diff --git a/ilinx/01/lvs.html b/ilinx/01/lvs.html index 83583ff..c05299a 100644 --- a/ilinx/01/lvs.html +++ b/ilinx/01/lvs.html @@ -6,18 +6,19 @@
@ilinx:~$ Letters Vysparov-Stillwell
- The corrispondency between Echidna Stillwell and Peter Vysparov is extremely relevant because it is considered the first step to the creation of the Miskatonic Virtual University. Recently the MVU press have released a digital copy of the originals letters, otherwise another version of the same letters can be found in Ccru's texts as Origins of the Cthulhu Club + The corrispondency between Echidna Stillwell and Peter Vysparov is extremely relevant because it is considered the first step to the creation of the Miskatonic Virtual University. Recently the MVU press released a digital copy of the original letters, otherwise, another version of the same letters can be found in Ccru's texts as Origins of the Cthulhu Club

- Original letters    - Origins of the Cthulhu Club    + Original letters    Echidna Stillwell    Peter Vysparov    - Miskatonic Virtual University    + Miskatonic Virtual University   

+
\ No newline at end of file diff --git a/ilinx/01/wcl.html b/ilinx/01/wcl.html index f273281..8865861 100644 --- a/ilinx/01/wcl.html +++ b/ilinx/01/wcl.html @@ -14,8 +14,7 @@
@ilinx:~$ Wicht Club
The Wicht Club (1903 to 1911) has been founded by Walter Cannon and his collegue G. W. Pierce, pioneer in the developement of electronic telecommunication, as a semi-secret and self-assembled associations revolving around Harvard University and whose members and aims are, in part, still secret. To shed light on this private club it is necessary to understand the origin of its name, in fact, 'wicht' refers to the german word 'wichtel', in english 'wight' which ''is a creature or living sentient being also called 'restless soul'. In its original usage, the word wight described a living human being, but has also come to be used within fantasy and gothic literature to describe certain undead or zombies". Following this direction the Wicht Club seems to be involved in the scientific study of a new kind of human understood as zombie, a position that will later become epurated from its fantastical myst and transferred in the idea of the cybernetic machinery and the parallel birth of the post-human perspective.

- - During the 40's Professor Fassrol, which had access to Harvard's archives found some hidden records of the Wicht Club and published one of the firsts account of the people and guests involved in the associations, wuch as William James.

+ During the 40's Professor Fassrol, which had access to Harvard's archives found some hidden records of the Wicht Club and published one of the firsts account of the people and guests involved in the associations, wuch as William James.

William James    Walter Cannon    Professor Fassrol    diff --git a/ilinx/Ixse.html b/ilinx/Ixse.html new file mode 100644 index 0000000..dec27b5 --- /dev/null +++ b/ilinx/Ixse.html @@ -0,0 +1,713 @@ + + + + + @@@ilinχ + + + + + +
+
+

+ Hypervirus + +

+
+
+

+ Whatever ultramodernity places under the dominion + + of signs postmodernity subverts with virus. As culture + + migrates into partial-machines (lacking an autonomous + + reproductive system) semiotics subsides into virotechnics. + +

+ +

+ 0010101011011100101101010101001100100010001010 + + 1011101000010101100101001010001100100111001000100 + + 000000010011111100010010010101010100001000010101 + + 00111111001001000100011010010001010010101111000101 + + 001000010001110100 Yes No Yes No Yes Yes No longer + + what does it mean? but how does it spread? + +

+ +

+ Having no proper substance, or sense beyond its re re + + re replication, yes no no usage of virus is ever metaphori- + + cal. The word ‘virus’ is more re re virus. + +

+ +

+ Postmodern culture re re chatters-out virus virus virus + + virus virus virus virus virus virus virus 0110001001001 + + 011010010010110010010010010010 ‘virus’ (viroductile, + + virogenic, immunosuppressor and and or, meta-, or or + + and or hyper-) virus. + +

