Tancre
/
ilinx
1
0
Fork 0
Code Issues Pull Requests Releases Wiki Activity

old and new

Browse Source
master
Tancre 4 years ago
parent 65de7f913d
commit b14ef3a384
115 changed files with 7353 additions and 0 deletions
Show Stats Download Patch File Download Diff File

BIN
ElevatorButton/._elevGif.gif
View File

Binary file not shown.

BIN
ElevatorButton/elevGif.gif
View File

Binary file not shown.
Side by Side

After

Width:  |  Height:  |  Size: 780 KiB

461
ElevatorButton/index.html
Unescape Escape View File

@ -0,0 +1,461 @@
<html lang="en">
<head>
<!-- Required meta tags -->
<meta charset="utf-8">
<meta name="viewport" content="width=device-width, initial-scale=1, shrink-to-fit=no">
<!-- Bootstrap CSS -->
<link rel="stylesheet" href="https://stackpath.bootstrapcdn.com/bootstrap/4.1.3/css/bootstrap.min.css" integrity="sha384-MCw98/SFnGE8fJT3GXwEOngsV7Zt27NXFoaoApmYm81iuXoPkFOJwJ8ERdknLPMO" crossorigin="anonymous">
<title>Elevator_Button</title>
<style type="text/css">
body {
background-color: black;
color: white;
margin-left: 20px;
margin-top: 20px;
}
</style>
</head>
<body id="bdy">
<img id="elev1" src="https://i.ytimg.com/vi/jn4ZCeF-e_k/maxresdefault.jpg" type="photo" width="500px" height="217px">
<img id="elev2" src="http://genknews.genkcdn.vn/2016/photo-0-1482138225435.gif" type="photo" h="217" w="500" style="float: inline-start;margin-right: 37px;">
<img id="elev3" src="./elevGif.gif" type="photo">
<img id="elev4" src="https://media.giphy.com/media/tyttpGW87UcUb7O6jg4/giphy.gif" type="photo" style="float: inline-start;margin-right: 80px;">
<p id="info" style="font-size: 100px;"> Find the right button to stop the elevator before it crush! <br> <span style="color: red;">Warning! You have 50 seconds.</span> </p>
<button type="button" id="startButton" class="btn btn-outline-success" style="position: fixed; margin-top: -680px; margin-left: 622px; width: 750px; height: 210px; font-size: 90px;" onclick="start_timer()">START</button>
<p id="message" style="font-size: 110px; color: #28a745;"> You are safe! <br> <span style="color: white;">You clicked in <span id="time" ></span></span></p> <br>
<p id="messageDead" style="font-size: 121px;"> I'm sorry but <br><br><br></p>
<p id="messageDead2" style="color: red; font-size:227px; margin-top: -281;"> you are DEAD!</p>
<div id="stopButtons" style="margin-top: -33px;">
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="stop_timer()">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
<button type="button" id="btn1" class="btn btn-outline-danger" onclick="$(this).css( 'visibility', 'hidden' )">STOP</button>
</div>
<!-- Optional JavaScript -->
<!-- jQuery first, then Popper.js, then Bootstrap JS -->
<script src="https://code.jquery.com/jquery-3.3.1.slim.min.js" integrity="sha384-q8i/X+965DzO0rT7abK41JStQIAqVgRVzpbzo5smXKp4YfRvH+8abtTE1Pi6jizo" crossorigin="anonymous"></script>
<script src="https://cdnjs.cloudflare.com/ajax/libs/popper.js/1.14.3/umd/popper.min.js" integrity="sha384-ZMP7rVo3mIykV+2+9J3UJ46jBk0WLaUAdn689aCwoqbBJiSnjAK/l8WvCWPIPm49" crossorigin="anonymous"></script>
<script src="https://stackpath.bootstrapcdn.com/bootstrap/4.1.3/js/bootstrap.min.js" integrity="sha384-ChfqqxuZUCnJSK3+MXmPNIyE6ZbWh2IMqE241rYiqJxyMiZ6OW/JmZQ5stwEULTy" crossorigin="anonymous"></script>
<!-- My Script -->
<script type="text/javascript">
var start;
var clicked = false;
var click_time;
$("#message").hide();
$("#messageDead").hide();
$("#messageDead2").hide();
$("#stopButtons").hide();
$("#elev2").hide();
$("#elev3").hide();
$("#elev4").hide();
function start_timer() {
console.log("start_timer");
$("#startButton").hide();
$("#stopButtons").show();
$("#elev1").hide();
$("#elev2").show();
$("#info").hide();
start = Date.now();
var dead = Date.now() - start;
console.log(start);
console.log(dead);
if ( dead > 3000) {
$("#elev2").hide();
$("#elev4").show();
$("#messageDead").show();
$("#messageDead2").show();
}
}
function stop_timer() {
if (clicked) { return }
console.log("stop_time");
click_time = Date.now() - start;
console.log (click_time,"time has past");
$("#message").show();
$("#time").text(click_time/1000 + " seconds");
$("#elev2").hide();
$("#elev3").show();
$("#info").hide();
$("#stopButtons").hide();
clicked = true;
}
</script>
</body>
</html>

BIN
clippy/._elizabot.js
View File

Binary file not shown.

BIN
clippy/._elizadata.js
View File

Binary file not shown.

BIN
clippy/._jquery.1.7.min.js vendored
View File

Binary file not shown.

10
clippy/clippy.js/MIT-LICENSE.txt
Unescape Escape View File

@ -0,0 +1,10 @@
Copyright (c) 2012 Fireplace, Inc
Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions:
The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
THE ABOVE LICENSE IS FOR THE CODE (JAVASCRIPT AND CSS) IN CLIPPY.JS ONLY.
All Microsoft agents, including agent names, the Clippy brand and all resources are the property of Microsoft and their respective owners.

69
clippy/clippy.js/README.md
Unescape Escape View File

@ -0,0 +1,69 @@
[Clippy.JS](http://smore.com/clippy-js)
=========
Add Clippy or his friends to any website for instant nostalgia.
Read more about the project on [our homepage](http://smore.com/clippy-js).
Usage: Setup
------------
Add this code to you to your page to enable Clippy.js.
```html
<!-- Add the stylesheet to the head -->
<link rel="stylesheet" type="text/css" href="clippy.css" media="all">
...
<!-- Add these scripts to the bottom of the page -->
<!-- jQuery 1.7+ -->
<script src="jquery.1.7.min.js"></script>
<!-- Clippy.js -->
<script src="clippy.min.js"></script>
<!-- Init script -->
<script type="text/javascript">
clippy.load('Merlin', function(agent){
// do anything with the loaded agent
agent.show();
});
</script>
```
Usage: Actions
--------------
All the agent actions are queued and executed by order, so you could stack them.
```javascript
// play a given animation
agent.play('Searching');
// play a random animation
agent.animate();
// get a list of all the animations
agent.animations();
// => ["MoveLeft", "Congratulate", "Hide", "Pleased", "Acknowledge", ...]
// Show text balloon
agent.speak('When all else fails, bind some paper together. My name is Clippy.');
// move to the given point, use animation if available
agent.moveTo(100,100);
// gesture at a given point (if gesture animation is available)
agent.gestureAt(200,200);
// stop the current action in the queue
agent.stopCurrent();
// stop all actions in the queue and go back to idle mode
agent.stop();
```
Special Thanks
--------------
* The awesome [Cinnamon Software](http://www.cinnamonsoftware.com/) for developing [Double Agent](http://doubleagent.sourceforge.net/)
the program we used to unpack Clippy and his friends!
* Microsoft, for creating clippy :)

1
clippy/clippy.js/agents/Bonzi/agent.js
View File

File diff suppressed because one or more lines are too long

BIN
clippy/clippy.js/agents/Bonzi/map.png
View File

Binary file not shown.
Side by Side

After

Width:  |  Height:  |  Size: 815 KiB

1
clippy/clippy.js/agents/Bonzi/sounds-mp3.js
View File

File diff suppressed because one or more lines are too long

1
clippy/clippy.js/agents/Bonzi/sounds-ogg.js
View File

File diff suppressed because one or more lines are too long

1
clippy/clippy.js/agents/Clippy/agent.js
View File

File diff suppressed because one or more lines are too long

BIN
clippy/clippy.js/agents/Clippy/map.png
View File

Binary file not shown.
Side by Side

After

Width:  |  Height:  |  Size: 1.3 MiB

1
clippy/clippy.js/agents/Clippy/sounds-mp3.js
View File

File diff suppressed because one or more lines are too long

1
clippy/clippy.js/agents/Clippy/sounds-ogg.js
View File

File diff suppressed because one or more lines are too long

1
clippy/clippy.js/agents/F1/agent.js
View File

File diff suppressed because one or more lines are too long

BIN
clippy/clippy.js/agents/F1/map.png
View File

Binary file not shown.
Side by Side

After

Width:  |  Height:  |  Size: 1.0 MiB

1
clippy/clippy.js/agents/F1/sounds-mp3.js
View File

File diff suppressed because one or more lines are too long

1
clippy/clippy.js/agents/F1/sounds-ogg.js
View File

File diff suppressed because one or more lines are too long

1
clippy/clippy.js/agents/Genie/agent.js
View File

File diff suppressed because one or more lines are too long

BIN
clippy/clippy.js/agents/Genie/map.png
View File

Binary file not shown.
Side by Side

After

Width:  |  Height:  |  Size: 962 KiB

1
clippy/clippy.js/agents/Genie/sounds-mp3.js
View File

File diff suppressed because one or more lines are too long

1
clippy/clippy.js/agents/Genie/sounds-ogg.js
View File

File diff suppressed because one or more lines are too long

1
clippy/clippy.js/agents/Genius/agent.js
View File

File diff suppressed because one or more lines are too long

BIN
clippy/clippy.js/agents/Genius/map.png
View File

Binary file not shown.
Side by Side

After

Width:  |  Height:  |  Size: 1.1 MiB

1
clippy/clippy.js/agents/Genius/sounds-mp3.js
View File

File diff suppressed because one or more lines are too long

1
clippy/clippy.js/agents/Genius/sounds-ogg.js
View File

File diff suppressed because one or more lines are too long

1
clippy/clippy.js/agents/Links/agent.js
View File

File diff suppressed because one or more lines are too long

BIN
clippy/clippy.js/agents/Links/map.png
View File

Binary file not shown.
Side by Side

After

Width:  |  Height:  |  Size: 800 KiB

1
clippy/clippy.js/agents/Links/sounds-mp3.js
View File

File diff suppressed because one or more lines are too long

1
clippy/clippy.js/agents/Links/sounds-ogg.js
View File

File diff suppressed because one or more lines are too long

1
clippy/clippy.js/agents/Merlin/agent.js
View File

File diff suppressed because one or more lines are too long

BIN
clippy/clippy.js/agents/Merlin/map.png
View File

Binary file not shown.
Side by Side

After

Width:  |  Height:  |  Size: 1013 KiB

1
clippy/clippy.js/agents/Merlin/sounds-mp3.js
View File

File diff suppressed because one or more lines are too long

1
clippy/clippy.js/agents/Merlin/sounds-ogg.js
View File

File diff suppressed because one or more lines are too long

1
clippy/clippy.js/agents/Peedy/agent.js
View File

File diff suppressed because one or more lines are too long

BIN
clippy/clippy.js/agents/Peedy/map.png
View File

Binary file not shown.
Side by Side

After

Width:  |  Height:  |  Size: 1.8 MiB

1
clippy/clippy.js/agents/Peedy/sounds-mp3.js
View File

File diff suppressed because one or more lines are too long

1
clippy/clippy.js/agents/Peedy/sounds-ogg.js
View File

File diff suppressed because one or more lines are too long

1
clippy/clippy.js/agents/Rocky/agent.js
View File

File diff suppressed because one or more lines are too long

BIN
clippy/clippy.js/agents/Rocky/map.png
View File

Binary file not shown.
Side by Side

After

Width:  |  Height:  |  Size: 1.2 MiB

1
clippy/clippy.js/agents/Rocky/sounds-mp3.js
View File

File diff suppressed because one or more lines are too long

1
clippy/clippy.js/agents/Rocky/sounds-ogg.js
View File

File diff suppressed because one or more lines are too long

1
clippy/clippy.js/agents/Rover/agent.js
View File

File diff suppressed because one or more lines are too long

BIN
clippy/clippy.js/agents/Rover/map.png
View File

Binary file not shown.
Side by Side

After

Width:  |  Height:  |  Size: 682 KiB

1
clippy/clippy.js/agents/Rover/sounds-mp3.js
View File

File diff suppressed because one or more lines are too long

1
clippy/clippy.js/agents/Rover/sounds-ogg.js
View File

File diff suppressed because one or more lines are too long

62
clippy/clippy.js/build/clippy.css
Unescape Escape View File

@ -0,0 +1,62 @@
.clippy, .clippy-balloon {
position: fixed;
z-index: 1000;
cursor: pointer;
}
.clippy-balloon {
background: #FFC;
color: black;
padding: 8px;
border: 1px solid black;
border-radius: 5px;
}
.clippy-content {
max-width: 200px;
min-width: 120px;
font-family: "Microsoft Sans", sans-serif;
font-size: 10pt;
}
.clippy-tip {
width: 10px;
height: 16px;
background: url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABQAAAAgCAMAAAAlvKiEAAAAGXRFWHRTb2Z0d2FyZQBBZG9iZSBJbWFnZVJlYWR5ccllPAAAAAlQTFRF///MAAAA////52QwgAAAAAN0Uk5T//8A18oNQQAAAGxJREFUeNqs0kEOwCAIRFHn3//QTUU6xMyyxii+jQosrTPkyPEM6IN3FtzIRk1U4dFeKWQiH6pRRowMVKEmvronEynkwj0uZJgR22+YLopPSo9P34wJSamLSU7lSIWLJU7NkNomNlhqxUeAAQC+TQLZyEuJBwAAAABJRU5ErkJggg==) no-repeat;
position: absolute;
}
.clippy-top-left .clippy-tip {
top: 100%;
margin-top: 0px;
left: 100%;
margin-left: -50px;
}
.clippy-top-right .clippy-tip {
top: 100%;
margin-top: 0px;
left: 0;
margin-left: 50px;
background-position: -10px 0;
}
.clippy-bottom-right .clippy-tip {
top: 0;
margin-top: -16px;
left: 0;
margin-left: 50px;
background-position: -10px -16px;
}
.clippy-bottom-left .clippy-tip {
top: 0;
margin-top: -16px;
left: 100%;
margin-left: -50px;
background-position: 0px -16px;
}

1015
clippy/clippy.js/build/clippy.js
View File

File diff suppressed because it is too large Load Diff

1
clippy/clippy.js/build/clippy.min.js vendored
View File

File diff suppressed because one or more lines are too long

459
clippy/clippy.js/src/agent.js
Unescape Escape View File

@ -0,0 +1,459 @@
var clippy = {};
/******
*
*
* @constructor
*/
clippy.Agent = function (path, data, sounds) {
this.path = path;
this._queue = new clippy.Queue($.proxy(this._onQueueEmpty, this));
this._el = $('<div class="clippy"></div>').hide();
$(document.body).append(this._el);
this._animator = new clippy.Animator(this._el, path, data, sounds);
this._balloon = new clippy.Balloon(this._el);
this._setupEvents();
};
clippy.Agent.prototype = {
/**************************** API ************************************/
/***
*
* @param {Number} x
* @param {Number} y
*/
gestureAt:function (x, y) {
var d = this._getDirection(x, y);
var gAnim = 'Gesture' + d;
var lookAnim = 'Look' + d;
var animation = this.hasAnimation(gAnim) ? gAnim : lookAnim;
return this.play(animation);
},
/***
*
* @param {Boolean=} fast
*
*/
hide:function (fast, callback) {
this._hidden = true;
var el = this._el;
this.stop();
if (fast) {
this._el.hide();
this.stop();
this.pause();
if (callback) callback();
return;
}
return this._playInternal('Hide', function () {
el.hide();
this.pause();
if (callback) callback();
})
},
moveTo:function (x, y, duration) {
var dir = this._getDirection(x, y);
var anim = 'Move' + dir;
if (duration === undefined) duration = 1000;
this._addToQueue(function (complete) {
// the simple case
if (duration === 0) {
this._el.css({top:y, left:x});
this.reposition();
complete();
return;
}
// no animations
if (!this.hasAnimation(anim)) {
this._el.animate({top:y, left:x}, duration, complete);
return;
}
var callback = $.proxy(function (name, state) {
// when exited, complete
if (state === clippy.Animator.States.EXITED) {
complete();
}
// if waiting,
if (state === clippy.Animator.States.WAITING) {
this._el.animate({top:y, left:x}, duration, $.proxy(function () {
// after we're done with the movement, do the exit animation
this._animator.exitAnimation();
}, this));
}
}, this);
this._playInternal(anim, callback);
}, this);
},
_playInternal:function (animation, callback) {
// if we're inside an idle animation,
if (this._isIdleAnimation() && this._idleDfd && this._idleDfd.state() === 'pending') {
this._idleDfd.done($.proxy(function () {
this._playInternal(animation, callback);
}, this))
}
this._animator.showAnimation(animation, callback);
},
play:function (animation, timeout, cb) {
if (!this.hasAnimation(animation)) return false;
if (timeout === undefined) timeout = 5000;
this._addToQueue(function (complete) {
var completed = false;
// handle callback
var callback = function (name, state) {
if (state === clippy.Animator.States.EXITED) {
completed = true;
if (cb) cb();
complete();
}
};
// if has timeout, register a timeout function
if (timeout) {
window.setTimeout($.proxy(function () {
if (completed) return;
// exit after timeout
this._animator.exitAnimation();
}, this), timeout)
}
this._playInternal(animation, callback);
}, this);
return true;
},
/***
*
* @param {Boolean=} fast
*/
show:function (fast) {
this._hidden = false;
if (fast) {
this._el.show();
this.resume();
this._onQueueEmpty();
return;
}
if (this._el.css('top') === 'auto' || !this._el.css('left') === 'auto') {
var left = $(window).width() * 0.8;
var top = ($(window).height() + $(document).scrollTop()) * 0.8;
this._el.css({top:top, left:left});
}
this.resume();
return this.play('Show');
},
/***
*
* @param {String} text
*/
speak:function (text, hold) {
this._addToQueue(function (complete) {
this._balloon.speak(complete, text, hold);
}, this);
},
/***
* Close the current balloon
*/
closeBalloon:function () {
this._balloon.hide();
},
delay:function (time) {
time = time || 250;
this._addToQueue(function (complete) {
this._onQueueEmpty();
window.setTimeout(complete, time);
});
},
/***
* Skips the current animation
*/
stopCurrent:function () {
this._animator.exitAnimation();
this._balloon.close();
},
stop:function () {
// clear the queue
this._queue.clear();
this._animator.exitAnimation();
this._balloon.hide();
},
/***
*
* @param {String} name
* @returns {Boolean}
*/
hasAnimation:function (name) {
return this._animator.hasAnimation(name);
},
/***
* Gets a list of animation names
*
* @return {Array.<string>}
*/
animations:function () {
return this._animator.animations();
},
/***
* Play a random animation
* @return {jQuery.Deferred}
*/
animate:function () {
var animations = this.animations();
var anim = animations[Math.floor(Math.random() * animations.length)];
// skip idle animations
if (anim.indexOf('Idle') === 0) {
return this.animate();
}
return this.play(anim);
},
/**************************** Utils ************************************/
/***
*
* @param {Number} x
* @param {Number} y
* @return {String}
* @private
*/
_getDirection:function (x, y) {
var offset = this._el.offset();
var h = this._el.height();
var w = this._el.width();
var centerX = (offset.left + w / 2);
var centerY = (offset.top + h / 2);
var a = centerY - y;
var b = centerX - x;
var r = Math.round((180 * Math.atan2(a, b)) / Math.PI);
// Left and Right are for the character, not the screen :-/
if (-45 <= r && r < 45) return 'Right';
if (45 <= r && r < 135) return 'Up';
if (135 <= r && r <= 180 || -180 <= r && r < -135) return 'Left';
if (-135 <= r && r < -45) return 'Down';
// sanity check
return 'Top';
},
/**************************** Queue and Idle handling ************************************/
/***
* Handle empty queue.
* We need to transition the animation to an idle state
* @private
*/
_onQueueEmpty:function () {
if (this._hidden || this._isIdleAnimation()) return;
var idleAnim = this._getIdleAnimation();
this._idleDfd = $.Deferred();
this._animator.showAnimation(idleAnim, $.proxy(this._onIdleComplete, this));
},
_onIdleComplete:function (name, state) {
if (state === clippy.Animator.States.EXITED) {
this._idleDfd.resolve();
}
},
/***
* Is the current animation is Idle?
* @return {Boolean}
* @private
*/
_isIdleAnimation:function () {
var c = this._animator.currentAnimationName;
return c && c.indexOf('Idle') === 0;
},
/**
* Gets a random Idle animation
* @return {String}
* @private
*/
_getIdleAnimation:function () {
var animations = this.animations();
var r = [];
for (var i = 0; i < animations.length; i++) {
var a = animations[i];
if (a.indexOf('Idle') === 0) {
r.push(a);
}
}
// pick one
var idx = Math.floor(Math.random() * r.length);
return r[idx];
},
/**************************** Events ************************************/
_setupEvents:function () {
$(window).on('resize', $.proxy(this.reposition, this));
this._el.on('mousedown', $.proxy(this._onMouseDown, this));
this._el.on('dblclick', $.proxy(this._onDoubleClick, this));
},
_onDoubleClick:function () {
if (!this.play('ClickedOn')) {
this.animate();
}
},
reposition:function () {
if (!this._el.is(':visible')) return;
var o = this._el.offset();
var bH = this._el.outerHeight();
var bW = this._el.outerWidth();
var wW = $(window).width();
var wH = $(window).height();
var sT = $(window).scrollTop();
var sL = $(window).scrollLeft();
var top = o.top - sT;
var left = o.left - sL;
var m = 5;
if (top - m < 0) {
top = m;
} else if ((top + bH + m) > wH) {
top = wH - bH - m;
}
if (left - m < 0) {
left = m;
} else if (left + bW + m > wW) {
left = wW - bW - m;
}
this._el.css({left:left, top:top});
// reposition balloon
this._balloon.reposition();
},
_onMouseDown:function (e) {
e.preventDefault();
this._startDrag(e);
},
/**************************** Drag ************************************/
_startDrag:function (e) {
// pause animations
this.pause();
this._balloon.hide(true);
this._offset = this._calculateClickOffset(e);
this._moveHandle = $.proxy(this._dragMove, this);
this._upHandle = $.proxy(this._finishDrag, this);
$(window).on('mousemove', this._moveHandle);
$(window).on('mouseup', this._upHandle);
this._dragUpdateLoop = window.setTimeout($.proxy(this._updateLocation, this), 10);
},
_calculateClickOffset:function (e) {
var mouseX = e.pageX;
var mouseY = e.pageY;
var o = this._el.offset();
return {
top:mouseY - o.top,
left:mouseX - o.left
}
},
_updateLocation:function () {
this._el.css({top:this._targetY, left:this._targetX});
this._dragUpdateLoop = window.setTimeout($.proxy(this._updateLocation, this), 10);
},
_dragMove:function (e) {
e.preventDefault();
var x = e.clientX - this._offset.left;
var y = e.clientY - this._offset.top;
this._targetX = x;
this._targetY = y;
},
_finishDrag:function () {
window.clearTimeout(this._dragUpdateLoop);
// remove handles
$(window).off('mousemove', this._moveHandle);
$(window).off('mouseup', this._upHandle);
// resume animations
this._balloon.show();
this.reposition();
this.resume();
},
_addToQueue:function (func, scope) {
if (scope) func = $.proxy(func, scope);
this._queue.queue(func);
},
/**************************** Pause and Resume ************************************/
pause:function () {
this._animator.pause();
this._balloon.pause();
},
resume:function () {
this._animator.resume();
this._balloon.resume();
}
};

