_1196' title='bbox 580 11286 592 11330; x_wconf 79' lang='eng'><em>&gt;</em></span> <span class='ocrx_word' id='word_1_1197' title='bbox 610 11284 637 11329; x_wconf 81' lang='eng'>)&gt;</span> <span class='ocrx_word' id='word_1_1198' title='bbox 658 11285 670 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1199' title='bbox 689 11285 717 11329; x_wconf 83' lang='eng'>)&gt;</span> <span class='ocrx_word' id='word_1_1200' title='bbox 751 11284 780 11329; x_wconf 81' lang='eng'>&lt;&lt;</span> <span class='ocrx_word' id='word_1_1201' title='bbox 798 11286 810 11330; x_wconf 80' lang='eng'><em>)</em></span> <span class='ocrx_word' id='word_1_1202' title='bbox 830 11285 842 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1203' title='bbox 861 11285 873 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1204' title='bbox 892 11285 920 11329; x_wconf 83' lang='eng'>»</span> <span class='ocrx_word' id='word_1_1205' title='bbox 954 11284 1031 11330; x_wconf 79' lang='eng'><strong>()))</strong></span> <span class='ocrx_word' id='word_1_1206' title='bbox 1050 11285 1062 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1207' title='bbox 1081 11284 1126 11330; x_wconf 79' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1208' title='bbox 1158 11285 1375 11329; x_wconf 78' lang='eng' dir='ltr'><a href="cyberSit.html">)Cyberserk</a></span>
</span>
<span class='ocr_line' id='line_1_192' title="bbox 363 11342 1372 11387; baseline 0 -12; x_size 44; x_descenders 11; x_ascenders 13"><span class='ocrx_word' id='word_1_1209' title='bbox 363 11345 697 11386; x_wconf 91' lang='eng' dir='ltr'>repelting-slippage</span> <span class='ocrx_word' id='word_1_1210' title='bbox 719 11345 789 11375; x_wconf 94' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_1211' title='bbox 810 11345 983 11375; x_wconf 93' lang='eng' dir='ltr'>dark-side</span> <span class='ocrx_word' id='word_1_1212' title='bbox 1004 11342 1016 11387; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1213' title='bbox 1039 11342 1068 11387; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1214' title='bbox 1092 11342 1135 11386; x_wconf 89' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1215' title='bbox 1158 11345 1372 11375; x_wconf 92' lang='eng' dir='ltr'>distributive</span>
</span>
<span class='ocr_line' id='line_1_193' title="bbox 365 11400 1372 11446; baseline 0 -14; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_1216' title='bbox 365 11402 659 11443; x_wconf 81' lang='eng' dir='ltr'>ROM-scrambling</span> <span class='ocrx_word' id='word_1_1217' title='bbox 668 11402 783 11432; x_wconf 93' lang='eng' dir='ltr'>TACT</span> <span class='ocrx_word' id='word_1_1218' title='bbox 795 11402 918 11432; x_wconf 93' lang='eng' dir='ltr'>tactics.</span> <span class='ocrx_word' id='word_1_1219' title='bbox 934 11401 963 11445; x_wconf 94' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1220' title='bbox 979 11400 1005 11444; x_wconf 93' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1221' title='bbox 1019 11400 1031 11444; x_wconf 93' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1222' title='bbox 1048 11400 1060 11444; x_wconf 96' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1223' title='bbox 1074 11400 1086 11444; x_wconf 93' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1224' title='bbox 1102 11400 1114 11444; x_wconf 96' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1225' title='bbox 1128 11400 1153 11444; x_wconf 92' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1226' title='bbox 1171 11400 1199 11444; x_wconf 93' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1227' title='bbox 1213 11400 1241 11444; x_wconf 92' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1228' title='bbox 1257 11401 1269 11446; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1229' title='bbox 1283 11401 1311 11446; x_wconf 87' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1230' title='bbox 1326 11401 1372 11445; x_wconf 91' lang='eng'>(((</span>
