Tancre
/
ilinx
1
0
Fork 0
Code Issues Pull Requests Releases Wiki Activity
You cannot select more than 25 topics Topics must start with a letter or number, can include dashes ('-') and can be up to 35 characters long.
master
Branches Tags
${ item.name }
Create tag ${ searchTerm }
Create branch ${ searchTerm }
from '61a1423367'
${ noResults }
ilinx/text_base/hypervirus/3.html

95 lines
17 KiB
HTML
Raw Blame History Unescape Escape

This file contains ambiguous Unicode characters!

This file contains ambiguous Unicode characters that may be confused with others in your current locale. If your use case is intentional and legitimate, you can safely ignore this warning. Use the Escape button to highlight these characters.

<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
<head>
<title></title>
<meta http-equiv="Content-Type" content="text/html;charset=utf-8" />
<meta name='ocr-system' content='tesseract 3.04.01' />
<meta name='ocr-capabilities' content='ocr_page ocr_carea ocr_par ocr_line ocrx_word'/>
</head>
<body>
<div class='ocr_page' id='page_1' title='image "hypervirus-03.tif"; bbox 0 0 1749 2481; ppageno 0'>
<div class='ocr_carea' id='block_1_1' title="bbox 733 371 950 392">
<p class='ocr_par' dir='ltr' id='par_1_1' title="bbox 733 371 950 392">
<span class='ocr_line' id='line_1_1' title="bbox 733 371 950 392; baseline 0 0; x_size 27.333334; x_descenders 6.8333335; x_ascenders 6.8333335"><span class='ocrx_word' id='word_1_1' title='bbox 733 371 950 392; x_wconf 84' lang='eng' dir='ltr'><strong>HYPERVIRUS</strong></span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_2' title="bbox 332 477 1343 2025">
<p class='ocr_par' dir='ltr' id='par_1_2' title="bbox 333 477 1343 755">
<span class='ocr_line' id='line_1_2' title="bbox 333 477 1343 521; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_2' title='bbox 333 477 646 521; x_wconf 85' lang='eng' dir='ltr'>disproportionate)</span> <span class='ocrx_word' id='word_1_3' title='bbox 657 479 831 519; x_wconf 80' lang='eng' dir='ltr'>efficiency:</span> <span class='ocrx_word' id='word_1_4' title='bbox 842 479 987 509; x_wconf 85' lang='eng' dir='ltr'>intruder</span> <span class='ocrx_word' id='word_1_5' title='bbox 994 479 1162 519; x_wconf 98' lang='eng' dir='ltr'>passcode,</span> <span class='ocrx_word' id='word_1_6' title='bbox 1172 479 1343 509; x_wconf 90' lang='eng' dir='ltr'>locational</span>
</span>
<span class='ocr_line' id='line_1_3' title="bbox 334 537 1342 578; baseline 0 -11; x_size 37; x_descenders 7; x_ascenders 10"><span class='ocrx_word' id='word_1_7' title='bbox 334 537 495 574; x_wconf 83' lang='eng' dir='ltr'>ZIP-code,</span> <span class='ocrx_word' id='word_1_8' title='bbox 509 537 799 578; x_wconf 95' lang='eng' dir='ltr'>pseudogenomic</span> <span class='ocrx_word' id='word_1_9' title='bbox 813 537 991 567; x_wconf 89' lang='eng' dir='ltr'>substitute</span> <span class='ocrx_word' id='word_1_10' title='bbox 1005 537 1226 574; x_wconf 86' lang='eng' dir='ltr'>instructions,</span> <span class='ocrx_word' id='word_1_11' title='bbox 1242 543 1342 567; x_wconf 92' lang='eng' dir='ltr'>muta-</span>
</span>
<span class='ocr_line' id='line_1_4' title="bbox 334 594 1342 639; baseline 0.003 -13; x_size 43; x_descenders 11; x_ascenders 12"><span class='ocrx_word' id='word_1_12' title='bbox 334 596 437 631; x_wconf 86' lang='eng' dir='ltr'>tional</span> <span class='ocrx_word' id='word_1_13' title='bbox 444 596 532 637; x_wconf 86' lang='eng' dir='ltr'>junk</span> <span class='ocrx_word' id='word_1_14' title='bbox 545 594 718 639; x_wconf 90' lang='eng' dir='ltr'>(complex</span> <span class='ocrx_word' id='word_1_15' title='bbox 729 596 790 626; x_wconf 95' lang='eng' dir='ltr'>but</span> <span class='ocrx_word' id='word_1_16' title='bbox 803 596 906 626; x_wconf 99' lang='eng' dir='ltr'>latent</span> <span class='ocrx_word' id='word_1_17' title='bbox 918 594 1109 638; x_wconf 86' lang='eng' dir='ltr'>segments),</span> <span class='ocrx_word' id='word_1_18' title='bbox 1123 596 1189 626; x_wconf 99' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_19' title='bbox 1200 598 1342 639; x_wconf 85' lang='eng' dir='ltr'>garbage</span>