191
clippy/clippy.js/src/animator.js
Unescape Escape View File

@ -0,0 +1,191 @@
/******
*
*
* @constructor
*/
clippy.Animator = function (el, path, data, sounds) {
this._el = el;
this._data = data;
this._path = path;
this._currentFrameIndex = 0;
this._currentFrame = undefined;
this._exiting = false;
this._currentAnimation = undefined;
this._endCallback = undefined;
this._started = false;
this._sounds = {};
this.currentAnimationName = undefined;
this.preloadSounds(sounds);
this._overlays = [this._el];
var curr = this._el;
this._setupElement(this._el);
for (var i = 1; i < this._data.overlayCount; i++) {
var inner = this._setupElement($('<div></div>'));
curr.append(inner);
this._overlays.push(inner);
curr = inner;
}
};
clippy.Animator.prototype = {
_setupElement:function (el) {
var frameSize = this._data.framesize;
el.css('display', "none");
el.css({width:frameSize[0], height:frameSize[1]});
el.css('background', "url('" + this._path + "/map.png') no-repeat");
return el;
},
animations:function () {
var r = [];
var d = this._data.animations;
for (var n in d) {
r.push(n);
}
return r;
},
preloadSounds:function (sounds) {
for (var i = 0; i < this._data.sounds.length; i++) {
var snd = this._data.sounds[i];
var uri = sounds[snd];
if (!uri) continue;
this._sounds[snd] = new Audio(uri);
}
},
hasAnimation:function (name) {
return !!this._data.animations[name];
},
exitAnimation:function () {
this._exiting = true;
},
showAnimation:function (animationName, stateChangeCallback) {
this._exiting = false;
if (!this.hasAnimation(animationName)) {
return false;
}
this._currentAnimation = this._data.animations[animationName];
this.currentAnimationName = animationName;
if (!this._started) {
this._step();
this._started = true;
}
this._currentFrameIndex = 0;
this._currentFrame = undefined;
this._endCallback = stateChangeCallback;
return true;
},
_draw:function () {
var images = [];
if (this._currentFrame) images = this._currentFrame.images || [];
for (var i = 0; i < this._overlays.length; i++) {
if (i < images.length) {
var xy = images[i];
var bg = -xy[0] + 'px ' + -xy[1] + 'px';
this._overlays[i].css({'background-position':bg, 'display':'block'});
}
else {
this._overlays[i].css('display', 'none');
}
}
},
_getNextAnimationFrame:function () {
if (!this._currentAnimation) return undefined;
// No current frame. start animation.
if (!this._currentFrame) return 0;
var currentFrame = this._currentFrame;
var branching = this._currentFrame.branching;
if (this._exiting && currentFrame.exitBranch !== undefined) {
return currentFrame.exitBranch;
}
else if (branching) {
var rnd = Math.random() * 100;
for (var i = 0; i < branching.branches.length; i++) {
var branch = branching.branches[i];
if (rnd <= branch.weight) {
return branch.frameIndex;
}
rnd -= branch.weight;
}
}
return this._currentFrameIndex + 1;
},
_playSound:function () {
var s = this._currentFrame.sound;
if (!s) return;
var audio = this._sounds[s];
if (audio) audio.play();
},
_atLastFrame:function () {
return this._currentFrameIndex >= this._currentAnimation.frames.length - 1;
},
_step:function () {
if (!this._currentAnimation) return;
var newFrameIndex = Math.min(this._getNextAnimationFrame(), this._currentAnimation.frames.length - 1);
var frameChanged = !this._currentFrame || this._currentFrameIndex !== newFrameIndex;
this._currentFrameIndex = newFrameIndex;
// always switch frame data, unless we're at the last frame of an animation with a useExitBranching flag.
if (!(this._atLastFrame() && this._currentAnimation.useExitBranching)) {
this._currentFrame = this._currentAnimation.frames[this._currentFrameIndex];
}
this._draw();
this._playSound();
this._loop = window.setTimeout($.proxy(this._step, this), this._currentFrame.duration);
// fire events if the frames changed and we reached an end
if (this._endCallback && frameChanged && this._atLastFrame()) {
if (this._currentAnimation.useExitBranching && !this._exiting) {
this._endCallback(this.currentAnimationName, clippy.Animator.States.WAITING);
}
else {
this._endCallback(this.currentAnimationName, clippy.Animator.States.EXITED);
}
}
},
/***
* Pause animation execution
*/
pause:function () {
window.clearTimeout(this._loop);
},
/***
* Resume animation
*/
resume:function () {
this._step();
}
};
clippy.Animator.States = { WAITING:1, EXITED:0 };

200
clippy/clippy.js/src/balloon.js
Unescape Escape View File

@ -0,0 +1,200 @@
/******
*
*
* @constructor
*/
clippy.Balloon = function (targetEl) {
this._targetEl = targetEl;
this._hidden = true;
this._setup();
};
clippy.Balloon.prototype = {
WORD_SPEAK_TIME:200,
CLOSE_BALLOON_DELAY:2000,
_setup:function () {
this._balloon = $('<div class="clippy-balloon"><div class="clippy-tip"></div><div class="clippy-content"></div></div> ').hide();
this._content = this._balloon.find('.clippy-content');
$(document.body).append(this._balloon);
},
reposition:function () {
var sides = ['top-left', 'top-right', 'bottom-left', 'bottom-right'];
for (var i = 0; i < sides.length; i++) {
var s = sides[i];
this._position(s);
if (!this._isOut()) break;
}
},
_BALLOON_MARGIN:15,
/***
*
* @param side
* @private
*/
_position:function (side) {
var o = this._targetEl.offset();
var h = this._targetEl.height();
var w = this._targetEl.width();
o.top -= $(window).scrollTop();
o.left -= $(window).scrollLeft();
var bH = this._balloon.outerHeight();
var bW = this._balloon.outerWidth();
this._balloon.removeClass('clippy-top-left');
this._balloon.removeClass('clippy-top-right');
this._balloon.removeClass('clippy-bottom-right');
this._balloon.removeClass('clippy-bottom-left');
var left, top;
switch (side) {
case 'top-left':
// right side of the balloon next to the right side of the agent
left = o.left + w - bW;
top = o.top - bH - this._BALLOON_MARGIN;
break;
case 'top-right':
// left side of the balloon next to the left side of the agent
left = o.left;
top = o.top - bH - this._BALLOON_MARGIN;
break;
case 'bottom-right':
// right side of the balloon next to the right side of the agent
left = o.left;
top = o.top + h + this._BALLOON_MARGIN;
break;
case 'bottom-left':
// left side of the balloon next to the left side of the agent
left = o.left + w - bW;
top = o.top + h + this._BALLOON_MARGIN;
break;
}
this._balloon.css({top:top, left:left});
this._balloon.addClass('clippy-' + side);
},
_isOut:function () {
var o = this._balloon.offset();
var bH = this._balloon.outerHeight();
var bW = this._balloon.outerWidth();
var wW = $(window).width();
var wH = $(window).height();
var sT = $(document).scrollTop();
var sL = $(document).scrollLeft();
var top = o.top - sT;
var left = o.left - sL;
var m = 5;
if (top - m < 0 || left - m < 0) return true;
if ((top + bH + m) > wH || (left + bW + m) > wW) return true;
return false;
},
speak:function (complete, text, hold) {
this._hidden = false;
this.show();
var c = this._content;
// set height to auto
c.height('auto');
c.width('auto');
// add the text
c.text(text);
// set height
c.height(c.height());
c.width(c.width());
c.text('');
this.reposition();
this._complete = complete;
this._sayWords(text, hold, complete);
},
show:function () {
if (this._hidden) return;
this._balloon.show();
},
hide:function (fast) {
if (fast) {
this._balloon.hide();
return;
}
this._hiding = window.setTimeout($.proxy(this._finishHideBalloon, this), this.CLOSE_BALLOON_DELAY);
},
_finishHideBalloon:function () {
if (this._active) return;
this._balloon.hide();
this._hidden = true;
this._hiding = null;
},
_sayWords:function (text, hold, complete) {
this._active = true;
this._hold = hold;
var words = text.split(/[^\S-]/);
var time = this.WORD_SPEAK_TIME;
var el = this._content;
var idx = 1;
this._addWord = $.proxy(function () {
if (!this._active) return;
if (idx > words.length) {
delete this._addWord;
this._active = false;
if (!this._hold) {
complete();
this.hide();
}
} else {
el.text(words.slice(0, idx).join(' '));
idx++;
this._loop = window.setTimeout($.proxy(this._addWord, this), time);
}
}, this);
this._addWord();
},
close:function () {
if (this._active) {
this._hold = false;
} else if (this._hold) {
this._complete();
}
},
pause:function () {
window.clearTimeout(this._loop);
if (this._hiding) {
window.clearTimeout(this._hiding);
this._hiding = null;
}
},
resume:function () {
if (this._addWord) {
this._addWord();
} else if (!this._hold && !this._hidden) {
this._hiding = window.setTimeout($.proxy(this._finishHideBalloon, this), this.CLOSE_BALLOON_DELAY);
}
}
};

62
clippy/clippy.js/src/clippy.css
Unescape Escape View File

@ -0,0 +1,62 @@
.clippy, .clippy-balloon {
position: fixed;
z-index: 1000;
cursor: pointer;
}
.clippy-balloon {
background: #FFC;
color: black;
padding: 8px;
border: 1px solid black;
border-radius: 5px;
}
.clippy-content {
max-width: 200px;
min-width: 120px;
font-family: "Microsoft Sans", sans-serif;
font-size: 10pt;
}
.clippy-tip {
width: 10px;
height: 16px;
background: url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABQAAAAgCAMAAAAlvKiEAAAAGXRFWHRTb2Z0d2FyZQBBZG9iZSBJbWFnZVJlYWR5ccllPAAAAAlQTFRF///MAAAA////52QwgAAAAAN0Uk5T//8A18oNQQAAAGxJREFUeNqs0kEOwCAIRFHn3//QTUU6xMyyxii+jQosrTPkyPEM6IN3FtzIRk1U4dFeKWQiH6pRRowMVKEmvronEynkwj0uZJgR22+YLopPSo9P34wJSamLSU7lSIWLJU7NkNomNlhqxUeAAQC+TQLZyEuJBwAAAABJRU5ErkJggg==) no-repeat;
position: absolute;
}
.clippy-top-left .clippy-tip {
top: 100%;
margin-top: 0px;
left: 100%;
margin-left: -50px;
}
.clippy-top-right .clippy-tip {
top: 100%;
margin-top: 0px;
left: 0;
margin-left: 50px;
background-position: -10px 0;
}
.clippy-bottom-right .clippy-tip {
top: 0;
margin-top: -16px;
left: 0;
margin-left: 50px;
background-position: -10px -16px;
}
.clippy-bottom-left .clippy-tip {
top: 0;
margin-top: -16px;
left: 100%;
margin-left: -50px;
background-position: 0px -16px;
}

BIN
clippy/clippy.js/src/images/border.png
View File

Binary file not shown.
Side by Side

After

Width:  |  Height:  |  Size: 229 B

4
clippy/clippy.js/src/images/tip.PNG
Unescape Escape View File

@ -0,0 +1,4 @@
‰PNG

IHDR   %¼¨„ tEXtSoftware Adobe ImageReadyqÉe< PLTEÿÿÌ ÿÿÿçd0€ tRNSÿÿ ×Ê A lIDATxÚ¬ÒAÀ DQçßÿÐME:Ä̲Æ(¾<>
,­3äÈñ èƒwÜÈFMTáÑ^)d"ªQFŒ T¡&¾º')äÂ=.d˜Ûo˜.ŠOJ<4F>Oߌ I©‹INåH…‹%NÍ<4E>Ú&6XjÅG€ ¾MÙÈK‰ IEND®B`‚
Side by Side

After

Width:  |  Height:  |  Size: 238 B

118
clippy/clippy.js/src/load.js
Unescape Escape View File

@ -0,0 +1,118 @@
clippy.BASE_PATH = '//s3.amazonaws.com/clippy.js/Agents/';
clippy.load = function (name, successCb, failCb) {
var path = clippy.BASE_PATH + name;
var mapDfd = clippy.load._loadMap(path);
var agentDfd = clippy.load._loadAgent(name, path);
var soundsDfd = clippy.load._loadSounds(name, path);
var data;
agentDfd.done(function (d) {
data = d;
});
var sounds;
soundsDfd.done(function (d) {
sounds = d;
});
// wrapper to the success callback
var cb = function () {
var a = new clippy.Agent(path, data,sounds);
successCb(a);
};
$.when(mapDfd, agentDfd, soundsDfd).done(cb).fail(failCb);
};
clippy.load._maps = {};
clippy.load._loadMap = function (path) {
var dfd = clippy.load._maps[path];
if (dfd) return dfd;
// set dfd if not defined
dfd = clippy.load._maps[path] = $.Deferred();
var src = path + '/map.png';
var img = new Image();
img.onload = dfd.resolve;
img.onerror = dfd.reject;
// start loading the map;
img.setAttribute('src', src);
return dfd.promise();
};
clippy.load._sounds = {};
clippy.load._loadSounds = function (name, path) {
var dfd = clippy.load._sounds[name];
if (dfd) return dfd;
// set dfd if not defined
dfd = clippy.load._sounds[name] = $.Deferred();
var audio = document.createElement('audio');
var canPlayMp3 = !!audio.canPlayType && "" != audio.canPlayType('audio/mpeg');
var canPlayOgg = !!audio.canPlayType && "" != audio.canPlayType('audio/ogg; codecs="vorbis"');
if (!canPlayMp3 && !canPlayOgg) {
dfd.resolve({});
} else {
var src = path + (canPlayMp3 ? '/sounds-mp3.js' : '/sounds-ogg.js');
// load
clippy.load._loadScript(src);
}
return dfd.promise()
};
clippy.load._data = {};
clippy.load._loadAgent = function (name, path) {
var dfd = clippy.load._data[name];
if (dfd) return dfd;
dfd = clippy.load._getAgentDfd(name);
var src = path + '/agent.js';
clippy.load._loadScript(src);
return dfd.promise();
};
clippy.load._loadScript = function (src) {
var script = document.createElement('script');
script.setAttribute('src', src);
script.setAttribute('async', 'async');
script.setAttribute('type', 'text/javascript');
document.head.appendChild(script);
};
clippy.load._getAgentDfd = function (name) {
var dfd = clippy.load._data[name];
if (!dfd) {
dfd = clippy.load._data[name] = $.Deferred();
}
return dfd;
};
clippy.ready = function (name, data) {
var dfd = clippy.load._getAgentDfd(name);
dfd.resolve(data);
};
clippy.soundsReady = function (name, data) {
var dfd = clippy.load._sounds[name];
if (!dfd) {
dfd = clippy.load._sounds[name] = $.Deferred();
}
dfd.resolve(data);
};

50
clippy/clippy.js/src/queue.js
Unescape Escape View File

@ -0,0 +1,50 @@
/******
* Tiny Queue
*
* @constructor
*/
clippy.Queue = function (onEmptyCallback) {
this._queue = [];
this._onEmptyCallback = onEmptyCallback;
};
clippy.Queue.prototype = {
/***
*
* @param {function(Function)} func
* @returns {jQuery.Deferred}
*/
queue:function (func) {
this._queue.push(func);
if (this._queue.length === 1 && !this._active) {
this._progressQueue();
}
},
_progressQueue:function () {
// stop if nothing left in queue
if (!this._queue.length) {
this._onEmptyCallback();
return;
}
var f = this._queue.shift();
this._active = true;
// execute function
var completeFunction = $.proxy(this.next, this);
f(completeFunction);
},
clear:function () {
this._queue = [];
},
next:function () {
this._active = false;
this._progressQueue();
}
};