</span>
<span class='ocr_line' id='line_1_194' title="bbox 364 11458 1372 11505; baseline 0 -1; x_size 60.254128; x_descenders 16.254128; x_ascenders 15.112474"><span class='ocrx_word' id='word_1_1231' title='bbox 364 11458 1195 11505; x_wconf 85' lang='eng'>)()))((((()((()))(((()())())(()))(((()</span> <span class='ocrx_word' id='word_1_1232' title='bbox 1212 11459 1372 11504; x_wconf 85' lang='eng'>(())((()</span>
</span>
<span class='ocr_line' id='line_1_195' title="bbox 364 11517 1372 11563; baseline -0.001 0; x_size 60.254128; x_descenders 16.254128; x_ascenders 15.112474"><span class='ocrx_word' id='word_1_1233' title='bbox 364 11517 927 11563; x_wconf 84' lang='eng'>((()))(()))))((())))((()(</span> <span class='ocrx_word' id='word_1_1234' title='bbox 970 11517 1372 11563; x_wconf 85' lang='eng'>()))(()))((())(((</span>
</span>
<span class='ocr_line' id='line_1_196' title="bbox 364 11574 1370 11622; baseline 0 -1; x_size 60.254128; x_descenders 16.254128; x_ascenders 15.112474"><span class='ocrx_word' id='word_1_1235' title='bbox 364 11577 497 11621; x_wconf 63' lang='eng' dir='ltr'>()ZCr0</span> <span class='ocrx_word' id='word_1_1236' title='bbox 509 11575 689 11619; x_wconf 69' lang='eng' dir='ltr'>Program)</span> <span class='ocrx_word' id='word_1_1237' title='bbox 706 11574 751 11618; x_wconf 85' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_1238' title='bbox 766 11575 812 11620; x_wconf 88' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1239' title='bbox 828 11575 918 11620; x_wconf 85' lang='eng'>(((()</span> <span class='ocrx_word' id='word_1_1240' title='bbox 1006 11576 1062 11621; x_wconf 72' lang='eng'>0)</span> <span class='ocrx_word' id='word_1_1241' title='bbox 1078 11577 1090 11621; x_wconf 93' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1242' title='bbox 1106 11577 1118 11621; x_wconf 93' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1243' title='bbox 1133 11576 1178 11621; x_wconf 85' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1244' title='bbox 1194 11576 1282 11622; x_wconf 86' lang='eng'>(((()</span> <span class='ocrx_word' id='word_1_1245' title='bbox 1299 11576 1328 11621; x_wconf 87' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1246' title='bbox 1343 11577 1370 11621; x_wconf 89' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_197' title="bbox 365 11634 1372 11679; baseline 0 -1; x_size 60.254128; x_descenders 16.254128; x_ascenders 15.112474"><span class='ocrx_word' id='word_1_1247' title='bbox 365 11635 442 11679; x_wconf 88' lang='eng'>(((((</span> <span class='ocrx_word' id='word_1_1248' title='bbox 456 11635 468 11679; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1249' title='bbox 484 11634 521 11679; x_wconf 83' lang='eng'>()</span> <span class='ocrx_word' id='word_1_1250' title='bbox 537 11634 683 11678; x_wconf 81' lang='eng'>)()(())((</span> <span class='ocrx_word' id='word_1_1251' title='bbox 698 11634 737 11678; x_wconf 84' lang='eng'>()</span> <span class='ocrx_word' id='word_1_1252' title='bbox 753 11634 766 11678; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1253' title='bbox 781 11634 828 11678; x_wconf 61' lang='eng' dir='ltr'>(H</span> <span class='ocrx_word' id='word_1_1254' title='bbox 842 11634 855 11663; x_wconf 64' lang='eng'></span> <span class='ocrx_word' id='word_1_1255' title='bbox 869 11634 927 11678; x_wconf 55' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1256' title='bbox 1004 11634 1051 11678; x_wconf 56' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1257' title='bbox 1068 11634 1081 11678; x_wconf 80' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1258' title='bbox 1096 11634 1150 11678; x_wconf 70' lang='eng' dir='ltr'>(O</span> <span class='ocrx_word' id='word_1_1259' title='bbox 1189 11634 1217 11678; x_wconf 77' lang='eng'>0</span> <span class='ocrx_word' id='word_1_1260' title='bbox 1255 11634 1316 11679; x_wconf 87' lang='eng'>()))</span> <span class='ocrx_word' id='word_1_1261' title='bbox 1333 11634 1372 11679; x_wconf 95' lang='eng'>((</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_6' title="bbox 1005 11664 1370 11795">