</span>
<span class='ocr_line' id='line_1_5' title="bbox 334 652 1342 697; baseline 0 -13; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_20' title='bbox 334 652 547 697; x_wconf 92' lang='eng' dir='ltr'>(redundant</span> <span class='ocrx_word' id='word_1_21' title='bbox 566 664 1342 694; x_wconf 93' lang='eng' dir='ltr'>scrapcrapcrapcrapcrapcrapcrapcrapcrap-</span>
</span>
<span class='ocr_line' id='line_1_6' title="bbox 333 711 683 755; baseline 0 -12; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_22' title='bbox 333 711 683 755; x_wconf 95' lang='eng' dir='ltr'>crapcrapcrapcrap).</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_3' title="bbox 332 771 1343 1163">
<span class='ocr_line' id='line_1_7' title="bbox 398 771 1343 812; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_23' title='bbox 398 771 547 801; x_wconf 93' lang='eng' dir='ltr'>Biovirus</span> <span class='ocrx_word' id='word_1_24' title='bbox 561 771 621 801; x_wconf 90' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_25' title='bbox 630 771 691 801; x_wconf 91' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_26' title='bbox 699 771 760 801; x_wconf 91' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_27' title='bbox 774 777 893 812; x_wconf 98' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_28' title='bbox 910 771 1101 812; x_wconf 86' lang='eng' dir='ltr'>organisms,</span> <span class='ocrx_word' id='word_1_29' title='bbox 1120 771 1262 812; x_wconf 82' lang='eng' dir='ltr'>hacking</span> <span class='ocrx_word' id='word_1_30' title='bbox 1274 771 1343 801; x_wconf 92' lang='eng' dir='ltr'>and</span>
</span>
<span class='ocr_line' id='line_1_8' title="bbox 333 829 1343 870; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_31' title='bbox 333 829 616 870; x_wconf 98' lang='eng' dir='ltr'>reprogramming</span> <span class='ocrx_word' id='word_1_32' title='bbox 622 829 1343 859; x_wconf 67' lang='eng' dir='ltr'><strong>ATGAmATCCACGGTACATFCAGT</strong></span>
</span>
<span class='ocr_line' id='line_1_9' title="bbox 333 887 1341 927; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_33' title='bbox 333 887 467 917; x_wconf 95' lang='eng' dir='ltr'>cellular</span> <span class='ocrx_word' id='word_1_34' title='bbox 477 896 553 917; x_wconf 89' lang='eng' dir='ltr'>DNA</span> <span class='ocrx_word' id='word_1_35' title='bbox 567 893 599 917; x_wconf 99' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_36' title='bbox 609 887 759 927; x_wconf 94' lang='eng' dir='ltr'>produce</span> <span class='ocrx_word' id='word_1_37' title='bbox 770 897 862 917; x_wconf 99' lang='eng' dir='ltr'>more</span> <span class='ocrx_word' id='word_1_38' title='bbox 871 887 959 917; x_wconf 93' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_39' title='bbox 969 887 1054 917; x_wconf 93' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_40' title='bbox 1064 887 1151 917; x_wconf 94' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_41' title='bbox 1160 887 1246 917; x_wconf 95' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_42' title='bbox 1255 887 1341 917; x_wconf 94' lang='eng' dir='ltr'>virus</span>
</span>
<span class='ocr_line' id='line_1_10' title="bbox 333 946 1340 986; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_43' title='bbox 333 946 420 976; x_wconf 94' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_44' title='bbox 434 946 522 976; x_wconf 95' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_45' title='bbox 538 946 635 976; x_wconf 92' lang='eng' dir='ltr'>virus.</span> <span class='ocrx_word' id='word_1_46' title='bbox 655 947 701 976; x_wconf 95' lang='eng' dir='ltr'>Its</span> <span class='ocrx_word' id='word_1_47' title='bbox 715 946 864 986; x_wconf 94' lang='eng' dir='ltr'>enzymic</span> <span class='ocrx_word' id='word_1_48' title='bbox 880 946 1102 986; x_wconf 94' lang='eng' dir='ltr'>cut-and-past</span> <span class='ocrx_word' id='word_1_49' title='bbox 1116 946 1340 976; x_wconf 92' lang='eng' dir='ltr'>recombinant</span>
</span>