144
clippy/clippy_eliza.html
Unescape Escape View File

@ -0,0 +1,144 @@
<HTML>
<HEAD>
<meta charset="utf-8">
<TITLE>Eliza (elizabot.js)</TITLE>
<SCRIPT LANGUAGE="JavaScript" TYPE="text/javascript" SRC="elizabot.js"></SCRIPT>
<SCRIPT LANGUAGE="JavaScript" TYPE="text/javascript" SRC="elizadata.js"></SCRIPT>
<link rel="stylesheet" type="text/css" href="./clippy.js/build/clippy.css" media="all">
<SCRIPT LANGUAGE="JavaScript" TYPE="text/javascript">
var eliza = new ElizaBot();
var elizaLines = new Array();
var displayCols = 60;
var displayRows = 20;
function elizaReset() {
eliza.reset();
elizaLines.length = 0;
elizaStep();
}
</SCRIPT>
<style type="text/css">
textarea {
display: none;
}
.clippy {
transform: scale(0.7, 0.7);
}
</style>
</HEAD>
<BODY TOPMARGIN="0" LEFTMARGIN="0" RIGHTMARGIN="0" BOTTOMMARGIN="0" MARGINHEIGHT="0" MARGINWIDTH="0" STYLE="border:0" onload="window.setTimeout('elizaReset()',100)"><A NAME="top"></A>
<CENTER>
<TABLE BORDER="0" CELLSPACING="10" CELLPADDING="0">
<FORM NAME="e_form" onsubmit="elizaStep();return false">
<TR><TD COLSPAN="2"><TEXTAREA NAME="e_display" COLS="60" ROWS="20"></TEXTAREA></TD></TR>
<TR VALIGN="middle">
<TD><INPUT TYPE="text" NAME="e_input" SIZE="50"></TD>
<TD ALIGN="right"><INPUT TYPE="submit" VALUE="&nbsp;Talk&nbsp;"></TD>
</TR>
</FORM>
<script src="./jquery.1.7.min.js"></script>
<script src="./clippy.js/build/clippy.js"></script>
<script type="text/javascript">
var rpl;
function getRandomInt(max) {
return Math.floor(Math.random() * Math.floor(max));
};
function elizaStep() {
var f = document.forms.e_form;
var userinput = f.e_input.value;
if (eliza.quit) {
f.e_input.value = '';
if (confirm("This session is over.\nStart over?")) elizaReset();
f.e_input.focus();
return;
}
else if (userinput != '') {
var usr = 'YOU: ' + userinput;
rpl = eliza.transform(userinput);
elizaLines.push(usr);
elizaLines.push(rpl);
clippy.load('Clippy', function(agent){
agent.show();
//agent.play('Searching');
//agent.animate();
//agent.animations();
//agent.moveTo();
//agent.play();
agent.moveTo( getRandomInt(screen.width-100), getRandomInt(screen.height-200) );
agent.speak(rpl);
agent.animate();
//agent.gestureAt(200,200);
//agent.stopCurrent();
//agent.stop();
});
// display nicely
// (fit to textarea with last line free - reserved for extra line caused by word wrap)
var temp = new Array();
var l = 0;
for (var i=elizaLines.length-1; i>=0; i--) {
l += 1 + Math.floor(elizaLines[i].length/displayCols);
if (l >= displayRows) break
else temp.push(elizaLines[i]);
}
elizaLines = temp.reverse();
f.e_display.value = elizaLines.join('\n');
}
else if (elizaLines.length == 0) {
// no input and no saved lines -> output initial
var initial = 'ELIZA: ' + eliza.getInitial();
elizaLines.push(initial);
f.e_display.value = initial + '\n';
clippy.load('Clippy', function(agent){
agent.show();
//agent.play('Searching');
//agent.animate();
//agent.animations();
//agent.moveTo();
//agent.play();
agent.animate();
agent.speak('Hi Im Clippy');
setTimeout(function(){ agent.speak('How do you do? Please tell me your problem.') }, 1000);
//agent.gestureAt(200,200);
//agent.stopCurrent();
//agent.stop();
});
}
f.e_input.value = '';
f.e_input.focus();
}
</script>
</BODY>
</HTML>

49
clippy/clippy_world.html
Unescape Escape View File

@ -0,0 +1,49 @@
<!DOCTYPE html>
<html>
<head>
<meta charset="utf-8">
<meta name="viewport" content="width=device-width, initial-scale=10">
<title>Clippy</title>
<link rel="stylesheet" type="text/css" href="./clippy.js/build/clippy.css" media="all">
</head>
<body>
<h1>Hello Clippy!</h1>
<script src="./jquery.1.7.min.js"></script>
<script src="./clippy.js/build/clippy.js"></script>
<script type="text/javascript">
function getRandomInt(max) {
return Math.floor(Math.random() * Math.floor(max));
};
for (var i = 0; i < 30; i++) {
clippy.load('Clippy', function(agent){
//agent.play('Searching');
//agent.animate();
//agent.animations();
//agent.speak('When all else fails, bind some paper together. My name is Clippy.');
for (var i = 0; i < 50; i++) {
agent.show();
agent.moveTo(getRandomInt(screen.width-100),getRandomInt(screen.height-200));
agent.animate();
agent.speak('Wooooo');
};
//agent.gestureAt(200,200);
//agent.stopCurrent();
//agent.stop();
});
};
</script>
</body>
</html>

49
clippy/clippy_world.jpg
Unescape Escape View File

@ -0,0 +1,49 @@
<!DOCTYPE html>
<html>
<head>
<meta charset="utf-8">
<meta name="viewport" content="width=device-width, initial-scale=10">
<title>Clippy</title>
<link rel="stylesheet" type="text/css" href="./clippy.js/build/clippy.css" media="all">
</head>
<body>
<h1>Hello Clippy!</h1>
<script src="./jquery.1.7.min.js"></script>
<script src="./clippy.js/build/clippy.js"></script>
<script type="text/javascript">
function getRandomInt(max) {
return Math.floor(Math.random() * Math.floor(max));
};
for (var i = 0; i < 30; i++) {
clippy.load('Clippy', function(agent){
//agent.play('Searching');
//agent.animate();
//agent.animations();
//agent.speak('When all else fails, bind some paper together. My name is Clippy.');
for (var i = 0; i < 50; i++) {
agent.show();
agent.moveTo(getRandomInt(screen.width-100),getRandomInt(screen.height-200));
agent.animate();
agent.speak('Wooooo');
};
//agent.gestureAt(200,200);
//agent.stopCurrent();
//agent.stop();
});
};
</script>
</body>
</html>

391
clippy/elizabot.js
Unescape Escape View File

@ -0,0 +1,391 @@
/*
elizabot.js v.1.1 - ELIZA JS library (N.Landsteiner 2005)
Eliza is a mock Rogerian psychotherapist.
Original program by Joseph Weizenbaum in MAD-SLIP for "Project MAC" at MIT.
cf: Weizenbaum, Joseph "ELIZA - A Computer Program For the Study of Natural Language
Communication Between Man and Machine"
in: Communications of the ACM; Volume 9 , Issue 1 (January 1966): p 36-45.
JavaScript implementation by Norbert Landsteiner 2005; <http://www.masserk.at>
synopsis:
new ElizaBot( <random-choice-disable-flag> )
ElizaBot.prototype.transform( <inputstring> )
ElizaBot.prototype.getInitial()
ElizaBot.prototype.getFinal()
ElizaBot.prototype.reset()
usage: var eliza = new ElizaBot();
var initial = eliza.getInitial();
var reply = eliza.transform(inputstring);
if (eliza.quit) {
// last user input was a quit phrase
}
// method `transform()' returns a final phrase in case of a quit phrase
// but you can also get a final phrase with:
var final = eliza.getFinal();
// other methods: reset memory and internal state
eliza.reset();
// to set the internal memory size override property `memSize':
eliza.memSize = 100; // (default: 20)
// to reproduce the example conversation given by J. Weizenbaum
// initialize with the optional random-choice-disable flag
var originalEliza = new ElizaBot(true);
`ElizaBot' is also a general chatbot engine that can be supplied with any rule set.
(for required data structures cf. "elizadata.js" and/or see the documentation.)
data is parsed and transformed for internal use at the creation time of the
first instance of the `ElizaBot' constructor.
vers 1.1: lambda functions in RegExps are currently a problem with too many browsers.
changed code to work around.
*/
function ElizaBot(noRandomFlag) {
this.noRandom= (noRandomFlag)? true:false;
this.capitalizeFirstLetter=true;
this.debug=false;
this.memSize=20;
this.version="1.1 (original)";
if (!this._dataParsed) this._init();
this.reset();
}
ElizaBot.prototype.reset = function() {
this.quit=false;
this.mem=[];
this.lastchoice=[];
for (var k=0; k<elizaKeywords.length; k++) {
this.lastchoice[k]=[];
var rules=elizaKeywords[k][2];
for (var i=0; i<rules.length; i++) this.lastchoice[k][i]=-1;
}
}
ElizaBot.prototype._dataParsed = false;
ElizaBot.prototype._init = function() {
// install ref to global object
var global=ElizaBot.prototype.global=self;
// parse data and convert it from canonical form to internal use
// prodoce synonym list
var synPatterns={};
if ((global.elizaSynons) && (typeof elizaSynons == 'object')) {
for (var i in elizaSynons) synPatterns[i]='('+i+'|'+elizaSynons[i].join('|')+')';
}
// check for keywords or install empty structure to prevent any errors
if ((!global.elizaKeywords) || (typeof elizaKeywords.length == 'undefined')) {
elizaKeywords=[['###',0,[['###',[]]]]];
}
// 1st convert rules to regexps
// expand synonyms and insert asterisk expressions for backtracking
var sre=/@(\S+)/;
var are=/(\S)\s*\*\s*(\S)/;
var are1=/^\s*\*\s*(\S)/;
var are2=/(\S)\s*\*\s*$/;
var are3=/^\s*\*\s*$/;
var wsre=/\s+/g;
for (var k=0; k<elizaKeywords.length; k++) {
var rules=elizaKeywords[k][2];
elizaKeywords[k][3]=k; // save original index for sorting
for (var i=0; i<rules.length; i++) {
var r=rules[i];
// check mem flag and store it as decomp's element 2
if (r[0].charAt(0)=='$') {
var ofs=1;
while (r[0].charAt[ofs]==' ') ofs++;
r[0]=r[0].substring(ofs);
r[2]=true;
}
else {
r[2]=false;
}
// expand synonyms (v.1.1: work around lambda function)
var m=sre.exec(r[0]);
while (m) {
var sp=(synPatterns[m[1]])? synPatterns[m[1]]:m[1];
r[0]=r[0].substring(0,m.index)+sp+r[0].substring(m.index+m[0].length);
m=sre.exec(r[0]);
}
// expand asterisk expressions (v.1.1: work around lambda function)
if (are3.test(r[0])) {
r[0]='\\s*(.*)\\s*';
}
else {
m=are.exec(r[0]);
if (m) {
var lp='';
var rp=r[0];
while (m) {
lp+=rp.substring(0,m.index+1);
if (m[1]!=')') lp+='\\b';
lp+='\\s*(.*)\\s*';
if ((m[2]!='(') && (m[2]!='\\')) lp+='\\b';
lp+=m[2];
rp=rp.substring(m.index+m[0].length);
m=are.exec(rp);
}
r[0]=lp+rp;
}
m=are1.exec(r[0]);
if (m) {
var lp='\\s*(.*)\\s*';
if ((m[1]!=')') && (m[1]!='\\')) lp+='\\b';
r[0]=lp+r[0].substring(m.index-1+m[0].length);
}
m=are2.exec(r[0]);
if (m) {
var lp=r[0].substring(0,m.index+1);
if (m[1]!='(') lp+='\\b';
r[0]=lp+'\\s*(.*)\\s*';
}
}
// expand white space
r[0]=r[0].replace(wsre, '\\s+');
wsre.lastIndex=0;
}
}
// now sort keywords by rank (highest first)
elizaKeywords.sort(this._sortKeywords);
// and compose regexps and refs for pres and posts
ElizaBot.prototype.pres={};
ElizaBot.prototype.posts={};
if ((global.elizaPres) && (elizaPres.length)) {
var a=new Array();
for (var i=0; i<elizaPres.length; i+=2) {
a.push(elizaPres[i]);
ElizaBot.prototype.pres[elizaPres[i]]=elizaPres[i+1];
}
ElizaBot.prototype.preExp = new RegExp('\\b('+a.join('|')+')\\b');
}
else {
// default (should not match)
ElizaBot.prototype.preExp = /####/;
ElizaBot.prototype.pres['####']='####';
}
if ((global.elizaPosts) && (elizaPosts.length)) {
var a=new Array();
for (var i=0; i<elizaPosts.length; i+=2) {
a.push(elizaPosts[i]);
ElizaBot.prototype.posts[elizaPosts[i]]=elizaPosts[i+1];
}
ElizaBot.prototype.postExp = new RegExp('\\b('+a.join('|')+')\\b');
}
else {
// default (should not match)
ElizaBot.prototype.postExp = /####/;
ElizaBot.prototype.posts['####']='####';
}
// check for elizaQuits and install default if missing
if ((!global.elizaQuits) || (typeof elizaQuits.length == 'undefined')) {
elizaQuits=[];
}
// done
ElizaBot.prototype._dataParsed=true;
}
ElizaBot.prototype._sortKeywords = function(a,b) {
// sort by rank
if (a[1]>b[1]) return -1
else if (a[1]<b[1]) return 1
// or original index
else if (a[3]>b[3]) return 1
else if (a[3]<b[3]) return -1
else return 0;
}
ElizaBot.prototype.transform = function(text) {
var rpl='';
this.quit=false;
// unify text string
text=text.toLowerCase();
text=text.replace(/@#\$%\^&\*\(\)_\+=~`\{\[\}\]\|:;<>\/\\\t/g, ' ');
text=text.replace(/\s+-+\s+/g, '.');
text=text.replace(/\s*[,\.\?!;]+\s*/g, '.');
text=text.replace(/\s*\bbut\b\s*/g, '.');
text=text.replace(/\s{2,}/g, ' ');
// split text in part sentences and loop through them
var parts=text.split('.');
for (var i=0; i<parts.length; i++) {
var part=parts[i];
if (part!='') {
// check for quit expression
for (var q=0; q<elizaQuits.length; q++) {
if (elizaQuits[q]==part) {
this.quit=true;
return this.getFinal();
}
}
// preprocess (v.1.1: work around lambda function)
var m=this.preExp.exec(part);
if (m) {
var lp='';
var rp=part;
while (m) {
lp+=rp.substring(0,m.index)+this.pres[m[1]];
rp=rp.substring(m.index+m[0].length);
m=this.preExp.exec(rp);
}
part=lp+rp;
}
this.sentence=part;
// loop trough keywords
for (var k=0; k<elizaKeywords.length; k++) {
if (part.search(new RegExp('\\b'+elizaKeywords[k][0]+'\\b', 'i'))>=0) {
rpl = this._execRule(k);
}
if (rpl!='') return rpl;
}
}
}
// nothing matched try mem
rpl=this._memGet();
// if nothing in mem, so try xnone
if (rpl=='') {
this.sentence=' ';
var k=this._getRuleIndexByKey('xnone');
if (k>=0) rpl=this._execRule(k);
}
// return reply or default string
return (rpl!='')? rpl : 'I am at a loss for words.';
}
ElizaBot.prototype._execRule = function(k) {
var rule=elizaKeywords[k];
var decomps=rule[2];
var paramre=/\(([0-9]+)\)/;
for (var i=0; i<decomps.length; i++) {
var m=this.sentence.match(decomps[i][0]);
if (m!=null) {
var reasmbs=decomps[i][1];
var memflag=decomps[i][2];
var ri= (this.noRandom)? 0 : Math.floor(Math.random()*reasmbs.length);
if (((this.noRandom) && (this.lastchoice[k][i]>ri)) || (this.lastchoice[k][i]==ri)) {
ri= ++this.lastchoice[k][i];
if (ri>=reasmbs.length) {
ri=0;
this.lastchoice[k][i]=-1;
}
}
else {
this.lastchoice[k][i]=ri;
}
var rpl=reasmbs[ri];
if (this.debug) alert('match:\nkey: '+elizaKeywords[k][0]+
'\nrank: '+elizaKeywords[k][1]+
'\ndecomp: '+decomps[i][0]+
'\nreasmb: '+rpl+
'\nmemflag: '+memflag);
if (rpl.search('^goto ', 'i')==0) {
ki=this._getRuleIndexByKey(rpl.substring(5));
if (ki>=0) return this._execRule(ki);
}
// substitute positional params (v.1.1: work around lambda function)
var m1=paramre.exec(rpl);
if (m1) {
var lp='';
var rp=rpl;
while (m1) {
var param = m[parseInt(m1[1])];
// postprocess param
var m2=this.postExp.exec(param);
if (m2) {
var lp2='';
var rp2=param;
while (m2) {
lp2+=rp2.substring(0,m2.index)+this.posts[m2[1]];
rp2=rp2.substring(m2.index+m2[0].length);
m2=this.postExp.exec(rp2);
}
param=lp2+rp2;
}
lp+=rp.substring(0,m1.index)+param;
rp=rp.substring(m1.index+m1[0].length);
m1=paramre.exec(rp);
}
rpl=lp+rp;
}
rpl=this._postTransform(rpl);
if (memflag) this._memSave(rpl)
else return rpl;
}
}
return '';
}
ElizaBot.prototype._postTransform = function(s) {
// final cleanings
s=s.replace(/\s{2,}/g, ' ');
s=s.replace(/\s+\./g, '.');
if ((this.global.elizaPostTransforms) && (elizaPostTransforms.length)) {
for (var i=0; i<elizaPostTransforms.length; i+=2) {
s=s.replace(elizaPostTransforms[i], elizaPostTransforms[i+1]);
elizaPostTransforms[i].lastIndex=0;
}
}
// capitalize first char (v.1.1: work around lambda function)
if (this.capitalizeFirstLetter) {
var re=/^([a-z])/;
var m=re.exec(s);
if (m) s=m[0].toUpperCase()+s.substring(1);
}
return s;
}
ElizaBot.prototype._getRuleIndexByKey = function(key) {
for (var k=0; k<elizaKeywords.length; k++) {
if (elizaKeywords[k][0]==key) return k;
}
return -1;
}
ElizaBot.prototype._memSave = function(t) {
this.mem.push(t);
if (this.mem.length>this.memSize) this.mem.shift();
}
ElizaBot.prototype._memGet = function() {
if (this.mem.length) {
if (this.noRandom) return this.mem.shift();
else {
var n=Math.floor(Math.random()*this.mem.length);
var rpl=this.mem[n];
for (var i=n+1; i<this.mem.length; i++) this.mem[i-1]=this.mem[i];
this.mem.length--;
return rpl;
}
}
else return '';
}
ElizaBot.prototype.getFinal = function() {
if (!ElizaBot.prototype.global.elizaFinals) return '';
return elizaFinals[Math.floor(Math.random()*elizaFinals.length)];
}
ElizaBot.prototype.getInitial = function() {
if (!ElizaBot.prototype.global.elizaInitials) return '';
return elizaInitials[Math.floor(Math.random()*elizaInitials.length)];
}
// fix array.prototype methods (push, shift) if not implemented (MSIE fix)
if (typeof Array.prototype.push == 'undefined') {
Array.prototype.push=function(v) { return this[this.length]=v; };
}
if (typeof Array.prototype.shift == 'undefined') {
Array.prototype.shift=function() {
if (this.length==0) return null;
var e0=this[0];
for (var i=1; i<this.length; i++) this[i-1]=this[i];
this.length--;
return e0;
};
}
// eof

BIN
clippy/elizabot/._eliza_test.html
View File

Binary file not shown.

BIN
clippy/elizabot/._elizabot.js
View File

Binary file not shown.

BIN
clippy/elizabot/._elizadata.js
View File

Binary file not shown.