<p class='ocr_par' dir='ltr' id='par_1_28' title="bbox 801 11664 1370 11795">
<span class='ocr_line' id='line_1_198' title="bbox 1005 11664 1370 11795; baseline 0 -58; x_size 80.41758; x_descenders 7.4175825; x_ascenders 28"><span class='ocrx_word' id='word_1_1262' title='bbox 1005 11664 1370 11795; x_wconf 49' lang='eng'>§5&gt;((»&gt;&lt;(&lt;&lt;&gt;&lt;(&gt;&gt;</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_7' title="bbox 364 11518 1371 11796">
<p class='ocr_par' dir='ltr' id='par_1_29' title="bbox 931 11518 943 11562">
<span class='ocr_line' id='line_1_199' title="bbox 931 11518 943 11562; baseline 0 0; x_size 59.826088; x_descenders 14.956522; x_ascenders 14.956522"><span class='ocrx_word' id='word_1_1263' title='bbox 931 11518 943 11562; x_wconf 93' lang='eng'>)</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_30' title="bbox 935 11576 947 11620">
<span class='ocr_line' id='line_1_200' title="bbox 935 11576 947 11620; baseline 0 0; x_size 59.826088; x_descenders 14.956522; x_ascenders 14.956522"><span class='ocrx_word' id='word_1_1264' title='bbox 935 11576 947 11620; x_wconf 95' lang='eng'>(</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_31' title="bbox 933 11633 946 11678">
<span class='ocr_line' id='line_1_201' title="bbox 933 11633 946 11678; baseline 0 0; x_size 59.826088; x_descenders 14.956522; x_ascenders 14.956522"><span class='ocrx_word' id='word_1_1265' title='bbox 933 11633 946 11678; x_wconf 88' lang='eng'>(</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_32' title="bbox 364 11692 1371 11796">
<span class='ocr_line' id='line_1_202' title="bbox 364 11692 948 11738; baseline -0.003 0; x_size 59.826088; x_descenders 14.956522; x_ascenders 14.956522"><span class='ocrx_word' id='word_1_1266' title='bbox 364 11692 948 11738; x_wconf 85' lang='eng'><a href="home/doorway.html">))((())(((())((()))(((((</a>)</span>
</span>
<span class='ocr_line' id='line_1_203' title="bbox 1054 11751 1371 11796; baseline 0 0; x_size 59.826088; x_descenders 14.956522; x_ascenders 14.956522"><span class='ocrx_word' id='word_1_1267' title='bbox 1054 11751 1371 11796; x_wconf 84' lang='eng'>()))(()))((())</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_8' title="bbox 364 11575 1372 12264">
<p class='ocr_par' dir='ltr' id='par_1_33' title="bbox 364 11575 1372 12264">
<span class='ocr_line' id='line_1_204' title="bbox 962 11575 990 11619; baseline 0 0; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1268' title='bbox 962 11575 990 11619; x_wconf 89' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_205' title="bbox 959 11634 990 11678; baseline 0 0; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1269' title='bbox 959 11634 990 11678; x_wconf 85' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_206' title="bbox 908 11692 991 11737; baseline -0.012 0; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1270' title='bbox 908 11693 920 11737; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1271' title='bbox 963 11692 991 11736; x_wconf 89' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_207' title="bbox 365 11750 1004 11796; baseline 0 -1; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1272' title='bbox 365 11750 1004 11796; x_wconf 83' lang='eng'>((((()())()(())((())((())))())(</span>
</span>
<span class='ocr_line' id='line_1_208' title="bbox 365 11809 1371 11855; baseline 0 -1; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1273' title='bbox 365 11809 1371 11855; x_wconf 69' lang='eng' dir='ltr'>(((())((()))(((()(D())(()))(((()(())((((()())</span>
</span>