<span class='ocr_line' id='line_1_11' title="bbox 332 1005 1340 1046; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_50' title='bbox 332 1005 653 1046; x_wconf 90' lang='eng' dir='ltr'>wetware-splicing</span> <span class='ocrx_word' id='word_1_51' title='bbox 674 1015 804 1035; x_wconf 98' lang='eng' dir='ltr'>crosses</span> <span class='ocrx_word' id='word_1_52' title='bbox 827 1005 1029 1046; x_wconf 92' lang='eng' dir='ltr'>singularity</span> <span class='ocrx_word' id='word_1_53' title='bbox 1049 1005 1148 1035; x_wconf 91' lang='eng' dir='ltr'>when</span> <span class='ocrx_word' id='word_1_54' title='bbox 1170 1005 1340 1035; x_wconf 98' lang='eng' dir='ltr'>retroviral</span>
</span>
<span class='ocr_line' id='line_1_12' title="bbox 333 1061 1339 1106; baseline 0 -13; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_55' title='bbox 333 1063 698 1103; x_wconf 94' lang='eng' dir='ltr'>reverse-transcriptase</span> <span class='ocrx_word' id='word_1_56' title='bbox 708 1063 807 1093; x_wconf 92' lang='eng' dir='ltr'>clicks</span> <span class='ocrx_word' id='word_1_57' title='bbox 816 1063 851 1093; x_wconf 99' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_58' title='bbox 862 1061 1032 1106; x_wconf 91' lang='eng' dir='ltr'>(enabling</span> <span class='ocrx_word' id='word_1_59' title='bbox 1040 1063 1246 1104; x_wconf 98' lang='eng' dir='ltr'>ontogenetic</span> <span class='ocrx_word' id='word_1_60' title='bbox 1256 1072 1339 1093; x_wconf 91' lang='eng' dir='ltr'><strong>DNA-</strong></span>
</span>
<span class='ocr_line' id='line_1_13' title="bbox 335 1119 1162 1163; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_61' title='bbox 335 1130 408 1151; x_wconf 90' lang='eng' dir='ltr'>RNA</span> <span class='ocrx_word' id='word_1_62' title='bbox 421 1121 574 1161; x_wconf 92' lang='eng' dir='ltr'>circuitry</span> <span class='ocrx_word' id='word_1_63' title='bbox 586 1121 655 1151; x_wconf 98' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_64' title='bbox 667 1121 895 1151; x_wconf 94' lang='eng' dir='ltr'>endocellular</span> <span class='ocrx_word' id='word_1_65' title='bbox 907 1119 1162 1163; x_wconf 92' lang='eng' dir='ltr'>computation).</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_4' title="bbox 332 1179 1339 1501">
<span class='ocr_line' id='line_1_14' title="bbox 394 1179 1339 1209; baseline 0 0; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_66' title='bbox 394 1179 1339 1209; x_wconf 90' lang='eng' dir='ltr'><strong>ATAGGTCATGAATCTACCGATTGCAGCTGC</strong></span>
</span>
<span class='ocr_line' id='line_1_15' title="bbox 332 1238 1338 1268; baseline 0 0; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_67' title='bbox 332 1238 1338 1268; x_wconf 90' lang='eng' dir='ltr'><strong>TATTCCTCGATGATCGCATGGGCTGTGATG</strong></span>
</span>
<span class='ocr_line' id='line_1_16' title="bbox 333 1296 1338 1326; baseline 0 0; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_68' title='bbox 333 1296 1338 1326; x_wconf 76' lang='eng' dir='ltr'><strong>GCATCGTATCCGATCGATI‘CGAGCGATI‘GCAGC</strong></span>
</span>
<span class='ocr_line' id='line_1_17' title="bbox 332 1355 1337 1386; baseline 0 -1; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_69' title='bbox 332 1355 1337 1386; x_wconf 76' lang='eng' dir='ltr'><strong>TACGCTATI‘CCTCCGAGGGATTGCAGCTACGTC</strong></span>
</span>
<span class='ocr_line' id='line_1_18' title="bbox 333 1412 1338 1443; baseline 0 0; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_70' title='bbox 333 1412 1338 1443; x_wconf 88' lang='eng' dir='ltr'><strong>GCATCGGGCTCAGATGTAGGTCATGAATCTACC</strong></span>
</span>
<span class='ocr_line' id='line_1_19' title="bbox 334 1471 1302 1501; baseline 0 0; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_71' title='bbox 334 1471 1302 1501; x_wconf 76' lang='eng' dir='ltr'><strong>GA&#39;ITGCATGAC’I&#39;TATCCACGGTACA’ITCGACTC</strong></span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_5' title="bbox 333 1530 1337 2025">