107
clippy/elizabot/clippy_eliza.html
Unescape Escape View File

@ -0,0 +1,107 @@
<HTML>
<HEAD>
<meta charset="utf-8">
<TITLE>Eliza (elizabot.js)</TITLE>
<SCRIPT LANGUAGE="JavaScript" TYPE="text/javascript" SRC="elizabot.js"></SCRIPT>
<SCRIPT LANGUAGE="JavaScript" TYPE="text/javascript" SRC="elizadata.js"></SCRIPT>
<link rel="stylesheet" type="text/css" href="./clippy.js/build/clippy.css" media="all">
<SCRIPT LANGUAGE="JavaScript" TYPE="text/javascript">
var eliza = new ElizaBot();
var elizaLines = new Array();
var displayCols = 60;
var displayRows = 20;
function elizaReset() {
eliza.reset();
elizaLines.length = 0;
elizaStep();
}
function elizaStep() {
var f = document.forms.e_form;
var userinput = f.e_input.value;
if (eliza.quit) {
f.e_input.value = '';
if (confirm("This session is over.\nStart over?")) elizaReset();
f.e_input.focus();
return;
}
else if (userinput != '') {
var usr = 'YOU: ' + userinput;
var rpl ='ELIZA: ' + eliza.transform(userinput);
elizaLines.push(usr);
elizaLines.push(rpl);
// display nicely
// (fit to textarea with last line free - reserved for extra line caused by word wrap)
var temp = new Array();
var l = 0;
for (var i=elizaLines.length-1; i>=0; i--) {
l += 1 + Math.floor(elizaLines[i].length/displayCols);
if (l >= displayRows) break
else temp.push(elizaLines[i]);
}
elizaLines = temp.reverse();
f.e_display.value = elizaLines.join('\n');
}
else if (elizaLines.length == 0) {
// no input and no saved lines -> output initial
var initial = 'ELIZA: ' + eliza.getInitial();
elizaLines.push(initial);
f.e_display.value = initial + '\n';
}
f.e_input.value = '';
f.e_input.focus();
}
//-->
</SCRIPT>
</HEAD>
<BODY TOPMARGIN="0" LEFTMARGIN="0" RIGHTMARGIN="0" BOTTOMMARGIN="0" MARGINHEIGHT="0" MARGINWIDTH="0" STYLE="border:0" onload="window.setTimeout('elizaReset()',100)"><A NAME="top"></A>
<CENTER>
<P>&nbsp;</P>
<H3>Eliza</H3>
<TABLE BORDER="0" CELLSPACING="10" CELLPADDING="0">
<FORM NAME="e_form" onsubmit="elizaStep();return false">
<TR><TD COLSPAN="2"><TEXTAREA NAME="e_display" COLS="60" ROWS="20"></TEXTAREA></TD></TR>
<TR VALIGN="middle">
<TD><INPUT TYPE="text" NAME="e_input" SIZE="50"></TD>
<TD ALIGN="right"><INPUT TYPE="submit" VALUE="&nbsp;Talk&nbsp;"> <INPUT TYPE="reset" VALUE="Reset" onClick="window.setTimeout('elizaReset()',100)"></TD>
</TR>
</FORM>
<script src="./jquery.1.7.min.js"></script>
<script src="./clippy.js/build/clippy.js"></script>
<script type="text/javascript">
clippy.load('Clippy', function(agent){
agent.show();
//agent.play('Searching');
//agent.animate();
//agent.animations();
//agent.moveTo();
//agent.play();
agent.speak('Heeeeeeeeey!');
agent.animate();
agent.speak('Im Clippy!');
//agent.gestureAt(200,200);
//agent.stopCurrent();
//agent.stop();
});
</script>
</BODY>
</HTML>

134
clippy/elizabot/eliza_test.html
Unescape Escape View File

@ -0,0 +1,134 @@
<HTML>
<HEAD>
<TITLE>Eliza Test</TITLE>
<SCRIPT LANGUAGE="JavaScript" TYPE="text/javascript" SRC="elizabot.js"></SCRIPT>
<SCRIPT LANGUAGE="JavaScript" TYPE="text/javascript" SRC="elizadata.js"></SCRIPT>
<SCRIPT LANGUAGE="JavaScript" TYPE="text/javascript">
<!--
// initialize with argument 'true': no random choices
var eliza = new ElizaBot(true);
var exampleLines= [
"Men are all alike.",
"They're always bugging us about something or other.",
"Well, my boyfriend made me come here.",
"He says I'm depressed much of the time.",
"It's true. I am unhappy.",
"I need some help, that much seems certain.",
"Perhaps I could learn to get along with my mother.",
"My mother takes care of me.",
"My father.",
"You are like my father in some ways.",
"You are not very aggressive but I think you don't want me to notice that.",
"You don't argue with me.",
"You are afraid of me.",
"My father is afraid of everybody.",
"Bullies."
];
var exampleCursor=0;
function elizaReset() {
eliza.reset();
exampleCursor=0;
}
function elizaNext() {
if (exampleCursor >= exampleLines.length) {
alert('Last entry reached.\nClick "Reset" to start over again.');
return;
}
var userinput = exampleLines[exampleCursor++];
document.forms.eform.edisplay.value += 'USER: ' + userinput + '\n';
document.forms.eform.edisplay.value += 'ELIZA: ' + eliza.transform(userinput) + '\n';
}
//-->
</SCRIPT>
</HEAD>
<BODY TOPMARGIN="0" LEFTMARGIN="0" RIGHTMARGIN="0" BOTTOMMARGIN="0" MARGINHEIGHT="0" MARGINWIDTH="0" STYLE="border:0"><A NAME="top"></A>
<CENTER>
<P>&nbsp;</P>
<H3>Eliza Test</H3>
<TABLE BORDER="0" CELLSPACING="10" CELLPADDING="0">
<FORM NAME="eform" onsubmit="return false">
<TR VALIGN="top">
<TD><TEXTAREA NAME="edisplay" COLS="80" ROWS="32"></TEXTAREA></TD>
<TD ALIGN="center"><INPUT TYPE="button" VALUE="Next step" onclick="elizaNext()"><BR><BR><INPUT TYPE="reset" VALUE="Reset" onclick="elizaReset(); return true"></TD>
</TR>
</FORM>
</TABLE>
</CENTER>
<P>&nbsp;</P>
<TABLE BORDER="0" CELLSPACING="12" CELLPADDDING="0">
<TR>
<TD COLSPAN="2">
This is a test application for the <A HREF="index.html">JavaScript library &quot;elizabot.js&quot;</A> (Norbert Landsteiner 2005; &lt;http://www.masswerk.at&gt;).<BR>
The test application should produce the original example given by Joseph Weizenbaum in his article on ELIZA from Jannuary 1966 <A HREF="#ELIZA">[1]</A>.<BR> Click &quot;Next step&quot; to see the next input und and Eliza's answer. Click &quot;Reset&quot; to reset Eliza and the display form.</TD>
</TR>
<TR><TD COLSPAN="2">&nbsp;</TD></TR>
<TR><TD COLSPAN="2">This is the &quot;typical conversation&quot; as described by Joseph Weizenbaum:</TD></TR>
<TR>
<TD>&nbsp;</TD>
<TD>
Men are all alike.<BR><BR>
IN WHAT WAY?<BR><BR>
They're always bugging us about something or other.<BR><BR>
CAN YOU THINK OF A SPECIFIC EXAMPLE?<BR><BR>
Well, my boyfriend made me come here.<BR><BR>
YOUR BOYFRIEND MADE YOU COME HERE?<BR><BR>
He says I'm depressed much of the time.<BR><BR>
I AM SORRY TO HEAR YOU ARE DEPRESSED.<BR><BR>
It's true.<BR>
I am unhappy.<BR><BR>
DO YOU THINK COMING HERE WILL HELP YOU NOT TO BE UNHAPPY.<BR><BR>
I need some help, that much seems certain.<BR><BR>
WHAT WOULD IT MEAN TO YOU IF YOU GOT SOME HELP?<BR><BR>
Perhaps I could learn to get along with my mother.<BR><BR>
TELL ME MORE ABOUT YOUR FAMILY.<BR><BR>
My mother takes care of me.<BR><BR>
WHO ELSE IN YOUR FAMILY TAKES CARE OF YOU?<BR><BR>
My father.<BR><BR>
YOUR FATHER?<BR><BR>
You are like my father in some ways.<BR><BR>
WHAT RESEMBLANCE DO YOU SEE?<BR><BR>
You are not very aggressive<BR>
but I think you don't want me to notice that.<BR><BR>
WHAT MAKES YOU THINK I AM NOT VERY AGGRESSIVE?<BR><BR>
You don't argue with me.<BR><BR>
WHY DO YOU THINK I DON'T ARGUE WITH YOU?<BR><BR>
You are afraid of me.<BR><BR>
DOES IT PLEASE YOU TO BELIEVE I AM AFRAID OF YOU?<BR><BR>
My father is afraid of everybody.<BR><BR>
WHAT ELSE COMES TO YOUR MIND WHEN YOU THINK OF YOUR FATHER?<BR><BR>
Bullies.<BR><BR>
DOES THAT HAVE ANYTHING TO DO WITH THE FACT<BR>
THAT YOUR BOYFRIEND MADE YOU COME HERE?<BR>
&nbsp;
</TD>
</TR>
<TR><TD COLSPAN="2">(The capitalized lines are the machine responses.)</TD></TR>
<TR><TD COLSPAN="2">&nbsp;</TD></TR>
<TR><TD COLSPAN="2">References:</TD></TR>
<TR VALIGN="top">
<TD><A NAME="ELIZA"></A>[1]</TD>
<TD>
Weizenbaum, Joseph &quot;ELIZA &#150; A Computer Program For the Study of Natural Language
Communication Between Man and Machine&quot;<BR>
in: Communications of the ACM; Volume 9 , Issue 1 (January 1966): p 36-45.
</TD>
</TR>
<TR><TD COLSPAN="2">&nbsp;</TD></TR>
<TR><TD COLSPAN="2"><SMALL>&gt; <A HREF="#top">top of page</A></SMALL></TD></TR>
<TR><TD COLSPAN="2">&nbsp;</TD></TR>
<TR><TD COLSPAN="2" STYLE="font-family: arial,helvetica,sans-serif; font-size: 12px;">N. Landsteiner 2005; &lt;<A HREF="http://www.masswerk.at/" TARGET="_blank">http://www.masswerk.at</A>&gt;</SMALL></TD></TR>
<TR><TD COLSPAN="2">&nbsp;</TD></TR>
</TABLE>
</BODY>
</HTML>

391
clippy/elizabot/elizabot.js
Unescape Escape View File

@ -0,0 +1,391 @@
/*
elizabot.js v.1.1 - ELIZA JS library (N.Landsteiner 2005)
Eliza is a mock Rogerian psychotherapist.
Original program by Joseph Weizenbaum in MAD-SLIP for "Project MAC" at MIT.
cf: Weizenbaum, Joseph "ELIZA - A Computer Program For the Study of Natural Language
Communication Between Man and Machine"
in: Communications of the ACM; Volume 9 , Issue 1 (January 1966): p 36-45.
JavaScript implementation by Norbert Landsteiner 2005; <http://www.masserk.at>
synopsis:
new ElizaBot( <random-choice-disable-flag> )
ElizaBot.prototype.transform( <inputstring> )
ElizaBot.prototype.getInitial()
ElizaBot.prototype.getFinal()
ElizaBot.prototype.reset()
usage: var eliza = new ElizaBot();
var initial = eliza.getInitial();
var reply = eliza.transform(inputstring);
if (eliza.quit) {
// last user input was a quit phrase
}
// method `transform()' returns a final phrase in case of a quit phrase
// but you can also get a final phrase with:
var final = eliza.getFinal();
// other methods: reset memory and internal state
eliza.reset();
// to set the internal memory size override property `memSize':
eliza.memSize = 100; // (default: 20)
// to reproduce the example conversation given by J. Weizenbaum
// initialize with the optional random-choice-disable flag
var originalEliza = new ElizaBot(true);
`ElizaBot' is also a general chatbot engine that can be supplied with any rule set.
(for required data structures cf. "elizadata.js" and/or see the documentation.)
data is parsed and transformed for internal use at the creation time of the
first instance of the `ElizaBot' constructor.
vers 1.1: lambda functions in RegExps are currently a problem with too many browsers.
changed code to work around.
*/
function ElizaBot(noRandomFlag) {
this.noRandom= (noRandomFlag)? true:false;
this.capitalizeFirstLetter=true;
this.debug=false;
this.memSize=20;
this.version="1.1 (original)";
if (!this._dataParsed) this._init();
this.reset();
}
ElizaBot.prototype.reset = function() {
this.quit=false;
this.mem=[];
this.lastchoice=[];
for (var k=0; k<elizaKeywords.length; k++) {
this.lastchoice[k]=[];
var rules=elizaKeywords[k][2];
for (var i=0; i<rules.length; i++) this.lastchoice[k][i]=-1;
}
}
ElizaBot.prototype._dataParsed = false;
ElizaBot.prototype._init = function() {
// install ref to global object
var global=ElizaBot.prototype.global=self;
// parse data and convert it from canonical form to internal use
// prodoce synonym list
var synPatterns={};
if ((global.elizaSynons) && (typeof elizaSynons == 'object')) {
for (var i in elizaSynons) synPatterns[i]='('+i+'|'+elizaSynons[i].join('|')+')';
}
// check for keywords or install empty structure to prevent any errors
if ((!global.elizaKeywords) || (typeof elizaKeywords.length == 'undefined')) {
elizaKeywords=[['###',0,[['###',[]]]]];
}
// 1st convert rules to regexps
// expand synonyms and insert asterisk expressions for backtracking
var sre=/@(\S+)/;
var are=/(\S)\s*\*\s*(\S)/;
var are1=/^\s*\*\s*(\S)/;
var are2=/(\S)\s*\*\s*$/;
var are3=/^\s*\*\s*$/;
var wsre=/\s+/g;
for (var k=0; k<elizaKeywords.length; k++) {
var rules=elizaKeywords[k][2];
elizaKeywords[k][3]=k; // save original index for sorting
for (var i=0; i<rules.length; i++) {
var r=rules[i];
// check mem flag and store it as decomp's element 2
if (r[0].charAt(0)=='$') {
var ofs=1;
while (r[0].charAt[ofs]==' ') ofs++;
r[0]=r[0].substring(ofs);
r[2]=true;
}
else {
r[2]=false;
}
// expand synonyms (v.1.1: work around lambda function)
var m=sre.exec(r[0]);
while (m) {
var sp=(synPatterns[m[1]])? synPatterns[m[1]]:m[1];
r[0]=r[0].substring(0,m.index)+sp+r[0].substring(m.index+m[0].length);
m=sre.exec(r[0]);
}
// expand asterisk expressions (v.1.1: work around lambda function)
if (are3.test(r[0])) {
r[0]='\\s*(.*)\\s*';
}
else {
m=are.exec(r[0]);
if (m) {
var lp='';
var rp=r[0];
while (m) {
lp+=rp.substring(0,m.index+1);
if (m[1]!=')') lp+='\\b';
lp+='\\s*(.*)\\s*';
if ((m[2]!='(') && (m[2]!='\\')) lp+='\\b';
lp+=m[2];
rp=rp.substring(m.index+m[0].length);
m=are.exec(rp);
}
r[0]=lp+rp;
}
m=are1.exec(r[0]);
if (m) {
var lp='\\s*(.*)\\s*';
if ((m[1]!=')') && (m[1]!='\\')) lp+='\\b';
r[0]=lp+r[0].substring(m.index-1+m[0].length);
}
m=are2.exec(r[0]);
if (m) {
var lp=r[0].substring(0,m.index+1);
if (m[1]!='(') lp+='\\b';
r[0]=lp+'\\s*(.*)\\s*';
}
}
// expand white space
r[0]=r[0].replace(wsre, '\\s+');
wsre.lastIndex=0;
}
}
// now sort keywords by rank (highest first)
elizaKeywords.sort(this._sortKeywords);
// and compose regexps and refs for pres and posts
ElizaBot.prototype.pres={};
ElizaBot.prototype.posts={};
if ((global.elizaPres) && (elizaPres.length)) {
var a=new Array();
for (var i=0; i<elizaPres.length; i+=2) {
a.push(elizaPres[i]);
ElizaBot.prototype.pres[elizaPres[i]]=elizaPres[i+1];
}
ElizaBot.prototype.preExp = new RegExp('\\b('+a.join('|')+')\\b');
}
else {
// default (should not match)
ElizaBot.prototype.preExp = /####/;
ElizaBot.prototype.pres['####']='####';
}
if ((global.elizaPosts) && (elizaPosts.length)) {
var a=new Array();
for (var i=0; i<elizaPosts.length; i+=2) {
a.push(elizaPosts[i]);
ElizaBot.prototype.posts[elizaPosts[i]]=elizaPosts[i+1];
}
ElizaBot.prototype.postExp = new RegExp('\\b('+a.join('|')+')\\b');
}
else {
// default (should not match)
ElizaBot.prototype.postExp = /####/;
ElizaBot.prototype.posts['####']='####';
}
// check for elizaQuits and install default if missing
if ((!global.elizaQuits) || (typeof elizaQuits.length == 'undefined')) {
elizaQuits=[];
}
// done
ElizaBot.prototype._dataParsed=true;
}
ElizaBot.prototype._sortKeywords = function(a,b) {
// sort by rank
if (a[1]>b[1]) return -1
else if (a[1]<b[1]) return 1
// or original index
else if (a[3]>b[3]) return 1
else if (a[3]<b[3]) return -1
else return 0;
}
ElizaBot.prototype.transform = function(text) {
var rpl='';
this.quit=false;
// unify text string
text=text.toLowerCase();
text=text.replace(/@#\$%\^&\*\(\)_\+=~`\{\[\}\]\|:;<>\/\\\t/g, ' ');
text=text.replace(/\s+-+\s+/g, '.');
text=text.replace(/\s*[,\.\?!;]+\s*/g, '.');
text=text.replace(/\s*\bbut\b\s*/g, '.');
text=text.replace(/\s{2,}/g, ' ');
// split text in part sentences and loop through them
var parts=text.split('.');
for (var i=0; i<parts.length; i++) {
var part=parts[i];
if (part!='') {
// check for quit expression
for (var q=0; q<elizaQuits.length; q++) {
if (elizaQuits[q]==part) {
this.quit=true;
return this.getFinal();
}
}
// preprocess (v.1.1: work around lambda function)
var m=this.preExp.exec(part);
if (m) {
var lp='';
var rp=part;
while (m) {
lp+=rp.substring(0,m.index)+this.pres[m[1]];
rp=rp.substring(m.index+m[0].length);
m=this.preExp.exec(rp);
}
part=lp+rp;
}
this.sentence=part;
// loop trough keywords
for (var k=0; k<elizaKeywords.length; k++) {
if (part.search(new RegExp('\\b'+elizaKeywords[k][0]+'\\b', 'i'))>=0) {
rpl = this._execRule(k);
}
if (rpl!='') return rpl;
}
}
}
// nothing matched try mem
rpl=this._memGet();
// if nothing in mem, so try xnone
if (rpl=='') {
this.sentence=' ';
var k=this._getRuleIndexByKey('xnone');
if (k>=0) rpl=this._execRule(k);
}
// return reply or default string
return (rpl!='')? rpl : 'I am at a loss for words.';
}
ElizaBot.prototype._execRule = function(k) {
var rule=elizaKeywords[k];
var decomps=rule[2];
var paramre=/\(([0-9]+)\)/;
for (var i=0; i<decomps.length; i++) {
var m=this.sentence.match(decomps[i][0]);
if (m!=null) {
var reasmbs=decomps[i][1];
var memflag=decomps[i][2];
var ri= (this.noRandom)? 0 : Math.floor(Math.random()*reasmbs.length);
if (((this.noRandom) && (this.lastchoice[k][i]>ri)) || (this.lastchoice[k][i]==ri)) {
ri= ++this.lastchoice[k][i];
if (ri>=reasmbs.length) {
ri=0;
this.lastchoice[k][i]=-1;
}
}
else {
this.lastchoice[k][i]=ri;
}
var rpl=reasmbs[ri];
if (this.debug) alert('match:\nkey: '+elizaKeywords[k][0]+
'\nrank: '+elizaKeywords[k][1]+
'\ndecomp: '+decomps[i][0]+
'\nreasmb: '+rpl+
'\nmemflag: '+memflag);
if (rpl.search('^goto ', 'i')==0) {
ki=this._getRuleIndexByKey(rpl.substring(5));
if (ki>=0) return this._execRule(ki);
}
// substitute positional params (v.1.1: work around lambda function)
var m1=paramre.exec(rpl);
if (m1) {
var lp='';
var rp=rpl;
while (m1) {
var param = m[parseInt(m1[1])];
// postprocess param
var m2=this.postExp.exec(param);
if (m2) {
var lp2='';
var rp2=param;
while (m2) {
lp2+=rp2.substring(0,m2.index)+this.posts[m2[1]];
rp2=rp2.substring(m2.index+m2[0].length);
m2=this.postExp.exec(rp2);
}
param=lp2+rp2;
}
lp+=rp.substring(0,m1.index)+param;
rp=rp.substring(m1.index+m1[0].length);
m1=paramre.exec(rp);
}
rpl=lp+rp;
}
rpl=this._postTransform(rpl);
if (memflag) this._memSave(rpl)
else return rpl;
}
}
return '';
}
ElizaBot.prototype._postTransform = function(s) {
// final cleanings
s=s.replace(/\s{2,}/g, ' ');
s=s.replace(/\s+\./g, '.');
if ((this.global.elizaPostTransforms) && (elizaPostTransforms.length)) {
for (var i=0; i<elizaPostTransforms.length; i+=2) {
s=s.replace(elizaPostTransforms[i], elizaPostTransforms[i+1]);
elizaPostTransforms[i].lastIndex=0;
}
}
// capitalize first char (v.1.1: work around lambda function)
if (this.capitalizeFirstLetter) {
var re=/^([a-z])/;
var m=re.exec(s);
if (m) s=m[0].toUpperCase()+s.substring(1);
}
return s;
}
ElizaBot.prototype._getRuleIndexByKey = function(key) {
for (var k=0; k<elizaKeywords.length; k++) {
if (elizaKeywords[k][0]==key) return k;
}
return -1;
}
ElizaBot.prototype._memSave = function(t) {
this.mem.push(t);
if (this.mem.length>this.memSize) this.mem.shift();
}
ElizaBot.prototype._memGet = function() {
if (this.mem.length) {
if (this.noRandom) return this.mem.shift();
else {
var n=Math.floor(Math.random()*this.mem.length);
var rpl=this.mem[n];
for (var i=n+1; i<this.mem.length; i++) this.mem[i-1]=this.mem[i];
this.mem.length--;
return rpl;
}
}
else return '';
}
ElizaBot.prototype.getFinal = function() {
if (!ElizaBot.prototype.global.elizaFinals) return '';
return elizaFinals[Math.floor(Math.random()*elizaFinals.length)];
}
ElizaBot.prototype.getInitial = function() {
if (!ElizaBot.prototype.global.elizaInitials) return '';
return elizaInitials[Math.floor(Math.random()*elizaInitials.length)];
}
// fix array.prototype methods (push, shift) if not implemented (MSIE fix)
if (typeof Array.prototype.push == 'undefined') {
Array.prototype.push=function(v) { return this[this.length]=v; };
}
if (typeof Array.prototype.shift == 'undefined') {
Array.prototype.shift=function() {
if (this.length==0) return null;
var e0=this[0];
for (var i=1; i<this.length; i++) this[i-1]=this[i];
this.length--;
return e0;
};
}
// eof