<span class='ocr_line' id='line_1_209' title="bbox 365 11867 1371 11913; baseline -0.001 0; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1274' title='bbox 365 11867 1210 11913; x_wconf 74' lang='eng'>()(())((())((())))())))((())))0))))((()</span> <span class='ocrx_word' id='word_1_1275' title='bbox 1246 11867 1274 11911; x_wconf 82' lang='eng'>0</span> <span class='ocrx_word' id='word_1_1276' title='bbox 1309 11867 1371 11912; x_wconf 85' lang='eng'>()))</span>
</span>
<span class='ocr_line' id='line_1_210' title="bbox 365 11925 1371 11971; baseline 0 -1; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1277' title='bbox 365 11925 1371 11971; x_wconf 87' lang='eng'>(()))((())(((())((()))(((()())())(()))(((()</span>
</span>
<span class='ocr_line' id='line_1_211' title="bbox 365 11984 1370 12030; baseline 0 -1; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1278' title='bbox 365 11986 393 12030; x_wconf 92' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1279' title='bbox 407 11985 435 12030; x_wconf 85' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1280' title='bbox 452 11985 528 12029; x_wconf 88' lang='eng'>(((((</span> <span class='ocrx_word' id='word_1_1281' title='bbox 542 11985 555 12029; x_wconf 91' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1282' title='bbox 570 11985 582 12030; x_wconf 96' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1283' title='bbox 597 11986 609 12030; x_wconf 89' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1284' title='bbox 624 11985 636 12029; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1285' title='bbox 654 11985 682 12029; x_wconf 88' lang='eng'>()</span> <span class='ocrx_word' id='word_1_1286' title='bbox 699 11985 778 12030; x_wconf 85' lang='eng'>(())(</span> <span class='ocrx_word' id='word_1_1287' title='bbox 794 11985 806 12030; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1288' title='bbox 822 11985 834 12030; x_wconf 96' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1289' title='bbox 850 11984 878 12029; x_wconf 89' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1290' title='bbox 895 11984 941 12030; x_wconf 87' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_1291' title='bbox 956 11986 968 12030; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1292' title='bbox 985 11984 1013 12029; x_wconf 84' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1293' title='bbox 1029 11985 1059 12030; x_wconf 85' lang='eng'>)(</span> <span class='ocrx_word' id='word_1_1294' title='bbox 1074 11985 1102 12029; x_wconf 89' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1295' title='bbox 1119 11984 1147 12029; x_wconf 90' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1296' title='bbox 1164 11985 1210 12030; x_wconf 87' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_1297' title='bbox 1225 11986 1237 12030; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1298' title='bbox 1253 11985 1281 12029; x_wconf 88' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1299' title='bbox 1297 11985 1327 12030; x_wconf 87' lang='eng'>)(</span> <span class='ocrx_word' id='word_1_1300' title='bbox 1342 11985 1370 12029; x_wconf 88' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_212' title="bbox 364 12042 1372 12089; baseline -0.001 0; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1301' title='bbox 364 12043 508 12089; x_wconf 84' lang='eng'>)))((()</span> <span class='ocrx_word' id='word_1_1302' title='bbox 548 12043 575 12088; x_wconf 85' lang='eng'>0</span> <span class='ocrx_word' id='word_1_1303' title='bbox 614 12042 1372 12089; x_wconf 86' lang='eng'>()))(()))((())(((())((()))(((()(</span>
</span>
<span class='ocr_line' id='line_1_213' title="bbox 365 12101 1371 12147; baseline 0 0; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1304' title='bbox 365 12101 1371 12147; x_wconf 66' lang='eng' dir='ltr'>D())(()))(((()(())((((()())()(())((())((())))(</span>
</span>