+ +

+ 10110010010011101100001001001. hypervirus eats the end + + of history + +

+ +

+ 00100100100010]1110100001001101010101010101000 + + 10011010100100101001001010010110100100101111010001 + + 0101010101010100101010010101101010010000001000101 + + 1101010010010101001010010010101010010001001001001 + + 00100100101001001010110101001001001010110101010101 + + 0101111010000100]1010101010101000100110110101010100 + + 11001000100010101011101000010101100101001010001100 + + 1001110010001000000000000100111111100010010010101 + +

+ +

+ 0101000010000 K-(coding for cyber)p0sitive proc- + + esses auto-intensify by occurring. A cultural example is + + hype: products that AT AT trade on what they will be in + + the future, vir virtual fashion on off, imminent technical + + standards, self-fulfilling prophecies and and or and artifi- + + cial destinies. Anticipating a trend end end end ACC ACC + + accelerates it (which is in itself a re re recursive trend) + +

+ +

+ Hyping collapses SF into CATA CATA catalytic tic + + efficiency, re-routing tomorrow through what its prospect + + CT CT CT makes today. + +

+ +

+ Virohyping sweeps through the advertising industry. + +

+ +

+ Everyone will be doing it. + +

+ +

+ Virus is parasitic tic replicator code: an asignifying + + sequence of machinic data ATA ATA flow-break on/off, + + 1/0, yang/yin intrinsically destined for war. In place of + + mess message-content virodata is assembled bled from + + asignifying materials with CATA catalytic (or positively + + disproportionate) efficiency: intruder passcode, locational + + ZIP-code, pseudogenomic substitute instructions, muta- + + tional junk (complex but latent segments), and garbage + + (redundant scrapcrapcrapcrapcrapcrapcrapcrapcrap- + + crapcrapcrapcrap). + +

+ +

+ Biovirus TA TA TA targets organisms, hacking and + + reprogramming ATGAC'ITATCCACGGTACATTCAGT + + cellular DNA to produce more virus virus virus virus virus + + virus virus virus. Its enzymic cut-and-past recombinant + + wetware-splicing crosses singularity when retroviral + + reverse-transcriptase clicks in (enabling ontogenetic DNA- + + RNA circuitry and endocellular computation). + +

+ +

+ ATAGGTCATGAATCTACCGATTGCAGCTGC + + TATTCCTCGATGATCGCATGGGCTGTGATG + + GCATCGTATCCGATCGATTCGAGCGATTGCAGC + + TACGCTATTCCTCCGAGGGATTGCAGCTACGTC + + GCATCGGGCTCAGATGTAGGTCATGAATCTACC + + GATTGCATGACTT ATCCACGGTACA’ITCGACT C + +

+ +

+ Ethnovirus targets brains Technovirus targets socio- + + economic pro pro production pro processes. Infovirus + + targets digital 010010010001011110100001001101010101010 + + 10001001101010010010100computers100101001011010010 + + 101111010001010101010101010010101001010110101001 + + 000000100010111010100100101010010100100101010101 + + 00100010010010010010010010100100101011010100100 + + 10010101101010101010111101000010011010101010101000 + + 1001101101010101001100100010001010101110100001010 + + 110010100101000110010011100100010000000001001111 + + 1100010010010101 + +

+ +

+ Hypervirus targets intelligent immunosecurity struc- + + tures: yes yes no yes no nomadically abstracting its proc- + + esses from specific media (DNA, words, symbolic models, + + bit-sequences), and operantly re-engineering itself. It + + folds into itself, involutes, or plexes, by reprogramming + + corpuscular code to reprogram reprogramming repro- + + gramming reprogramming. ROM is melted into recursive + + experimentation. + +

+ +

+ 001010010010010110000101010101011101010010100 + + 10010101000011011001101001011000010001001001000 + + Recording devices. Copiers. Faxes. Samplers. K-stammer + + (((re)re)reruns) cross-cut by orphan drift. Repeat infec- + + tion. All hype hype hype hype hype hype hype hype + + hypervirus strains are plastic and interoperative. + +