611
clippy/elizabot/elizadata.js
Unescape Escape View File

@ -0,0 +1,611 @@
// data for elizabot.js
// entries prestructured as layed out in Weizenbaum's description
// [cf: Communications of the ACM, Vol. 9, #1 (January 1966): p 36-45.]
var elizaInitials = [
"How do you do. Please tell me your problem.",
// additions (not original)
"Please tell me what's been bothering you.",
"Is something troubling you ?"
];
var elizaFinals = [
"Goodbye. It was nice talking to you.",
// additions (not original)
"Goodbye. This was really a nice talk.",
"Goodbye. I'm looking forward to our next session.",
"This was a good session, wasn't it -- but time is over now. Goodbye.",
"Maybe we could discuss this moreover in our next session ? Goodbye."
];
var elizaQuits = [
"bye",
"goodbye",
"done",
"exit",
"quit"
];
var elizaPres = [
"dont", "don't",
"cant", "can't",
"wont", "won't",
"recollect", "remember",
"recall", "remember",
"dreamt", "dreamed",
"dreams", "dream",
"maybe", "perhaps",
"certainly", "yes",
"machine", "computer",
"machines", "computer",
"computers", "computer",
"were", "was",
"you're", "you are",
"i'm", "i am",
"same", "alike",
"identical", "alike",
"equivalent", "alike"
];
var elizaPosts = [
"am", "are",
"your", "my",
"me", "you",
"myself", "yourself",
"yourself", "myself",
"i", "you",
"you", "I",
"my", "your",
"i'm", "you are"
];
var elizaSynons = {
"be": ["am", "is", "are", "was"],
"belief": ["feel", "think", "believe", "wish"],
"cannot": ["can't"],
"desire": ["want", "need"],
"everyone": ["everybody", "nobody", "noone"],
"family": ["mother", "mom", "father", "dad", "sister", "brother", "wife", "children", "child"],
"happy": ["elated", "glad", "better"],
"sad": ["unhappy", "depressed", "sick"]
};
var elizaKeywords = [
/*
Array of
["<key>", <rank>, [
["<decomp>", [
"<reasmb>",
"<reasmb>",
"<reasmb>"
]],
["<decomp>", [
"<reasmb>",
"<reasmb>",
"<reasmb>"
]]
]]
*/
["xnone", 0, [
["*", [
"I'm not sure I understand you fully.",
"Please go on.",
"What does that suggest to you ?",
"Do you feel strongly about discussing such things ?",
"That is interesting. Please continue.",
"Tell me more about that.",
"Does talking about this bother you ?"
]]
]],
["sorry", 0, [
["*", [
"Please don't apologise.",
"Apologies are not necessary.",
"I've told you that apologies are not required.",
"It did not bother me. Please continue."
]]
]],
["apologise", 0, [
["*", [
"goto sorry"
]]
]],
["remember", 5, [
["* i remember *", [
"Do you often think of (2) ?",
"Does thinking of (2) bring anything else to mind ?",
"What else do you recollect ?",
"Why do you remember (2) just now ?",
"What in the present situation reminds you of (2) ?",
"What is the connection between me and (2) ?",
"What else does (2) remind you of ?"
]],
["* do you remember *", [
"Did you think I would forget (2) ?",
"Why do you think I should recall (2) now ?",
"What about (2) ?",
"goto what",
"You mentioned (2) ?"
]],
["* you remember *", [
"How could I forget (2) ?",
"What about (2) should I remember ?",
"goto you"
]]
]],
["forget", 5, [
["* i forget *", [
"Can you think of why you might forget (2) ?",
"Why can't you remember (2) ?",
"How often do you think of (2) ?",
"Does it bother you to forget that ?",
"Could it be a mental block ?",
"Are you generally forgetful ?",
"Do you think you are suppressing (2) ?"
]],
["* did you forget *", [
"Why do you ask ?",
"Are you sure you told me ?",
"Would it bother you if I forgot (2) ?",
"Why should I recall (2) just now ?",
"goto what",
"Tell me more about (2)."
]]
]],
["if", 3, [
["* if *", [
"Do you think it's likely that (2) ?",
"Do you wish that (2) ?",
"What do you know about (2) ?",
"Really, if (2) ?",
"What would you do if (2) ?",
"But what are the chances that (2) ?",
"What does this speculation lead to ?"
]]
]],
["dreamed", 4, [
["* i dreamed *", [
"Really, (2) ?",
"Have you ever fantasized (2) while you were awake ?",
"Have you ever dreamed (2) before ?",
"goto dream"
]]
]],
["dream", 3, [
["*", [
"What does that dream suggest to you ?",
"Do you dream often ?",
"What persons appear in your dreams ?",
"Do you believe that dreams have something to do with your problem ?"
]]
]],
["perhaps", 0, [
["*", [
"You don't seem quite certain.",
"Why the uncertain tone ?",
"Can't you be more positive ?",
"You aren't sure ?",
"Don't you know ?",
"How likely, would you estimate ?"
]]
]],
["name", 15, [
["*", [
"I am not interested in names.",
"I've told you before, I don't care about names -- please continue."
]]
]],
["deutsch", 0, [
["*", [
"goto xforeign",
"I told you before, I don't understand German."
]]
]],
["francais", 0, [
["*", [
"goto xforeign",
"I told you before, I don't understand French."
]]
]],
["italiano", 0, [
["*", [
"goto xforeign",
"I told you before, I don't understand Italian."
]]
]],
["espanol", 0, [
["*", [
"goto xforeign",
"I told you before, I don't understand Spanish."
]]
]],
["xforeign", 0, [
["*", [
"I speak only English."
]]
]],
["hello", 0, [
["*", [
"How do you do. Please state your problem.",
"Hi. What seems to be your problem ?"
]]
]],
["computer", 50, [
["*", [
"Do computers worry you ?",
"Why do you mention computers ?",
"What do you think machines have to do with your problem ?",
"Don't you think computers can help people ?",
"What about machines worries you ?",
"What do you think about machines ?",
"You don't think I am a computer program, do you ?"
]]
]],
["am", 0, [
["* am i *", [
"Do you believe you are (2) ?",
"Would you want to be (2) ?",
"Do you wish I would tell you you are (2) ?",
"What would it mean if you were (2) ?",
"goto what"
]],
["* i am *", [
"goto i"
]],
["*", [
"Why do you say 'am' ?",
"I don't understand that."
]]
]],
["are", 0, [
["* are you *", [
"Why are you interested in whether I am (2) or not ?",
"Would you prefer if I weren't (2) ?",
"Perhaps I am (2) in your fantasies.",
"Do you sometimes think I am (2) ?",
"goto what",
"Would it matter to you ?",
"What if I were (2) ?"
]],
["* you are *", [
"goto you"
]],
["* are *", [
"Did you think they might not be (2) ?",
"Would you like it if they were not (2) ?",
"What if they were not (2) ?",
"Are they always (2) ?",
"Possibly they are (2).",
"Are you positive they are (2) ?"
]]
]],
["your", 0, [
["* your *", [
"Why are you concerned over my (2) ?",
"What about your own (2) ?",
"Are you worried about someone else's (2) ?",
"Really, my (2) ?",
"What makes you think of my (2) ?",
"Do you want my (2) ?"
]]
]],
["was", 2, [
["* was i *", [
"What if you were (2) ?",
"Do you think you were (2) ?",
"Were you (2) ?",
"What would it mean if you were (2) ?",
"What does ' (2) ' suggest to you ?",
"goto what"
]],
["* i was *", [
"Were you really ?",
"Why do you tell me you were (2) now ?",
"Perhaps I already know you were (2)."
]],
["* was you *", [
"Would you like to believe I was (2) ?",
"What suggests that I was (2) ?",
"What do you think ?",
"Perhaps I was (2).",
"What if I had been (2) ?"
]]
]],
["i", 0, [
["* i @desire *", [
"What would it mean to you if you got (3) ?",
"Why do you want (3) ?",
"Suppose you got (3) soon.",
"What if you never got (3) ?",
"What would getting (3) mean to you ?",
"What does wanting (3) have to do with this discussion ?"
]],
["* i am* @sad *", [
"I am sorry to hear that you are (3).",
"Do you think coming here will help you not to be (3) ?",
"I'm sure it's not pleasant to be (3).",
"Can you explain what made you (3) ?"
]],
["* i am* @happy *", [
"How have I helped you to be (3) ?",
"Has your treatment made you (3) ?",
"What makes you (3) just now ?",
"Can you explain why you are suddenly (3) ?"
]],
["* i was *", [
"goto was"
]],
["* i @belief i *", [
"Do you really think so ?",
"But you are not sure you (3).",
"Do you really doubt you (3) ?"
]],
["* i* @belief *you *", [
"goto you"
]],
["* i am *", [
"Is it because you are (2) that you came to me ?",
"How long have you been (2) ?",
"Do you believe it is normal to be (2) ?",
"Do you enjoy being (2) ?",
"Do you know anyone else who is (2) ?"
]],
["* i @cannot *", [
"How do you know that you can't (3) ?",
"Have you tried ?",
"Perhaps you could (3) now.",
"Do you really want to be able to (3) ?",
"What if you could (3) ?"
]],
["* i don't *", [
"Don't you really (2) ?",
"Why don't you (2) ?",
"Do you wish to be able to (2) ?",
"Does that trouble you ?"
]],
["* i feel *", [
"Tell me more about such feelings.",
"Do you often feel (2) ?",
"Do you enjoy feeling (2) ?",
"Of what does feeling (2) remind you ?"
]],
["* i * you *", [
"Perhaps in your fantasies we (2) each other.",
"Do you wish to (2) me ?",
"You seem to need to (2) me.",
"Do you (2) anyone else ?"
]],
["*", [
"You say (1) ?",
"Can you elaborate on that ?",
"Do you say (1) for some special reason ?",
"That's quite interesting."
]]
]],
["you", 0, [
["* you remind me of *", [
"goto alike"
]],
["* you are *", [
"What makes you think I am (2) ?",
"Does it please you to believe I am (2) ?",
"Do you sometimes wish you were (2) ?",
"Perhaps you would like to be (2)."
]],
["* you* me *", [
"Why do you think I (2) you ?",
"You like to think I (2) you -- don't you ?",
"What makes you think I (2) you ?",
"Really, I (2) you ?",
"Do you wish to believe I (2) you ?",
"Suppose I did (2) you -- what would that mean ?",
"Does someone else believe I (2) you ?"
]],
["* you *", [
"We were discussing you -- not me.",
"Oh, I (2) ?",
"You're not really talking about me -- are you ?",
"What are your feelings now ?"
]]
]],
["yes", 0, [
["*", [
"You seem to be quite positive.",
"You are sure.",
"I see.",
"I understand."
]]
]],
["no", 0, [
["* no one *", [
"Are you sure, no one (2) ?",
"Surely someone (2) .",
"Can you think of anyone at all ?",
"Are you thinking of a very special person ?",
"Who, may I ask ?",
"You have a particular person in mind, don't you ?",
"Who do you think you are talking about ?"
]],
["*", [
"Are you saying no just to be negative?",
"You are being a bit negative.",
"Why not ?",
"Why 'no' ?"
]]
]],
["my", 2, [
["$ * my *", [
"Does that have anything to do with the fact that your (2) ?",
"Lets discuss further why your (2).",
"Earlier you said your (2).",
"But your (2)."
]],
["* my* @family *", [
"Tell me more about your family.",
"Who else in your family (4) ?",
"Your (3) ?",
"What else comes to your mind when you think of your (3) ?"
]],
["* my *", [
"Your (2) ?",
"Why do you say your (2) ?",
"Does that suggest anything else which belongs to you ?",
"Is it important to you that your (2) ?"
]]
]],
["can", 0, [
["* can you *", [
"You believe I can (2) don't you ?",
"goto what",
"You want me to be able to (2).",
"Perhaps you would like to be able to (2) yourself."
]],
["* can i *", [
"Whether or not you can (2) depends on you more than on me.",
"Do you want to be able to (2) ?",
"Perhaps you don't want to (2).",
"goto what"
]]
]],
["what", 0, [
["*", [
"Why do you ask ?",
"Does that question interest you ?",
"What is it you really want to know ?",
"Are such questions much on your mind ?",
"What answer would please you most ?",
"What do you think ?",
"What comes to mind when you ask that ?",
"Have you asked such questions before ?",
"Have you asked anyone else ?"
]]
]],
["who", 0, [
["who *", [
"goto what"
]]
]],
["when", 0, [
["when *", [
"goto what"
]]
]],
["where", 0, [
["where *", [
"goto what"
]]
]],
["how", 0, [
["how *", [
"goto what"
]]
]],
["because", 0, [
["*", [
"Is that the real reason ?",
"Don't any other reasons come to mind ?",
"Does that reason seem to explain anything else ?",
"What other reasons might there be ?"
]]
]],
["why", 0, [
["* why don't you *", [
"Do you believe I don't (2) ?",
"Perhaps I will (2) in good time.",
"Should you (2) yourself ?",
"You want me to (2) ?",
"goto what"
]],
["* why can't i *", [
"Do you think you should be able to (2) ?",
"Do you want to be able to (2) ?",
"Do you believe this will help you to (2) ?",
"Have you any idea why you can't (2) ?",
"goto what"
]],
["*", [
"goto what"
]]
]],
["everyone", 2, [
["* @everyone *", [
"Really, (2) ?",
"Surely not (2).",
"Can you think of anyone in particular ?",
"Who, for example?",
"Are you thinking of a very special person ?",
"Who, may I ask ?",
"Someone special perhaps ?",
"You have a particular person in mind, don't you ?",
"Who do you think you're talking about ?"
]]
]],
["everybody", 2, [
["*", [
"goto everyone"
]]
]],
["nobody", 2, [
["*", [
"goto everyone"
]]
]],
["noone", 2, [
["*", [
"goto everyone"
]]
]],
["always", 1, [
["*", [
"Can you think of a specific example ?",
"When ?",
"What incident are you thinking of ?",
"Really, always ?"
]]
]],
["alike", 10, [
["*", [
"In what way ?",
"What resemblence do you see ?",
"What does that similarity suggest to you ?",
"What other connections do you see ?",
"What do you suppose that resemblence means ?",
"What is the connection, do you suppose ?",
"Could there really be some connection ?",
"How ?"
]]
]],
["like", 10, [
["* @be *like *", [
"goto alike"
]]
]],
["different", 0, [
["*", [
"How is it different ?",
"What differences do you see ?",
"What does that difference suggest to you ?",
"What other distinctions do you see ?",
"What do you suppose that disparity means ?",
"Could there be some connection, do you suppose ?",
"How ?"
]]
]]
];
// regexp/replacement pairs to be performed as final cleanings
// here: cleanings for multiple bots talking to each other
var elizaPostTransforms = [
/ old old/g, " old",
/\bthey were( not)? me\b/g, "it was$1 me",
/\bthey are( not)? me\b/g, "it is$1 me",
/Are they( always)? me\b/, "it is$1 me",
/\bthat your( own)? (\w+)( now)? \?/, "that you have your$1 $2 ?",
/\bI to have (\w+)/, "I have $1",
/Earlier you said your( own)? (\w+)( now)?\./, "Earlier you talked about your $2."
];
// eof

108
clippy/elizabot/index.html
Unescape Escape View File

@ -0,0 +1,108 @@
<HTML>
<HEAD>
<meta charset="utf-8">
<TITLE>Eliza (elizabot.js)</TITLE>
<SCRIPT LANGUAGE="JavaScript" TYPE="text/javascript" SRC="elizabot.js"></SCRIPT>
<SCRIPT LANGUAGE="JavaScript" TYPE="text/javascript" SRC="elizadata.js"></SCRIPT>
<link rel="stylesheet" type="text/css" href="./clippy.js/build/clippy.css" media="all">
<SCRIPT LANGUAGE="JavaScript" TYPE="text/javascript">
var eliza = new ElizaBot();
var elizaLines = new Array();
var displayCols = 60;
var displayRows = 20;
function elizaReset() {
eliza.reset();
elizaLines.length = 0;
elizaStep();
}
function elizaStep() {
var f = document.forms.e_form;
var userinput = f.e_input.value;
if (eliza.quit) {
f.e_input.value = '';
if (confirm("This session is over.\nStart over?")) elizaReset();
f.e_input.focus();
return;
}
else if (userinput != '') {
var usr = 'YOU: ' + userinput;
var rpl ='ELIZA: ' + eliza.transform(userinput);
elizaLines.push(usr);
elizaLines.push(rpl);
console.log(rpl);
// display nicely
// (fit to textarea with last line free - reserved for extra line caused by word wrap)
var temp = new Array();
var l = 0;
for (var i=elizaLines.length-1; i>=0; i--) {
l += 1 + Math.floor(elizaLines[i].length/displayCols);
if (l >= displayRows) break
else temp.push(elizaLines[i]);
}
elizaLines = temp.reverse();
f.e_display.value = elizaLines.join('\n');
}
else if (elizaLines.length == 0) {
// no input and no saved lines -> output initial
var initial = 'ELIZA: ' + eliza.getInitial();
elizaLines.push(initial);
f.e_display.value = initial + '\n';
}
f.e_input.value = '';
f.e_input.focus();
}
//-->
</SCRIPT>
</HEAD>
<BODY TOPMARGIN="0" LEFTMARGIN="0" RIGHTMARGIN="0" BOTTOMMARGIN="0" MARGINHEIGHT="0" MARGINWIDTH="0" STYLE="border:0" onload="window.setTimeout('elizaReset()',100)"><A NAME="top"></A>
<CENTER>
<P>&nbsp;</P>
<H3>Eliza</H3>
<TABLE BORDER="0" CELLSPACING="10" CELLPADDING="0">
<FORM NAME="e_form" onsubmit="elizaStep();return false">
<TR><TD COLSPAN="2"><TEXTAREA NAME="e_display" COLS="60" ROWS="20"></TEXTAREA></TD></TR>
<TR VALIGN="middle">
<TD><INPUT TYPE="text" NAME="e_input" SIZE="50"></TD>
<TD ALIGN="right"><INPUT TYPE="submit" VALUE="&nbsp;Talk&nbsp;"> <INPUT TYPE="reset" VALUE="Reset" onClick="window.setTimeout('elizaReset()',100)"></TD>
</TR>
</FORM>
<script src="./jquery.1.7.min.js"></script>
<script src="./clippy.js/build/clippy.js"></script>
<script type="text/javascript">
clippy.load('Clippy', function(agent){
agent.show();
//agent.play('Searching');
//agent.animate();
//agent.animations();
//agent.moveTo();
//agent.play();
agent.speak('Heeeeeeeeey!');
agent.animate();
agent.speak('Im Clippy!');
//agent.gestureAt(200,200);
//agent.stopCurrent();
//agent.stop();
});
</script>
</BODY>
</HTML>