<span class='ocr_line' id='line_1_214' title="bbox 366 12159 1371 12206; baseline 0 -1; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1305' title='bbox 366 12160 435 12205; x_wconf 86' lang='eng'>))0</span> <span class='ocrx_word' id='word_1_1306' title='bbox 462 12159 1371 12206; x_wconf 76' lang='eng'>()))(0))((())(((())((()))(((()())())((</span>
</span>
<span class='ocr_line' id='line_1_215' title="bbox 366 12218 1214 12264; baseline 0 -1; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1307' title='bbox 366 12218 1214 12264; x_wconf 74' lang='eng'>)))(((()(())((((()())()(())((()))))(0))</span>
</span>
</p>
</div>
</div>
<!-- <script type="text/javascript" src="../scripts/drag.js"></script> -->
<script type="text/javascript">
var l = $('.ocr_line');
l.each( function(x){ this.title = "hypervirus"; });
var p = $('.ocr_par');
p.each( function(x){ this.title = "hypervirus"; });
var c = $('.ocr_carea');
c.each( function(x){ this.title = "hypervirus"; });
var ww = $('.ocrx_word');
ww.each( function(x){
let t = $(this).attr('title').split(" "),
left = parseInt(t[1]),
top = parseInt(t[2]);
console.log('title = ', left , top);
left *= 0.4;
top *= 0.5;
// this.style.left = left + 'px';
// this.style.top = top + 'px';
this.style.color = "blue;"
this.title = "hypervirus";
});
//store all class 'ocr_line' in 'lines'
var lines = document.querySelectorAll(".ocr_line");
//loop through each element in 'lines'
for (var i = 0; i < lines.length; i++){
var line = lines[i];
var words = line.querySelectorAll(".ocrx_word");
for (var e = 0; e < words.length; e++){
var span = words[e];
span.classList.add("draggable");
span.title = "hypervirus";
}
}
window.setInterval( function(){
// console.log('interval', ww);
var ra = Math.floor(ww.size()*Math.random());
var w = ww.get(ra);
// console.log(w);
var col = ["b", "w"];
var fs =["9px","15px"];
$(w).css('visibility', 'visible');
$(w).removeClass('ocrx_word');
$(w).addClass(col[Math.floor(Math.random()*col.length)]);
5 years ago
}, 200);
5 years ago
5 years ago
var rooms = ['VB01.html','FS01.html','Ixse.html','Ixse4.html','EOC.html','EOC2.html','./home/doorway.html','./AxS/index.html','./0/ilinx_0.html','cyberSit.html'];
5 years ago
function rand(){ return Math.ceil(Math.random() * (rooms.length -1)) }
window.setInterval( function(){
var ra2 = Math.floor(ww.size()*Math.random());
var a = ww.get(ra2);
var orig = $(a).html()
$(a).html('<a class="b" href='+ rooms[rand()]+'>'+ orig + '</a>')
}, 5000);
5 years ago
// ------------ DRAG ------------
$( function() {
$( ".draggable" ).draggable(
//{ containment: [-1300,-750,1800,1250] }
);
});
// // ------------ ZOOM -------------
// function zoom(event) {
// event.preventDefault();
// scale += event.deltaY * -0.01;
// scale = Math.min(Math.max(.125, scale), 4);
// el.style.transform = `scale(${scale})`;
// }
// let scale = 1;
// const el = document.querySelector('body');
// el.onwheel = zoom;
// CURSOR GRAB AND RELEASE
$('.draggable').on("mousedown",function(){
$('.draggable').css('cursor', 'grabbing');
}).on("mouseup mouseleave",function(){
$('.draggable').css('cursor', 'grab');
});
$(document).ready(function(){
$(".ocrx_word").hover(function(){
var n = $("this").css("color");
$(this).animate({color: "white"});
$(this).animate({fontSize: "20px"});
$(this).animate({marginLeft: "-20px"});
$(this).animate({letterSpacing: "20px"});
}, function(){
$(this).animate({color: "black"});
$(this).animate({fontSize: "15px"});
$(this).animate({marginLeft: "0px"});
$(this).animate({letterSpacing: "0px"});
});
});
5 years ago
var w = window.innerWidth;
var h = window.innerHeight;
function posX(){ return Math.ceil(Math.random() * w)-200 }
function posY(){ return Math.ceil(Math.random() * h) }
function popup(mylink, windowname, width, height) {
if (! window.focus)return true;
var href;
if (typeof(mylink) == 'string') href=mylink;
else href=mylink.href;
var open = window.open(href, windowname, 'width=' + width + ',height='+ height + ',left=' + posX() + ',top=' + posY());
open.focus();
setTimeout(function(){ open.close(); }, 15000);
return false;
}
</script>
5 years ago
</body>
</html>