+ +

+ INSERT. hyper-prefixing semiotic sectors TAG TAG + + TAG tags them for transfer into abstract ACT ACT (nonlin- + + ear transcodable) machinic systems, tuned to virtualities or + + hyperspeeds (futural currencies independent of def uturali- + + zation). Hypermedia configure re re every implementation + + within a specific medium or territory as a subfunction of + + extraterritorial processes. Going (( ( ))) ( ) ( ) (( ) ) (( )) + + ( ) hyper dissolves being into ACT ACT ACT activity; a + + material desubstantialisation on off on off. Hyperproc- + + esses spread like Heraklitean fire re re re (although there + + are no analogies or metaphors in hype hype hype hype + + hyperspace). + +

+ +

+ Being CAG CAG cages flow within memory. Function- + + ing as re re real antiontology, viral amnesia machinically + + realizes and dissolves biological TGACTCACI'ITAC- + + CGA'ITG, cultural, and technical 010110100100010110100 + + 101001001011101001010100100100100 mnemic structures: + + chopping-up hierarchic-generational descendency, col- + + lapsing phylogenetic tic frozen-code into ontogeny, and + + immanentizing the past to operative current. Its com- + + petitive just-in-time innovations delete storage CA CA + + capacity, flu flu flu fluidizin g energetic and informational + + stocks into and and or and and or orphan-vampire re re + + transversal 110111100010101010 vir vir virocommunication + + process, expressing a surplus value of code (content) + + as xenoreplication-behaviour (and/0r c0n(nective dis) + + junction). + +

+ +

+ As war increases in in in intelligence, it becomes softer. + + By trashing their hosts crude viruses feedback negatively + + upon themselves, autolimiting their range of re regen- + + erative infilitration. Crazy vandals like Ebola CGCGT + + GAGCAATCGGACTCGGCTGCTGTGC'ITG (bodies + + dissolved quickly into slime) aren’t ever going to make it + + big. General principle for viral take-overs in the media: the + + more unsophisticated the contagion, the bigger the splash + + (diversionary tactics excepted). CAGCTACGCTATT + + CTCCGAGGCTAGATTGCAGCTACGTCGCATCG + + GGCTGACCGATGTAGGTCATGAATCTACCGA’IT + + GCACATGACTTATCCACGGTCTATTCCTCGAT + + GATCGCATCGGG CT GACCGATGGCATCGTA COPY. + + CUT. PASTE. Subtle viruses are slow, synergic, flexible + + and elusive. They execute sensitive behavioural con- + + trol that prolongs the life of the biomachinic resources, + + maximizes opportunities for propogation, infiltrates and + + disables hostile security systems, and feeds-back posi- + + tive -+-++-+-++ in in in innovation technoscience. In the + + macroversion, a VR prey animal hid in its enemy’s head. + +

+ +

+ When hunting for hype hypervirus look 0k 0k ok for + + its primary host species, which will be undergoing logis- + + tical behavioral sophistication indexed by an explosive + + increase in communicative intensity, population density, + + sexual disorganisation, cultural promiscuity, and technical + + sub sub subtilization (leading to neurogenomic feedback + + and fluidization on off on off off on of all hard-wiring + + into into cybernetic fluxes). Any plane planet net net + + 00011011010010010101011 hosting such an event is about + + to flip over. CATA catastrophic OKOOKOK OK zero (0 + + (or ((( ( )) (( ) ) ( )) ) o°)) K-virus and (RT) retroscripts + + (Kobe, Tokyo, Oklahoma (Koresh, Koernke)). Apoka- + + lypse spread by the coke machine. Tomorrow’s news + + brews-up in Korea, Kosovo + +

+ +

+ Climbing out of a recombination apparatus of TA + + TA TA tape-recorders and cut-ups, hypervirus infected + + Burroughs in 1972, at the cusp of K(ondratieff)-wave 9 + +