611
clippy/elizadata.js
Unescape Escape View File

@ -0,0 +1,611 @@
// data for elizabot.js
// entries prestructured as layed out in Weizenbaum's description
// [cf: Communications of the ACM, Vol. 9, #1 (January 1966): p 36-45.]
var elizaInitials = [
"How do you do. Please tell me your problem.",
// additions (not original)
"Please tell me what's been bothering you.",
"Is something troubling you ?"
];
var elizaFinals = [
"Goodbye. It was nice talking to you.",
// additions (not original)
"Goodbye. This was really a nice talk.",
"Goodbye. I'm looking forward to our next session.",
"This was a good session, wasn't it -- but time is over now. Goodbye.",
"Maybe we could discuss this moreover in our next session ? Goodbye."
];
var elizaQuits = [
"bye",
"goodbye",
"done",
"exit",
"quit"
];
var elizaPres = [
"dont", "don't",
"cant", "can't",
"wont", "won't",
"recollect", "remember",
"recall", "remember",
"dreamt", "dreamed",
"dreams", "dream",
"maybe", "perhaps",
"certainly", "yes",
"machine", "computer",
"machines", "computer",
"computers", "computer",
"were", "was",
"you're", "you are",
"i'm", "i am",
"same", "alike",
"identical", "alike",
"equivalent", "alike"
];
var elizaPosts = [
"am", "are",
"your", "my",
"me", "you",
"myself", "yourself",
"yourself", "myself",
"i", "you",
"you", "I",
"my", "your",
"i'm", "you are"
];
var elizaSynons = {
"be": ["am", "is", "are", "was"],
"belief": ["feel", "think", "believe", "wish"],
"cannot": ["can't"],
"desire": ["want", "need"],
"everyone": ["everybody", "nobody", "noone"],
"family": ["mother", "mom", "father", "dad", "sister", "brother", "wife", "children", "child"],
"happy": ["elated", "glad", "better"],
"sad": ["unhappy", "depressed", "sick"]
};
var elizaKeywords = [
/*
Array of
["<key>", <rank>, [
["<decomp>", [
"<reasmb>",
"<reasmb>",
"<reasmb>"
]],
["<decomp>", [
"<reasmb>",
"<reasmb>",
"<reasmb>"
]]
]]
*/
["xnone", 0, [
["*", [
"I'm not sure I understand you fully.",
"Please go on.",
"What does that suggest to you ?",
"Do you feel strongly about discussing such things ?",
"That is interesting. Please continue.",
"Tell me more about that.",
"Does talking about this bother you ?"
]]
]],
["sorry", 0, [
["*", [
"Please don't apologise.",
"Apologies are not necessary.",
"I've told you that apologies are not required.",
"It did not bother me. Please continue."
]]
]],
["apologise", 0, [
["*", [
"goto sorry"
]]
]],
["remember", 5, [
["* i remember *", [
"Do you often think of (2) ?",
"Does thinking of (2) bring anything else to mind ?",
"What else do you recollect ?",
"Why do you remember (2) just now ?",
"What in the present situation reminds you of (2) ?",
"What is the connection between me and (2) ?",
"What else does (2) remind you of ?"
]],
["* do you remember *", [
"Did you think I would forget (2) ?",
"Why do you think I should recall (2) now ?",
"What about (2) ?",
"goto what",
"You mentioned (2) ?"
]],
["* you remember *", [
"How could I forget (2) ?",
"What about (2) should I remember ?",
"goto you"
]]
]],
["forget", 5, [
["* i forget *", [
"Can you think of why you might forget (2) ?",
"Why can't you remember (2) ?",
"How often do you think of (2) ?",
"Does it bother you to forget that ?",
"Could it be a mental block ?",
"Are you generally forgetful ?",
"Do you think you are suppressing (2) ?"
]],
["* did you forget *", [
"Why do you ask ?",
"Are you sure you told me ?",
"Would it bother you if I forgot (2) ?",
"Why should I recall (2) just now ?",
"goto what",
"Tell me more about (2)."
]]
]],
["if", 3, [
["* if *", [
"Do you think it's likely that (2) ?",
"Do you wish that (2) ?",
"What do you know about (2) ?",
"Really, if (2) ?",
"What would you do if (2) ?",
"But what are the chances that (2) ?",
"What does this speculation lead to ?"
]]
]],
["dreamed", 4, [
["* i dreamed *", [
"Really, (2) ?",
"Have you ever fantasized (2) while you were awake ?",
"Have you ever dreamed (2) before ?",
"goto dream"
]]
]],
["dream", 3, [
["*", [
"What does that dream suggest to you ?",
"Do you dream often ?",
"What persons appear in your dreams ?",
"Do you believe that dreams have something to do with your problem ?"
]]
]],
["perhaps", 0, [
["*", [
"You don't seem quite certain.",
"Why the uncertain tone ?",
"Can't you be more positive ?",
"You aren't sure ?",
"Don't you know ?",
"How likely, would you estimate ?"
]]
]],
["name", 15, [
["*", [
"I am not interested in names.",
"I've told you before, I don't care about names -- please continue."
]]
]],
["deutsch", 0, [
["*", [
"goto xforeign",
"I told you before, I don't understand German."
]]
]],
["francais", 0, [
["*", [
"goto xforeign",
"I told you before, I don't understand French."
]]
]],
["italiano", 0, [
["*", [
"goto xforeign",
"I told you before, I don't understand Italian."
]]
]],
["espanol", 0, [
["*", [
"goto xforeign",
"I told you before, I don't understand Spanish."
]]
]],
["xforeign", 0, [
["*", [
"I speak only English."
]]
]],
["hello", 0, [
["*", [
"How do you do. Please state your problem.",
"Hi. What seems to be your problem ?"
]]
]],
["computer", 50, [
["*", [
"Do computers worry you ?",
"Why do you mention computers ?",
"What do you think machines have to do with your problem ?",
"Don't you think computers can help people ?",
"What about machines worries you ?",
"What do you think about machines ?",
"You don't think I am a computer program, do you ?"
]]
]],
["am", 0, [
["* am i *", [
"Do you believe you are (2) ?",
"Would you want to be (2) ?",
"Do you wish I would tell you you are (2) ?",
"What would it mean if you were (2) ?",
"goto what"
]],
["* i am *", [
"goto i"
]],
["*", [
"Why do you say 'am' ?",
"I don't understand that."
]]
]],
["are", 0, [
["* are you *", [
"Why are you interested in whether I am (2) or not ?",
"Would you prefer if I weren't (2) ?",
"Perhaps I am (2) in your fantasies.",
"Do you sometimes think I am (2) ?",
"goto what",
"Would it matter to you ?",
"What if I were (2) ?"
]],
["* you are *", [
"goto you"
]],
["* are *", [
"Did you think they might not be (2) ?",
"Would you like it if they were not (2) ?",
"What if they were not (2) ?",
"Are they always (2) ?",
"Possibly they are (2).",
"Are you positive they are (2) ?"
]]
]],
["your", 0, [
["* your *", [
"Why are you concerned over my (2) ?",
"What about your own (2) ?",
"Are you worried about someone else's (2) ?",
"Really, my (2) ?",
"What makes you think of my (2) ?",
"Do you want my (2) ?"
]]
]],
["was", 2, [
["* was i *", [
"What if you were (2) ?",
"Do you think you were (2) ?",
"Were you (2) ?",
"What would it mean if you were (2) ?",
"What does ' (2) ' suggest to you ?",
"goto what"
]],
["* i was *", [
"Were you really ?",
"Why do you tell me you were (2) now ?",
"Perhaps I already know you were (2)."
]],
["* was you *", [
"Would you like to believe I was (2) ?",
"What suggests that I was (2) ?",
"What do you think ?",
"Perhaps I was (2).",
"What if I had been (2) ?"
]]
]],
["i", 0, [
["* i @desire *", [
"What would it mean to you if you got (3) ?",
"Why do you want (3) ?",
"Suppose you got (3) soon.",
"What if you never got (3) ?",
"What would getting (3) mean to you ?",
"What does wanting (3) have to do with this discussion ?"
]],
["* i am* @sad *", [
"I am sorry to hear that you are (3).",
"Do you think coming here will help you not to be (3) ?",
"I'm sure it's not pleasant to be (3).",
"Can you explain what made you (3) ?"
]],
["* i am* @happy *", [
"How have I helped you to be (3) ?",
"Has your treatment made you (3) ?",
"What makes you (3) just now ?",
"Can you explain why you are suddenly (3) ?"
]],
["* i was *", [
"goto was"
]],
["* i @belief i *", [
"Do you really think so ?",
"But you are not sure you (3).",
"Do you really doubt you (3) ?"
]],
["* i* @belief *you *", [
"goto you"
]],
["* i am *", [
"Is it because you are (2) that you came to me ?",
"How long have you been (2) ?",
"Do you believe it is normal to be (2) ?",
"Do you enjoy being (2) ?",
"Do you know anyone else who is (2) ?"
]],
["* i @cannot *", [
"How do you know that you can't (3) ?",
"Have you tried ?",
"Perhaps you could (3) now.",
"Do you really want to be able to (3) ?",
"What if you could (3) ?"
]],
["* i don't *", [
"Don't you really (2) ?",
"Why don't you (2) ?",
"Do you wish to be able to (2) ?",
"Does that trouble you ?"
]],
["* i feel *", [
"Tell me more about such feelings.",
"Do you often feel (2) ?",
"Do you enjoy feeling (2) ?",
"Of what does feeling (2) remind you ?"
]],
["* i * you *", [
"Perhaps in your fantasies we (2) each other.",
"Do you wish to (2) me ?",
"You seem to need to (2) me.",
"Do you (2) anyone else ?"
]],
["*", [
"You say (1) ?",
"Can you elaborate on that ?",
"Do you say (1) for some special reason ?",
"That's quite interesting."
]]
]],
["you", 0, [
["* you remind me of *", [
"goto alike"
]],
["* you are *", [
"What makes you think I am (2) ?",
"Does it please you to believe I am (2) ?",
"Do you sometimes wish you were (2) ?",
"Perhaps you would like to be (2)."
]],
["* you* me *", [
"Why do you think I (2) you ?",
"You like to think I (2) you -- don't you ?",
"What makes you think I (2) you ?",
"Really, I (2) you ?",
"Do you wish to believe I (2) you ?",
"Suppose I did (2) you -- what would that mean ?",
"Does someone else believe I (2) you ?"
]],
["* you *", [
"We were discussing you -- not me.",
"Oh, I (2) ?",
"You're not really talking about me -- are you ?",
"What are your feelings now ?"
]]
]],
["yes", 0, [
["*", [
"You seem to be quite positive.",
"You are sure.",
"I see.",
"I understand."
]]
]],
["no", 0, [
["* no one *", [
"Are you sure, no one (2) ?",
"Surely someone (2) .",
"Can you think of anyone at all ?",
"Are you thinking of a very special person ?",
"Who, may I ask ?",
"You have a particular person in mind, don't you ?",
"Who do you think you are talking about ?"
]],
["*", [
"Are you saying no just to be negative?",
"You are being a bit negative.",
"Why not ?",
"Why 'no' ?"
]]
]],
["my", 2, [
["$ * my *", [
"Does that have anything to do with the fact that your (2) ?",
"Lets discuss further why your (2).",
"Earlier you said your (2).",
"But your (2)."
]],
["* my* @family *", [
"Tell me more about your family.",
"Who else in your family (4) ?",
"Your (3) ?",
"What else comes to your mind when you think of your (3) ?"
]],
["* my *", [
"Your (2) ?",
"Why do you say your (2) ?",
"Does that suggest anything else which belongs to you ?",
"Is it important to you that your (2) ?"
]]
]],
["can", 0, [
["* can you *", [
"You believe I can (2) don't you ?",
"goto what",
"You want me to be able to (2).",
"Perhaps you would like to be able to (2) yourself."
]],
["* can i *", [
"Whether or not you can (2) depends on you more than on me.",
"Do you want to be able to (2) ?",
"Perhaps you don't want to (2).",
"goto what"
]]
]],
["what", 0, [
["*", [
"Why do you ask ?",
"Does that question interest you ?",
"What is it you really want to know ?",
"Are such questions much on your mind ?",
"What answer would please you most ?",
"What do you think ?",
"What comes to mind when you ask that ?",
"Have you asked such questions before ?",
"Have you asked anyone else ?"
]]
]],
["who", 0, [
["who *", [
"goto what"
]]
]],
["when", 0, [
["when *", [
"goto what"
]]
]],
["where", 0, [
["where *", [
"goto what"
]]
]],
["how", 0, [
["how *", [
"goto what"
]]
]],
["because", 0, [
["*", [
"Is that the real reason ?",
"Don't any other reasons come to mind ?",
"Does that reason seem to explain anything else ?",
"What other reasons might there be ?"
]]
]],
["why", 0, [
["* why don't you *", [
"Do you believe I don't (2) ?",
"Perhaps I will (2) in good time.",
"Should you (2) yourself ?",
"You want me to (2) ?",
"goto what"
]],
["* why can't i *", [
"Do you think you should be able to (2) ?",
"Do you want to be able to (2) ?",
"Do you believe this will help you to (2) ?",
"Have you any idea why you can't (2) ?",
"goto what"
]],
["*", [
"goto what"
]]
]],
["everyone", 2, [
["* @everyone *", [
"Really, (2) ?",
"Surely not (2).",
"Can you think of anyone in particular ?",
"Who, for example?",
"Are you thinking of a very special person ?",
"Who, may I ask ?",
"Someone special perhaps ?",
"You have a particular person in mind, don't you ?",
"Who do you think you're talking about ?"
]]
]],
["everybody", 2, [
["*", [
"goto everyone"
]]
]],
["nobody", 2, [
["*", [
"goto everyone"
]]
]],
["noone", 2, [
["*", [
"goto everyone"
]]
]],
["always", 1, [
["*", [
"Can you think of a specific example ?",
"When ?",
"What incident are you thinking of ?",
"Really, always ?"
]]
]],
["alike", 10, [
["*", [
"In what way ?",
"What resemblence do you see ?",
"What does that similarity suggest to you ?",
"What other connections do you see ?",
"What do you suppose that resemblence means ?",
"What is the connection, do you suppose ?",
"Could there really be some connection ?",
"How ?"
]]
]],
["like", 10, [
["* @be *like *", [
"goto alike"
]]
]],
["different", 0, [
["*", [
"How is it different ?",
"What differences do you see ?",
"What does that difference suggest to you ?",
"What other distinctions do you see ?",
"What do you suppose that disparity means ?",
"Could there be some connection, do you suppose ?",
"How ?"
]]
]]
];
// regexp/replacement pairs to be performed as final cleanings
// here: cleanings for multiple bots talking to each other
var elizaPostTransforms = [
/ old old/g, " old",
/\bthey were( not)? me\b/g, "it was$1 me",
/\bthey are( not)? me\b/g, "it is$1 me",
/Are they( always)? me\b/, "it is$1 me",
/\bthat your( own)? (\w+)( now)? \?/, "that you have your$1 $2 ?",
/\bI to have (\w+)/, "I have $1",
/Earlier you said your( own)? (\w+)( now)?\./, "Earlier you talked about your $2."
];
// eof

43
clippy/index.html
Unescape Escape View File

@ -0,0 +1,43 @@
<!DOCTYPE html>
<html>
<head>
<meta charset="utf-8">
<title>Clippy</title>
<link rel="stylesheet" type="text/css" href="./clippy.js/build/clippy.css" media="all">
</head>
<body>
<h1>Hello Clippy!</h1>
<script src="./jquery.1.7.min.js"></script>
<script src="./clippy.js/build/clippy.js"></script>
<script type="text/javascript">
clippy.load('Clippy', function(agent){
agent.show();
//agent.play('Searching');
//agent.animate();
//agent.animations();
//agent.moveTo();
//agent.play();
agent.speak('Heeeeeeeeey!');
agent.animate();
agent.speak('Im Clippy!');
//agent.gestureAt(200,200);
//agent.stopCurrent();
//agent.stop();
});
</script>
</body>
</html>

50
clippy/it_seems_like.html
Unescape Escape View File

@ -0,0 +1,50 @@
<!DOCTYPE html>
<html>
<head>
<meta charset="utf-8">
<title>Clippy</title>
<link rel="stylesheet" type="text/css" href="./clippy.js/build/clippy.css" media="all">
<link rel="stylesheet" type="text/css" href="./it_seems_like.js" media="all">
</head>
<body>
<h1>Hello Clippy!</h1>
<script src="./jquery.1.7.min.js"></script>
<script src="./clippy.js/build/clippy.js"></script>
<script type="text/javascript">
var x = ["It looks like you're writing a letter: Microsoft Word", 'A recent film has one character blown to death at their keyboard.', 'Underneath the desk they sit at is a bomb controlled by a keystroke counter. ', 'When the number of taps on the keyboard drops below a certain number, off goes the explosive. ', 'A real innovation in the switching system the bomb uses is that it is tied into the grammar check in Microsoft Word. ', 'The victim is unable to keep tapping away at the same key until help arrives. ', 'They have to keep composing grammatically correct sentences, line after line, through the cramp in their fingers.', "Needless to say, knowing this is both a sure wellspring of verbiage and a scriptwriter's shortcut to bathos, they compose a last letter to their loved ones.", "Eventually though, the agrammaticality of their emotions or of tiredness sprawls out of even these second guessed finger-tips and as a green line appears under a patiently panicked phrase, up they go.", '', 'This lot is being written with every toolbar visible, every feature enabled. ', 'One third of the screen, a large one, is taken up with grey toolbars pocked with icons. ', "There is a constant clatter of audio feedback clicking, shuffling and chiming as the user's attention is pulled away from putting together a piece of writing into the manufacture of the text as a perfectly primped document. ", 'As you read, understand that these words are to appear against a background fill effect of white, grey-veined marble.'];
clippy.load('Clippy', function(agent){
agent.show();
//agent.play('Searching');
//agent.animate();
//agent.animations();
//agent.moveTo();
//agent.play();
var i = 0
$( "*" ).click(function() {
agent.speak(x[i]);
i += 1;
});
agent.animate();
agent.speak('Hi. Im Clippy!');
//agent.gestureAt(200,200);
//agent.stopCurrent();
//agent.stop();
});
</script>
</body>
</html>

1
clippy/it_seems_like.js
Unescape Escape View File

@ -0,0 +1 @@
var x = ["It looks like you're writing a letter: Microsoft Word", '', 'A recent film has one character blown to death at their keyboard.', 'Underneath the desk they sit at is a bomb controlled by a keystroke counter. ', 'When the number of taps on the keyboard drops below a certain number, off goes the explosive. ', 'A real innovation in the switching system the bomb uses is that it is tied into the grammar check in Microsoft Word. ', 'The victim is unable to keep tapping away at the same key until help arrives. ', 'They have to keep composing grammatically correct sentences, line after line, through the cramp in their fingers.', '', "Needless to say, knowing this is both a sure wellspring of verbiage and a scriptwriter's shortcut to bathos, they compose a last letter to their loved ones. Eventually though, the agrammaticality of their emotions or of tiredness sprawls out of even these second guessed finger-tips and as a green line appears under a patiently panicked phrase, up they go.", '', 'This lot is being written with every toolbar visible, every feature enabled. ', 'One third of the screen, a large one, is taken up with grey toolbars pocked with icons. ', "There is a constant clatter of audio feedback clicking, shuffling and chiming as the user's attention is pulled away from putting together a piece of writing into the manufacture of the text as a perfectly primped document. ", 'As you read, understand that these words are to appear against a background fill effect of white, grey-veined marble.', '', '', ''];

4
clippy/jquery.1.7.min.js vendored
View File

File diff suppressed because one or more lines are too long

7
compphile.txt
Unescape Escape View File

@ -0,0 +1,7 @@
=computerphile=
* cokies
* music with hard drive
* algorithm (cost & speed)
* concept of abstraction

1
filoXX/filoXX.js
View File

File diff suppressed because one or more lines are too long

22
filoXX/index.html
Unescape Escape View File

@ -0,0 +1,22 @@
<!DOCTYPE html>
<html>
<head>
<title>Tao</title>
<script src="https://cdn.jsdelivr.net/npm/p5@1.0.0/lib/p5.js"></script>
<script type="text/javascript" src="sketch.js"></script>
<script type="text/javascript" src="filoXX.js"></script>
<style type="text/css">
body {
width: 100%;
height: 100%;
margin: 0px;
background-color: black;
font-family: "Lucida Console", Monaco, sans-serif;
color: black;
}
</style>
</head>
<body>
</body>
</html>

51
filoXX/sketch.js
Unescape Escape View File

@ -0,0 +1,51 @@
var canvas;
function windowResized(){
resizeCanvas(windowWidth, windowHeight);
}
function setup() {
var canvas;
canvas = createCanvas(windowWidth, windowHeight);
canvas.position(0,0);
canvas.style("z-index","-1");
background(255)
textSize(10);
frameRate(5)
}
let n = 0;
function draw(){
if (n == 40) {
noLoop();
} else {
textSize(0);
createP(x[n]);
n += 1;
}
}
// let words = x;
// let word = random(words); // select random word
// textSize(15);
// text(word, random(windowWidth), random(windowHeight))
// textSize(32);
// text(x[5], random(windowWidth), random(windowHeight));
// }
// s
// fill(0);
// circle(50,50,5,50);