<span class='ocr_line' id='line_1_20' title="bbox 398 1530 1337 1571; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_72' title='bbox 398 1530 598 1560; x_wconf 88' lang='eng' dir='ltr'>Ethnovirus</span> <span class='ocrx_word' id='word_1_73' title='bbox 614 1536 734 1571; x_wconf 99' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_74' title='bbox 749 1530 859 1560; x_wconf 98' lang='eng' dir='ltr'>brains</span> <span class='ocrx_word' id='word_1_75' title='bbox 872 1530 1092 1560; x_wconf 92' lang='eng' dir='ltr'>Technovirus</span> <span class='ocrx_word' id='word_1_76' title='bbox 1107 1536 1223 1571; x_wconf 95' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_77' title='bbox 1237 1530 1337 1560; x_wconf 94' lang='eng' dir='ltr'>socio-</span>
</span>
<span class='ocr_line' id='line_1_21' title="bbox 333 1588 1336 1628; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_78' title='bbox 333 1588 506 1618; x_wconf 98' lang='eng' dir='ltr'>economic</span> <span class='ocrx_word' id='word_1_79' title='bbox 524 1598 586 1628; x_wconf 98' lang='eng' dir='ltr'>pro</span> <span class='ocrx_word' id='word_1_80' title='bbox 603 1598 665 1628; x_wconf 98' lang='eng' dir='ltr'>pro</span> <span class='ocrx_word' id='word_1_81' title='bbox 682 1588 887 1628; x_wconf 95' lang='eng' dir='ltr'>production</span> <span class='ocrx_word' id='word_1_82' title='bbox 904 1598 965 1628; x_wconf 98' lang='eng' dir='ltr'>pro</span> <span class='ocrx_word' id='word_1_83' title='bbox 982 1598 1157 1628; x_wconf 92' lang='eng' dir='ltr'>processes.</span> <span class='ocrx_word' id='word_1_84' title='bbox 1177 1588 1336 1618; x_wconf 87' lang='eng' dir='ltr'>Infovirus</span>
</span>
<span class='ocr_line' id='line_1_22' title="bbox 335 1646 1336 1687; baseline -0.001 -11; x_size 41; x_descenders 11; x_ascenders 9"><span class='ocrx_word' id='word_1_85' title='bbox 335 1652 449 1687; x_wconf 93' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_86' title='bbox 459 1646 572 1687; x_wconf 96' lang='eng' dir='ltr'>digital</span> <span class='ocrx_word' id='word_1_87' title='bbox 581 1654 1336 1676; x_wconf 89' lang='eng'>010010010001011110100001001101010101010</span>
</span>
<span class='ocr_line' id='line_1_23' title="bbox 335 1711 1335 1745; baseline 0 -10; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_88' title='bbox 335 1711 1335 1745; x_wconf 91' lang='eng' dir='ltr'>10001001101010010010100computers100101001011010010</span>
</span>
<span class='ocr_line' id='line_1_24' title="bbox 335 1771 1335 1792; baseline 0.001 -1; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_89' title='bbox 335 1771 1335 1792; x_wconf 88' lang='eng'>101111010001010101010101010010101001010110101001</span>
</span>
<span class='ocr_line' id='line_1_25' title="bbox 333 1829 1334 1851; baseline -0.001 0; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_90' title='bbox 333 1829 1334 1851; x_wconf 93' lang='eng' dir='ltr'>oooooo100010111010100100101010010100100101010101</span>
</span>
<span class='ocr_line' id='line_1_26' title="bbox 334 1887 1333 1909; baseline 0 0; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_91' title='bbox 334 1887 1333 1909; x_wconf 91' lang='eng' dir='ltr'>oo100010010010010010010010100100101011010100100</span>
</span>
<span class='ocr_line' id='line_1_27' title="bbox 335 1945 1333 1967; baseline 0.001 -1; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_92' title='bbox 335 1945 1333 1967; x_wconf 90' lang='eng'>10010101101010101010111101000010011010101010101000</span>
</span>
<span class='ocr_line' id='line_1_28' title="bbox 336 2003 1334 2025; baseline 0.001 -1; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_93' title='bbox 336 2003 1334 2025; x_wconf 91' lang='eng'>1001101101010101001100100010001010101110100001010</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_3' title="bbox 811 2119 871 2142">
<p class='ocr_par' dir='ltr' id='par_1_6' title="bbox 811 2119 871 2142">
<span class='ocr_line' id='line_1_29' title="bbox 811 2119 871 2142; baseline 0 0; x_size 31.333334; x_descenders 7.8333335; x_ascenders 7.8333335"><span class='ocrx_word' id='word_1_94' title='bbox 811 2119 871 2142; x_wconf 84' lang='eng'>385</span>
</span>
</p>
</div>
</div>
</body>
</html>
Reference in New Issue View Git Blame Copy Permalink