+
+
+

+ (the threshold of postmodernity). It rapidly reprocessed + + its target into an intelligenic no yes yes no no nova-war + + laboratory, volatilizing the history of language into invo- + + lutionary word-virus. Mutation rat rat rat rat rates jump. + + Vector switches through Butler, Gibson, and Cadigan + + fine-tune its synergic interexcitation, silt-up cybershift- + + inducing K(uang)-potential, and trend-lock onto 11001 + + 01001001010111101001011101011001000100010100100010 + + 01001001001001010010110100100100100100100100111010 + + 0100100100011001000101100101010 K-punk pulses with + + telematically-accelerating neoreplicator plicator plicator + + contamination. + +

+ +

+ ‘Looking for a hit of snowcrash?’ # Wit # ## # # # + + ### ##W######## ##1## ###### # # # + + #### # ##1## # # # ### ####### # # + + ####### #####=# ## ##### ## # # ##### + + ### ############### ## # # + +

+ +

+ As postmodern culture crosses to hypermania and ##1## + + ######################W# # + + # #### ####### # ##########W# # + + ################# ## # ##fitfi # + + ##### ## ###### ## # W ## ## # #### #### + + # stop stop go stop go stop go go goes nova, it singular- + + izes multiplicities cities cities of invasively autoreplicating + +

+
+
+

+ autoreplicating plexoweapon - systems (0 ( ((() ((( ( )) + + ()) ((( ) (( )) ( D») ( ) ( ))) ) that are r6 r6 r6 r6 nothing + +

+
+
+

+ beyond their war AGA AGA against security. This is no + + longer a question on off on of ideological representation, + + exogeneous political mobilization, theoretical critique, ## + + ######## # ###################### #### + + ## # # # # # ### # # # #W # or strategic orienta- + + tion, but of decentralized cultural diagrams functioning + + as immanent forces of antagonism. K-war derives its sole + + coherence from the unity of its foe. RETURN. + + Ana/Cata. Switch cur((re)re)rent. (( ) (( ))) O(r an)d( ). + + K0( I Ching hexagram 49: Revolution (Molting (( ))) + + leaves ( ) nothing i)ntact TACT TACT. ((( (( (( ) (( ))) + + (( ( ( ))) (< > )> ( )> << ) ( ( » ())) ( ))) )Cyberserk + + repelting-slippage into dark-side ( (( ))) distributive + + ROM-scrambling TACT tactics. (( (( ) ( ) ( )) (( )) ( )) ((( + + )()))((((()((()))(((()())())(()))(((() (())((() + + ((()))(()))))((())))((()( ()))(()))((())((( + + ()ZCr0 Program) ((( ))) (((() 0) ( ( ))) (((() (( )) + + ((((( ) () )()(())(( () ) (H ‘ ))) ))) ( (O 0 ())) (( + +

+
+
+

+ §5>((»><(<<><(>> + +

+
+
+

+ ) + +

+ +

+ ( + +

+ +

+ ( + +

+ +

+ ))((())(((())((()))((((() + + ()))(()))((()) + +

+
+
+

+ )) + + )) + + ) )) + + ((((()())()(())((())((())))())( + + (((())((()))(((()(D())(()))(((()(())((((()()) + + ()(())((())((())))())))((())))0))))((() 0 ())) + + (()))((())(((())((()))(((()())())(()))(((() + + (( )) ((((( ) ( ) ) () (())( ( ( )) ((( ) )) )( )) )) ((( ) )) )( )) + + )))((() 0 ()))(()))((())(((())((()))(((()( + + D())(()))(((()(())((((()())()(())((())((())))( + + ))0 ()))(0))((())(((())((()))(((()())())(( + + )))(((()(())((((()())()(())((()))))(0)) + +

+
+
+ + + + + diff --git a/ilinx/main_l.html b/ilinx/main_l.html index 1f4a922..c9dc9fc 100644 --- a/ilinx/main_l.html +++ b/ilinx/main_l.html @@ -48,7 +48,7 @@
Adin Fassrol
virtual ethnology
Walter Cannon
-
Homeostat
+
Homeostat
@@ -61,7 +61,7 @@ - + @@ -73,14 +73,14 @@
Virus
-
HyperV
+
HyperV
Time War
-
Letters Vysparov-Stillwell
+
Letters Vysparov-Stillwell
Homeostasis