103
hypervirus/1.html
Unescape Escape View File

@ -0,0 +1,103 @@
<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
<head>
<title></title>
<meta http-equiv="Content-Type" content="text/html;charset=utf-8" />
<meta name='ocr-system' content='tesseract 3.04.01' />
<meta name='ocr-capabilities' content='ocr_page ocr_carea ocr_par ocr_line ocrx_word'/>
<link rel="stylesheet" href="//code.jquery.com/ui/1.12.1/themes/base/jquery-ui.css">
<link rel="stylesheet" href="/resources/demos/style.css">
<script src="https://code.jquery.com/jquery-1.12.4.js"></script>
<script src="https://code.jquery.com/ui/1.12.1/jquery-ui.js"></script>
<style type="text/css">
body { background-color: black;
color: lime; }
</style>
</head>
<body>
<div class='ocr_page' id='page_1' title='image "hypervirus-01.tif"; bbox 0 0 1749 2481; ppageno 0'>
<div class='ocr_carea' id='block_1_1' title="bbox 340 463 614 518">
<p class='ocr_par' dir='ltr' id='par_1_1' title="bbox 340 463 614 518">
<span class='ocr_line' id='line_1_1' title="bbox 340 463 614 518; baseline 0 -12; x_size 55; x_descenders 12; x_ascenders 13"><span class='ocrx_word' id='word_1_1' title='bbox 340 463 614 518; x_wconf 85' lang='eng' dir='ltr' style="font-size: 30px;"><b>Hypervirus</b></span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_2' title="bbox 332 1001 1343 2035">
<p class='ocr_par' dir='ltr' id='par_1_2' title="bbox 334 1001 1343 1219">
<span class='ocr_line' id='line_1_2' title="bbox 334 1001 1343 1042; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_2' title='bbox 334 1001 513 1031; x_wconf 85' lang='eng' dir='ltr'>Whatever</span> <span class='ocrx_word' id='word_1_3' title='bbox 532 1001 817 1042; x_wconf 92' lang='eng' dir='ltr'>ultramodernity</span> <span class='ocrx_word' id='word_1_4' title='bbox 835 1001 948 1041; x_wconf 84' lang='eng' dir='ltr'>places</span> <span class='ocrx_word' id='word_1_5' title='bbox 967 1001 1074 1031; x_wconf 98' lang='eng' dir='ltr'>under</span> <span class='ocrx_word' id='word_1_6' title='bbox 1093 1001 1147 1031; x_wconf 85' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_7' title='bbox 1166 1001 1343 1031; x_wconf 88' lang='eng' dir='ltr'>dominion</span>
</span>
<span class='ocr_line' id='line_1_3' title="bbox 334 1060 1343 1101; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_8' title='bbox 334 1060 374 1090; x_wconf 88' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_9' title='bbox 386 1060 479 1101; x_wconf 85' lang='eng' dir='ltr'>signs</span> <span class='ocrx_word' id='word_1_10' title='bbox 494 1060 766 1101; x_wconf 95' lang='eng' dir='ltr'>postmodernity</span> <span class='ocrx_word' id='word_1_11' title='bbox 784 1060 934 1090; x_wconf 85' lang='eng' dir='ltr'>subverts</span> <span class='ocrx_word' id='word_1_12' title='bbox 951 1060 1027 1090; x_wconf 92' lang='eng' dir='ltr'>with</span> <span class='ocrx_word' id='word_1_13' title='bbox 1044 1060 1140 1090; x_wconf 89' lang='eng' dir='ltr'>virus.</span> <span class='ocrx_word' id='word_1_14' title='bbox 1155 1061 1203 1090; x_wconf 93' lang='eng' dir='ltr'>As</span> <span class='ocrx_word' id='word_1_15' title='bbox 1219 1060 1343 1090; x_wconf 90' lang='eng' dir='ltr'>culture</span>
</span>
<span class='ocr_line' id='line_1_4' title="bbox 335 1117 1342 1161; baseline 0 -13; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_16' title='bbox 335 1118 489 1159; x_wconf 85' lang='eng' dir='ltr'>migrates</span> <span class='ocrx_word' id='word_1_17' title='bbox 503 1118 574 1148; x_wconf 98' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_18' title='bbox 588 1118 893 1158; x_wconf 88' lang='eng' dir='ltr'>partial-machines</span> <span class='ocrx_word' id='word_1_19' title='bbox 908 1117 1053 1161; x_wconf 88' lang='eng' dir='ltr'>(lacking</span> <span class='ocrx_word' id='word_1_20' title='bbox 1066 1128 1106 1148; x_wconf 98' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_21' title='bbox 1120 1124 1342 1148; x_wconf 88' lang='eng' dir='ltr'>autonomous</span>
</span>
<span class='ocr_line' id='line_1_5' title="bbox 334 1175 1341 1219; baseline 0 -12; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_22' title='bbox 334 1177 560 1217; x_wconf 91' lang='eng' dir='ltr'>reproductive</span> <span class='ocrx_word' id='word_1_23' title='bbox 571 1175 704 1219; x_wconf 89' lang='eng' dir='ltr'>system)</span> <span class='ocrx_word' id='word_1_24' title='bbox 716 1177 881 1207; x_wconf 90' lang='eng' dir='ltr'>semiotics</span> <span class='ocrx_word' id='word_1_25' title='bbox 890 1177 1036 1207; x_wconf 94' lang='eng' dir='ltr'>subsides</span> <span class='ocrx_word' id='word_1_26' title='bbox 1045 1177 1113 1207; x_wconf 98' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_27' title='bbox 1124 1177 1341 1207; x_wconf 87' lang='eng' dir='ltr'>virotechnics.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_3' title="bbox 332 1243 1342 1567">
<span class='ocr_line' id='line_1_6' title="bbox 398 1243 1340 1265; baseline 0.001 -1; x_size 42.261055; x_descenders 11.210714; x_ascenders 10.491632"><span class='ocrx_word' id='word_1_28' title='bbox 398 1243 1340 1265; x_wconf 94' lang='eng'>0010101011011100101101010101001100100010001010</span>
</span>
<span class='ocr_line' id='line_1_7' title="bbox 335 1301 1342 1323; baseline 0.001 -1; x_size 42.261055; x_descenders 11.210714; x_ascenders 10.491632"><span class='ocrx_word' id='word_1_29' title='bbox 335 1301 1342 1323; x_wconf 96' lang='eng'>1011101000010101100101001010001100100111001000100</span>
</span>
<span class='ocr_line' id='line_1_8' title="bbox 335 1360 1339 1382; baseline 0 0; x_size 42.261055; x_descenders 11.210714; x_ascenders 10.491632"><span class='ocrx_word' id='word_1_30' title='bbox 335 1360 1339 1382; x_wconf 94' lang='eng'>000000010011111100010010010101010100001000010101</span>
</span>
<span class='ocr_line' id='line_1_9' title="bbox 335 1418 1339 1440; baseline 0 0; x_size 42.261055; x_descenders 11.210714; x_ascenders 10.491632"><span class='ocrx_word' id='word_1_31' title='bbox 335 1418 1339 1440; x_wconf 96' lang='eng'>00111111001001000100011010010001010010101111000101</span>
</span>
<span class='ocr_line' id='line_1_10' title="bbox 335 1469 1342 1510; baseline 0 -11; x_size 40; x_descenders 11; x_ascenders 9"><span class='ocrx_word' id='word_1_32' title='bbox 335 1477 719 1499; x_wconf 96' lang='eng'>001000010001110100</span> <span class='ocrx_word' id='word_1_33' title='bbox 733 1470 792 1499; x_wconf 94' lang='eng' dir='ltr'>Yes</span> <span class='ocrx_word' id='word_1_34' title='bbox 807 1470 863 1499; x_wconf 95' lang='eng' dir='ltr'>No</span> <span class='ocrx_word' id='word_1_35' title='bbox 875 1470 935 1499; x_wconf 94' lang='eng' dir='ltr'>Yes</span> <span class='ocrx_word' id='word_1_36' title='bbox 950 1470 1003 1499; x_wconf 96' lang='eng' dir='ltr'>No</span> <span class='ocrx_word' id='word_1_37' title='bbox 1016 1470 1075 1499; x_wconf 94' lang='eng' dir='ltr'>Yes</span> <span class='ocrx_word' id='word_1_38' title='bbox 1087 1470 1146 1499; x_wconf 99' lang='eng' dir='ltr'>Yes</span> <span class='ocrx_word' id='word_1_39' title='bbox 1160 1470 1214 1499; x_wconf 96' lang='eng' dir='ltr'>No</span> <span class='ocrx_word' id='word_1_40' title='bbox 1229 1469 1342 1510; x_wconf 85' lang='eng' dir='ltr'>longer</span>
</span>
<span class='ocr_line' id='line_1_11' title="bbox 332 1527 1130 1567; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_41' title='bbox 332 1527 421 1557; x_wconf 93' lang='eng' dir='ltr'>what</span> <span class='ocrx_word' id='word_1_42' title='bbox 435 1527 515 1557; x_wconf 98' lang='eng' dir='ltr'>does</span> <span class='ocrx_word' id='word_1_43' title='bbox 530 1527 554 1557; x_wconf 99' lang='eng' dir='ltr'>it</span> <span class='ocrx_word' id='word_1_44' title='bbox 567 1527 685 1557; x_wconf 82' lang='eng' dir='ltr'>mean?</span> <span class='ocrx_word' id='word_1_45' title='bbox 699 1527 760 1557; x_wconf 98' lang='eng' dir='ltr'>but</span> <span class='ocrx_word' id='word_1_46' title='bbox 774 1527 851 1557; x_wconf 94' lang='eng' dir='ltr'>how</span> <span class='ocrx_word' id='word_1_47' title='bbox 862 1527 944 1557; x_wconf 99' lang='eng' dir='ltr'>does</span> <span class='ocrx_word' id='word_1_48' title='bbox 957 1527 982 1557; x_wconf 99' lang='eng' dir='ltr'>it</span> <span class='ocrx_word' id='word_1_49' title='bbox 994 1527 1130 1567; x_wconf 81' lang='eng' dir='ltr'>spread?</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_4' title="bbox 334 1586 1341 1732">
<span class='ocr_line' id='line_1_12' title="bbox 398 1586 1341 1627; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_50' title='bbox 398 1586 533 1627; x_wconf 84' lang='eng' dir='ltr'>Having</span> <span class='ocrx_word' id='word_1_51' title='bbox 541 1596 588 1616; x_wconf 98' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_52' title='bbox 596 1596 723 1626; x_wconf 98' lang='eng' dir='ltr'>proper</span> <span class='ocrx_word' id='word_1_53' title='bbox 732 1586 919 1622; x_wconf 79' lang='eng' dir='ltr'>substance,</span> <span class='ocrx_word' id='word_1_54' title='bbox 929 1596 967 1616; x_wconf 99' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_55' title='bbox 977 1596 1067 1616; x_wconf 98' lang='eng' dir='ltr'>sense</span> <span class='ocrx_word' id='word_1_56' title='bbox 1077 1586 1210 1627; x_wconf 88' lang='eng' dir='ltr'>beyond</span> <span class='ocrx_word' id='word_1_57' title='bbox 1219 1586 1258 1616; x_wconf 99' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_58' title='bbox 1264 1596 1298 1616; x_wconf 99' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_59' title='bbox 1307 1596 1341 1616; x_wconf 99' lang='eng' dir='ltr'>re</span>
</span>
<span class='ocr_line' id='line_1_13' title="bbox 334 1644 1339 1685; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_60' title='bbox 334 1654 367 1674; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_61' title='bbox 378 1644 583 1684; x_wconf 79' lang='eng' dir='ltr'>replication,</span> <span class='ocrx_word' id='word_1_62' title='bbox 593 1654 650 1685; x_wconf 89' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_63' title='bbox 661 1654 707 1674; x_wconf 98' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_64' title='bbox 718 1654 764 1674; x_wconf 98' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_65' title='bbox 775 1654 876 1685; x_wconf 99' lang='eng' dir='ltr'>usage</span> <span class='ocrx_word' id='word_1_66' title='bbox 886 1644 926 1674; x_wconf 88' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_67' title='bbox 930 1644 1017 1674; x_wconf 96' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_68' title='bbox 1028 1644 1053 1674; x_wconf 98' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_69' title='bbox 1061 1654 1139 1674; x_wconf 98' lang='eng' dir='ltr'>ever</span> <span class='ocrx_word' id='word_1_70' title='bbox 1146 1644 1339 1684; x_wconf 89' lang='eng' dir='ltr'>metaphori-</span>
</span>
<span class='ocr_line' id='line_1_14' title="bbox 335 1700 1050 1732; baseline 0 0; x_size 42.906048; x_descenders 10.906048; x_ascenders 12"><span class='ocrx_word' id='word_1_71' title='bbox 335 1702 393 1732; x_wconf 91' lang='eng' dir='ltr'>cal.</span> <span class='ocrx_word' id='word_1_72' title='bbox 407 1703 475 1732; x_wconf 78' lang='eng' dir='ltr'>The</span> <span class='ocrx_word' id='word_1_73' title='bbox 487 1702 580 1732; x_wconf 92' lang='eng' dir='ltr'>word</span> <span class='ocrx_word' id='word_1_74' title='bbox 595 1700 704 1732; x_wconf 73' lang='eng' dir='ltr'>‘virus’</span> <span class='ocrx_word' id='word_1_75' title='bbox 719 1702 745 1732; x_wconf 99' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_76' title='bbox 759 1712 851 1732; x_wconf 91' lang='eng' dir='ltr'>more</span> <span class='ocrx_word' id='word_1_77' title='bbox 864 1712 896 1732; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_78' title='bbox 910 1712 942 1732; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_79' title='bbox 954 1702 1050 1732; x_wconf 89' lang='eng' dir='ltr'>virus.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_5' title="bbox 332 1760 1340 2035">
<span class='ocr_line' id='line_1_15' title="bbox 399 1760 1339 1790; baseline 0 0; x_size 40.906048; x_descenders 10.906048; x_ascenders 10"><span class='ocrx_word' id='word_1_80' title='bbox 399 1760 616 1790; x_wconf 92' lang='eng' dir='ltr'>Postmodern</span> <span class='ocrx_word' id='word_1_81' title='bbox 625 1760 754 1790; x_wconf 99' lang='eng' dir='ltr'>culture</span> <span class='ocrx_word' id='word_1_82' title='bbox 763 1770 797 1790; x_wconf 99' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_83' title='bbox 805 1770 840 1790; x_wconf 99' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_84' title='bbox 849 1760 1059 1790; x_wconf 89' lang='eng' dir='ltr'>chatters-out</span> <span class='ocrx_word' id='word_1_85' title='bbox 1066 1760 1152 1790; x_wconf 89' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_86' title='bbox 1162 1760 1246 1790; x_wconf 95' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_87' title='bbox 1254 1760 1339 1790; x_wconf 95' lang='eng' dir='ltr'>virus</span>
</span>
<span class='ocr_line' id='line_1_16' title="bbox 332 1818 1338 1848; baseline 0 0; x_size 41.996651; x_descenders 11.996653; x_ascenders 8"><span class='ocrx_word' id='word_1_88' title='bbox 332 1818 422 1848; x_wconf 91' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_89' title='bbox 438 1818 528 1848; x_wconf 91' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_90' title='bbox 544 1818 635 1848; x_wconf 92' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_91' title='bbox 653 1818 743 1848; x_wconf 92' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_92' title='bbox 760 1818 850 1848; x_wconf 92' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_93' title='bbox 867 1818 956 1848; x_wconf 92' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_94' title='bbox 972 1818 1060 1848; x_wconf 92' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_95' title='bbox 1077 1826 1338 1848; x_wconf 92' lang='eng'>0110001001001</span>
</span>
<span class='ocr_line' id='line_1_17' title="bbox 334 1874 1338 1919; baseline 0.001 -14; x_size 43.996651; x_descenders 11.996653; x_ascenders 10"><span class='ocrx_word' id='word_1_96' title='bbox 334 1884 970 1907; x_wconf 99' lang='eng'>011010010010110010010010010010</span> <span class='ocrx_word' id='word_1_97' title='bbox 989 1874 1097 1906; x_wconf 87' lang='eng' dir='ltr'>‘virus’</span> <span class='ocrx_word' id='word_1_98' title='bbox 1119 1875 1338 1919; x_wconf 79' lang='eng' dir='ltr'>(viroductile,</span>
</span>
<span class='ocr_line' id='line_1_18' title="bbox 332 1934 1340 1975; baseline 0 -11; x_size 36; x_descenders 6; x_ascenders 10"><span class='ocrx_word' id='word_1_99' title='bbox 332 1934 511 1975; x_wconf 79' lang='eng' dir='ltr'>virogenic,</span> <span class='ocrx_word' id='word_1_100' title='bbox 529 1934 885 1974; x_wconf 98' lang='eng' dir='ltr'>immunosuppressor</span> <span class='ocrx_word' id='word_1_101' title='bbox 898 1934 968 1964; x_wconf 98' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_102' title='bbox 983 1934 1047 1964; x_wconf 98' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_103' title='bbox 1064 1944 1109 1970; x_wconf 79' lang='eng' dir='ltr'>or,</span> <span class='ocrx_word' id='word_1_104' title='bbox 1128 1940 1233 1970; x_wconf 79' lang='eng' dir='ltr'>meta-,</span> <span class='ocrx_word' id='word_1_105' title='bbox 1248 1944 1285 1964; x_wconf 90' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_106' title='bbox 1300 1944 1340 1964; x_wconf 97' lang='eng' dir='ltr'>or</span>
</span>
<span class='ocr_line' id='line_1_19' title="bbox 334 1991 710 2035; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_107' title='bbox 334 1993 402 2023; x_wconf 98' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_108' title='bbox 414 2003 452 2023; x_wconf 99' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_109' title='bbox 464 1991 595 2035; x_wconf 88' lang='eng' dir='ltr'>hyper-)</span> <span class='ocrx_word' id='word_1_110' title='bbox 609 1993 710 2023; x_wconf 92' lang='eng' dir='ltr'>virus.</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_3' title="bbox 813 2115 873 2138">
<p class='ocr_par' dir='ltr' id='par_1_6' title="bbox 813 2115 873 2138">
<span class='ocr_line' id='line_1_20' title="bbox 813 2115 873 2138; baseline 0 0; x_size 31.333334; x_descenders 7.8333335; x_ascenders 7.8333335"><span class='ocrx_word' id='word_1_111' title='bbox 813 2115 873 2138; x_wconf 84' lang='eng'>383</span>
</span>
</p>
</div>
</div>
<script type="text/javascript">
$( function() {
$( ".draggable" ).draggable();
} );
//store all class 'ocr_line' in 'lines'
var lines = document.querySelectorAll(".ocr_line");
//loop through each element in 'lines'
for (var i = 0; i < lines.length; i++){
var line = lines[i];
var words = line.querySelectorAll(".ocrx_word");
for (var e = 0; e < words.length; e++){
var span = words[e];
span.classList.add("draggable");
}
}
</script>
</body>
</html>

103
hypervirus/2.html
Unescape Escape View File

@ -0,0 +1,103 @@
<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
<head>
<title></title>
<meta http-equiv="Content-Type" content="text/html;charset=utf-8" />
<meta name='ocr-system' content='tesseract 3.04.01' />
<meta name='ocr-capabilities' content='ocr_page ocr_carea ocr_par ocr_line ocrx_word'/>
</head>
<body>
<div class='ocr_page' id='page_1' title='image "hypervirus-02.tif"; bbox 0 0 1749 2481; ppageno 0'>
<div class='ocr_carea' id='block_1_1' title="bbox 733 382 1070 402">
<p class='ocr_par' dir='ltr' id='par_1_1' title="bbox 733 382 1070 402">
<span class='ocr_line' id='line_1_1' title="bbox 733 382 1070 402; baseline 0 0; x_size 27.277779; x_descenders 6.8194447; x_ascenders 6.8194447"><span class='ocrx_word' id='word_1_1' title='bbox 733 382 874 402; x_wconf 88' lang='eng' dir='ltr'><strong>FANGED</strong></span> <span class='ocrx_word' id='word_1_2' title='bbox 892 382 1070 402; x_wconf 88' lang='eng' dir='ltr'><strong>NOUMENA</strong></span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_2' title="bbox 398 490 1414 2048">
<p class='ocr_par' dir='ltr' id='par_1_2' title="bbox 398 490 1410 589">
<span class='ocr_line' id='line_1_2' title="bbox 398 490 1410 531; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 9"><span class='ocrx_word' id='word_1_3' title='bbox 398 499 988 520; x_wconf 92' lang='eng'>10110010010011101100001001001.</span> <span class='ocrx_word' id='word_1_4' title='bbox 1000 490 1192 531; x_wconf 95' lang='eng' dir='ltr'>hypervirus</span> <span class='ocrx_word' id='word_1_5' title='bbox 1201 496 1269 520; x_wconf 94' lang='eng' dir='ltr'>eats</span> <span class='ocrx_word' id='word_1_6' title='bbox 1282 490 1333 520; x_wconf 99' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_7' title='bbox 1343 490 1410 520; x_wconf 85' lang='eng' dir='ltr'>end</span>
</span>
<span class='ocr_line' id='line_1_3' title="bbox 398 548 569 589; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_8' title='bbox 398 548 436 578; x_wconf 87' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_9' title='bbox 447 548 569 589; x_wconf 85' lang='eng' dir='ltr'>history</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_3' title="bbox 398 614 1411 1042">
<span class='ocr_line' id='line_1_4' title="bbox 461 614 1410 635; baseline 0 0; x_size 42.506748; x_descenders 11.454874; x_ascenders 10.48415"><span class='ocrx_word' id='word_1_10' title='bbox 461 614 1410 635; x_wconf 93' lang='eng'>0010010010001011110100001001101010101010101000</span>
</span>
<span class='ocr_line' id='line_1_5' title="bbox 399 673 1409 694; baseline 0 0; x_size 42.506748; x_descenders 11.454874; x_ascenders 10.48415"><span class='ocrx_word' id='word_1_11' title='bbox 399 673 1409 694; x_wconf 93' lang='eng'>10011010100100101001001010010110100100101111010001</span>
</span>
<span class='ocr_line' id='line_1_6' title="bbox 398 731 1410 752; baseline 0 0; x_size 42.506748; x_descenders 11.454874; x_ascenders 10.48415"><span class='ocrx_word' id='word_1_12' title='bbox 398 731 1410 752; x_wconf 93' lang='eng'>0101010101010100101010010101101010010000001000101</span>
</span>
<span class='ocr_line' id='line_1_7' title="bbox 399 789 1410 810; baseline 0 0; x_size 42.506748; x_descenders 11.454874; x_ascenders 10.48415"><span class='ocrx_word' id='word_1_13' title='bbox 399 789 1410 810; x_wconf 93' lang='eng'>1101010010010101001010010010101010010001001001001</span>
</span>
<span class='ocr_line' id='line_1_8' title="bbox 398 847 1409 868; baseline 0 0; x_size 42.506748; x_descenders 11.454874; x_ascenders 10.48415"><span class='ocrx_word' id='word_1_14' title='bbox 398 847 1409 868; x_wconf 93' lang='eng'>00100100101001001010110101001001001010110101010101</span>
</span>
<span class='ocr_line' id='line_1_9' title="bbox 398 905 1411 926; baseline 0 0; x_size 42.506748; x_descenders 11.454874; x_ascenders 10.48415"><span class='ocrx_word' id='word_1_15' title='bbox 398 905 1411 926; x_wconf 93' lang='eng'>010111101000010011010101010101000100110110101010100</span>
</span>
<span class='ocr_line' id='line_1_10' title="bbox 401 962 1410 984; baseline 0 0; x_size 42.506748; x_descenders 11.454874; x_ascenders 10.48415"><span class='ocrx_word' id='word_1_16' title='bbox 401 962 1410 984; x_wconf 86' lang='eng'>11001000100010101011101000010101100101001010001100</span>
</span>
<span class='ocr_line' id='line_1_11' title="bbox 400 1021 1408 1042; baseline 0 0; x_size 42.506748; x_descenders 11.454874; x_ascenders 10.48415"><span class='ocrx_word' id='word_1_17' title='bbox 400 1021 1408 1042; x_wconf 93' lang='eng'>1001110010001000000000000100111111100010010010101</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_4' title="bbox 399 1069 1411 1462">
<span class='ocr_line' id='line_1_12' title="bbox 461 1069 1411 1113; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 11"><span class='ocrx_word' id='word_1_18' title='bbox 461 1080 745 1101; x_wconf 94' lang='eng'>0101000010000</span> <span class='ocrx_word' id='word_1_19' title='bbox 768 1069 950 1113; x_wconf 87' lang='eng' dir='ltr'>K-(coding</span> <span class='ocrx_word' id='word_1_20' title='bbox 969 1071 1021 1101; x_wconf 91' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_21' title='bbox 1039 1069 1299 1113; x_wconf 91' lang='eng' dir='ltr'>cyber)positive</span> <span class='ocrx_word' id='word_1_22' title='bbox 1317 1081 1411 1111; x_wconf 91' lang='eng' dir='ltr'>proc-</span>
</span>
<span class='ocr_line' id='line_1_13' title="bbox 399 1128 1410 1169; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_23' title='bbox 399 1138 484 1158; x_wconf 95' lang='eng' dir='ltr'>esses</span> <span class='ocrx_word' id='word_1_24' title='bbox 499 1128 745 1169; x_wconf 91' lang='eng' dir='ltr'>auto-intensify</span> <span class='ocrx_word' id='word_1_25' title='bbox 759 1128 804 1169; x_wconf 89' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_26' title='bbox 817 1128 1004 1169; x_wconf 85' lang='eng' dir='ltr'>occurring.</span> <span class='ocrx_word' id='word_1_27' title='bbox 1019 1129 1049 1158; x_wconf 93' lang='eng' dir='ltr'><strong>A</strong></span> <span class='ocrx_word' id='word_1_28' title='bbox 1062 1128 1202 1158; x_wconf 85' lang='eng' dir='ltr'>cultural</span> <span class='ocrx_word' id='word_1_29' title='bbox 1218 1128 1369 1168; x_wconf 89' lang='eng' dir='ltr'>example</span> <span class='ocrx_word' id='word_1_30' title='bbox 1385 1128 1410 1158; x_wconf 90' lang='eng' dir='ltr'>is</span>
</span>
<span class='ocr_line' id='line_1_14' title="bbox 401 1187 1410 1228; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_31' title='bbox 401 1187 496 1228; x_wconf 89' lang='eng' dir='ltr'>hype:</span> <span class='ocrx_word' id='word_1_32' title='bbox 509 1187 666 1228; x_wconf 85' lang='eng' dir='ltr'>products</span> <span class='ocrx_word' id='word_1_33' title='bbox 680 1187 750 1217; x_wconf 91' lang='eng' dir='ltr'>that</span> <span class='ocrx_word' id='word_1_34' title='bbox 759 1188 816 1217; x_wconf 89' lang='eng' dir='ltr'>AT</span> <span class='ocrx_word' id='word_1_35' title='bbox 825 1188 882 1217; x_wconf 89' lang='eng' dir='ltr'>AT</span> <span class='ocrx_word' id='word_1_36' title='bbox 894 1187 987 1217; x_wconf 94' lang='eng' dir='ltr'>trade</span> <span class='ocrx_word' id='word_1_37' title='bbox 999 1197 1045 1217; x_wconf 99' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_38' title='bbox 1057 1187 1145 1217; x_wconf 92' lang='eng' dir='ltr'>what</span> <span class='ocrx_word' id='word_1_39' title='bbox 1157 1187 1233 1228; x_wconf 89' lang='eng' dir='ltr'>they</span> <span class='ocrx_word' id='word_1_40' title='bbox 1245 1187 1309 1217; x_wconf 89' lang='eng' dir='ltr'>will</span> <span class='ocrx_word' id='word_1_41' title='bbox 1322 1187 1364 1217; x_wconf 93' lang='eng' dir='ltr'>be</span> <span class='ocrx_word' id='word_1_42' title='bbox 1376 1187 1410 1217; x_wconf 97' lang='eng' dir='ltr'>in</span>
</span>
<span class='ocr_line' id='line_1_15' title="bbox 401 1245 1410 1282; baseline 0 -7; x_size 37; x_descenders 7; x_ascenders 10"><span class='ocrx_word' id='word_1_43' title='bbox 401 1245 454 1275; x_wconf 99' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_44' title='bbox 467 1245 584 1282; x_wconf 87' lang='eng' dir='ltr'>future,</span> <span class='ocrx_word' id='word_1_45' title='bbox 596 1245 645 1275; x_wconf 98' lang='eng' dir='ltr'>vir</span> <span class='ocrx_word' id='word_1_46' title='bbox 653 1245 775 1275; x_wconf 92' lang='eng' dir='ltr'>virtual</span> <span class='ocrx_word' id='word_1_47' title='bbox 787 1245 920 1275; x_wconf 90' lang='eng' dir='ltr'>fashion</span> <span class='ocrx_word' id='word_1_48' title='bbox 933 1255 978 1275; x_wconf 99' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_49' title='bbox 991 1245 1047 1282; x_wconf 82' lang='eng' dir='ltr'>off,</span> <span class='ocrx_word' id='word_1_50' title='bbox 1062 1245 1236 1275; x_wconf 91' lang='eng' dir='ltr'>imminent</span> <span class='ocrx_word' id='word_1_51' title='bbox 1249 1245 1410 1276; x_wconf 91' lang='eng' dir='ltr'>technical</span>
</span>
<span class='ocr_line' id='line_1_16' title="bbox 400 1303 1409 1344; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_52' title='bbox 400 1303 581 1340; x_wconf 89' lang='eng' dir='ltr'>standards,</span> <span class='ocrx_word' id='word_1_53' title='bbox 590 1303 821 1344; x_wconf 86' lang='eng' dir='ltr'>self-fulfilling</span> <span class='ocrx_word' id='word_1_54' title='bbox 830 1303 1027 1343; x_wconf 91' lang='eng' dir='ltr'>prophecies</span> <span class='ocrx_word' id='word_1_55' title='bbox 1038 1303 1105 1333; x_wconf 99' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_56' title='bbox 1114 1303 1181 1333; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_57' title='bbox 1190 1313 1229 1333; x_wconf 98' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_58' title='bbox 1237 1303 1303 1333; x_wconf 99' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_59' title='bbox 1313 1303 1409 1333; x_wconf 86' lang='eng' dir='ltr'>artifi-</span>
</span>
<span class='ocr_line' id='line_1_17' title="bbox 400 1362 1410 1403; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_60' title='bbox 400 1362 459 1393; x_wconf 89' lang='eng' dir='ltr'>cial</span> <span class='ocrx_word' id='word_1_61' title='bbox 468 1362 628 1392; x_wconf 88' lang='eng' dir='ltr'>destinies.</span> <span class='ocrx_word' id='word_1_62' title='bbox 637 1362 863 1403; x_wconf 85' lang='eng' dir='ltr'>Anticipating</span> <span class='ocrx_word' id='word_1_63' title='bbox 871 1372 889 1392; x_wconf 99' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_64' title='bbox 901 1362 995 1392; x_wconf 99' lang='eng' dir='ltr'>trend</span> <span class='ocrx_word' id='word_1_65' title='bbox 1004 1362 1069 1392; x_wconf 99' lang='eng' dir='ltr'>end</span> <span class='ocrx_word' id='word_1_66' title='bbox 1079 1362 1144 1392; x_wconf 92' lang='eng' dir='ltr'>end</span> <span class='ocrx_word' id='word_1_67' title='bbox 1153 1362 1315 1392; x_wconf 93' lang='eng' dir='ltr'>endACC</span> <span class='ocrx_word' id='word_1_68' title='bbox 1322 1362 1410 1392; x_wconf 93' lang='eng' dir='ltr'>ACC</span>
</span>
<span class='ocr_line' id='line_1_18' title="bbox 400 1418 1373 1462; baseline 0 -12; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_69' title='bbox 400 1420 589 1451; x_wconf 91' lang='eng' dir='ltr'>accelerates</span> <span class='ocrx_word' id='word_1_70' title='bbox 602 1420 625 1450; x_wconf 91' lang='eng' dir='ltr'>it</span> <span class='ocrx_word' id='word_1_71' title='bbox 640 1419 763 1462; x_wconf 85' lang='eng' dir='ltr'>(which</span> <span class='ocrx_word' id='word_1_72' title='bbox 777 1420 802 1450; x_wconf 98' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_73' title='bbox 815 1420 849 1450; x_wconf 97' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_74' title='bbox 863 1420 955 1450; x_wconf 82' lang='eng' dir='ltr'>itself</span> <span class='ocrx_word' id='word_1_75' title='bbox 964 1430 982 1450; x_wconf 99' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_76' title='bbox 996 1430 1029 1450; x_wconf 99' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_77' title='bbox 1042 1430 1075 1450; x_wconf 99' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_78' title='bbox 1090 1420 1250 1450; x_wconf 89' lang='eng' dir='ltr'>recursive</span> <span class='ocrx_word' id='word_1_79' title='bbox 1264 1418 1373 1462; x_wconf 90' lang='eng' dir='ltr'>trend)</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_5' title="bbox 400 1479 1412 1637">
<span class='ocr_line' id='line_1_19' title="bbox 462 1479 1411 1520; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_80' title='bbox 462 1479 600 1520; x_wconf 94' lang='eng' dir='ltr'>Hyping</span> <span class='ocrx_word' id='word_1_81' title='bbox 615 1479 776 1519; x_wconf 91' lang='eng' dir='ltr'>collapses</span> <span class='ocrx_word' id='word_1_82' title='bbox 796 1488 831 1509; x_wconf 87' lang='eng' dir='ltr'>SF</span> <span class='ocrx_word' id='word_1_83' title='bbox 853 1479 923 1509; x_wconf 97' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_84' title='bbox 944 1479 1055 1509; x_wconf 93' lang='eng' dir='ltr'>CATA</span> <span class='ocrx_word' id='word_1_85' title='bbox 1072 1479 1183 1509; x_wconf 93' lang='eng' dir='ltr'>CATA</span> <span class='ocrx_word' id='word_1_86' title='bbox 1199 1479 1350 1520; x_wconf 89' lang='eng' dir='ltr'>catalytic</span> <span class='ocrx_word' id='word_1_87' title='bbox 1369 1479 1411 1509; x_wconf 91' lang='eng' dir='ltr'>tic</span>
</span>
<span class='ocr_line' id='line_1_20' title="bbox 400 1537 1412 1578; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_88' title='bbox 400 1537 570 1578; x_wconf 83' lang='eng' dir='ltr'>efficiency,</span> <span class='ocrx_word' id='word_1_89' title='bbox 580 1537 759 1578; x_wconf 94' lang='eng' dir='ltr'>re-routing</span> <span class='ocrx_word' id='word_1_90' title='bbox 768 1543 948 1567; x_wconf 99' lang='eng' dir='ltr'>tomorrow</span> <span class='ocrx_word' id='word_1_91' title='bbox 958 1537 1103 1578; x_wconf 85' lang='eng' dir='ltr'>through</span> <span class='ocrx_word' id='word_1_92' title='bbox 1110 1537 1199 1567; x_wconf 99' lang='eng' dir='ltr'>what</span> <span class='ocrx_word' id='word_1_93' title='bbox 1208 1537 1248 1567; x_wconf 97' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_94' title='bbox 1256 1543 1412 1577; x_wconf 91' lang='eng' dir='ltr'>prospect</span>
</span>
<span class='ocr_line' id='line_1_21' title="bbox 401 1596 838 1637; baseline -0.002 -10; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_95' title='bbox 401 1597 457 1627; x_wconf 89' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_96' title='bbox 468 1596 527 1626; x_wconf 89' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_97' title='bbox 536 1596 596 1626; x_wconf 89' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_98' title='bbox 604 1596 719 1626; x_wconf 88' lang='eng' dir='ltr'>makes</span> <span class='ocrx_word' id='word_1_99' title='bbox 732 1596 838 1637; x_wconf 88' lang='eng' dir='ltr'>today.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_6' title="bbox 459 1654 1408 1695">
<span class='ocr_line' id='line_1_22' title="bbox 459 1654 1408 1695; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_100' title='bbox 459 1654 662 1695; x_wconf 93' lang='eng' dir='ltr'>Virohyping</span> <span class='ocrx_word' id='word_1_101' title='bbox 674 1664 799 1694; x_wconf 98' lang='eng' dir='ltr'>sweeps</span> <span class='ocrx_word' id='word_1_102' title='bbox 812 1654 959 1695; x_wconf 98' lang='eng' dir='ltr'>through</span> <span class='ocrx_word' id='word_1_103' title='bbox 973 1654 1028 1684; x_wconf 99' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_104' title='bbox 1040 1654 1242 1695; x_wconf 93' lang='eng' dir='ltr'>advertising</span> <span class='ocrx_word' id='word_1_105' title='bbox 1253 1654 1408 1695; x_wconf 97' lang='eng' dir='ltr'>industry.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_7' title="bbox 464 1712 928 1753">
<span class='ocr_line' id='line_1_23' title="bbox 464 1712 928 1753; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_106' title='bbox 464 1713 628 1753; x_wconf 90' lang='eng' dir='ltr'>Everyone</span> <span class='ocrx_word' id='word_1_107' title='bbox 641 1712 705 1742; x_wconf 95' lang='eng' dir='ltr'>will</span> <span class='ocrx_word' id='word_1_108' title='bbox 719 1712 761 1742; x_wconf 93' lang='eng' dir='ltr'>be</span> <span class='ocrx_word' id='word_1_109' title='bbox 774 1712 882 1753; x_wconf 97' lang='eng' dir='ltr'>doing</span> <span class='ocrx_word' id='word_1_110' title='bbox 894 1712 928 1742; x_wconf 87' lang='eng' dir='ltr'>it.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_8' title="bbox 400 1771 1414 2048">
<span class='ocr_line' id='line_1_24' title="bbox 460 1771 1412 1812; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_111' title='bbox 460 1771 553 1801; x_wconf 93' lang='eng' dir='ltr'>Virus</span> <span class='ocrx_word' id='word_1_112' title='bbox 569 1771 596 1801; x_wconf 98' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_113' title='bbox 611 1771 765 1811; x_wconf 91' lang='eng' dir='ltr'>parasitic</span> <span class='ocrx_word' id='word_1_114' title='bbox 782 1771 825 1801; x_wconf 91' lang='eng' dir='ltr'>tic</span> <span class='ocrx_word' id='word_1_115' title='bbox 842 1771 1021 1811; x_wconf 91' lang='eng' dir='ltr'>replicator</span> <span class='ocrx_word' id='word_1_116' title='bbox 1037 1771 1133 1801; x_wconf 90' lang='eng' dir='ltr'>code:</span> <span class='ocrx_word' id='word_1_117' title='bbox 1151 1781 1193 1801; x_wconf 99' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_118' title='bbox 1210 1771 1412 1812; x_wconf 90' lang='eng' dir='ltr'>asignifying</span>
</span>
<span class='ocr_line' id='line_1_25' title="bbox 401 1829 1410 1869; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_119' title='bbox 401 1839 561 1869; x_wconf 91' lang='eng' dir='ltr'>sequence</span> <span class='ocrx_word' id='word_1_120' title='bbox 575 1829 612 1859; x_wconf 90' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_121' title='bbox 623 1829 787 1859; x_wconf 91' lang='eng' dir='ltr'>machinic</span> <span class='ocrx_word' id='word_1_122' title='bbox 802 1829 878 1859; x_wconf 99' lang='eng' dir='ltr'>data</span> <span class='ocrx_word' id='word_1_123' title='bbox 891 1829 975 1859; x_wconf 91' lang='eng' dir='ltr'>ATA</span> <span class='ocrx_word' id='word_1_124' title='bbox 987 1830 1070 1859; x_wconf 92' lang='eng' dir='ltr'>ATA</span> <span class='ocrx_word' id='word_1_125' title='bbox 1085 1829 1275 1859; x_wconf 88' lang='eng' dir='ltr'>flow-break</span> <span class='ocrx_word' id='word_1_126' title='bbox 1288 1829 1410 1867; x_wconf 84' lang='eng' dir='ltr'>on/off,</span>
</span>
<span class='ocr_line' id='line_1_26' title="bbox 402 1889 1414 1930; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_127' title='bbox 402 1889 464 1927; x_wconf 93' lang='eng'>1/0,</span> <span class='ocrx_word' id='word_1_128' title='bbox 479 1889 639 1930; x_wconf 96' lang='eng' dir='ltr'>yang/yin</span> <span class='ocrx_word' id='word_1_129' title='bbox 655 1889 869 1930; x_wconf 91' lang='eng' dir='ltr'>intrinsically</span> <span class='ocrx_word' id='word_1_130' title='bbox 884 1889 1039 1919; x_wconf 97' lang='eng' dir='ltr'>destined</span> <span class='ocrx_word' id='word_1_131' title='bbox 1055 1889 1108 1919; x_wconf 90' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_132' title='bbox 1122 1899 1193 1919; x_wconf 87' lang='eng' dir='ltr'>war.</span> <span class='ocrx_word' id='word_1_133' title='bbox 1212 1890 1251 1919; x_wconf 93' lang='eng' dir='ltr'>In</span> <span class='ocrx_word' id='word_1_134' title='bbox 1266 1889 1359 1929; x_wconf 91' lang='eng' dir='ltr'>place</span> <span class='ocrx_word' id='word_1_135' title='bbox 1375 1889 1414 1919; x_wconf 90' lang='eng' dir='ltr'>of</span>
</span>
<span class='ocr_line' id='line_1_27' title="bbox 400 1947 1411 1988; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_136' title='bbox 400 1957 486 1977; x_wconf 92' lang='eng' dir='ltr'>mess</span> <span class='ocrx_word' id='word_1_137' title='bbox 501 1953 798 1988; x_wconf 91' lang='eng' dir='ltr'>message-content</span> <span class='ocrx_word' id='word_1_138' title='bbox 813 1947 964 1977; x_wconf 98' lang='eng' dir='ltr'>virodata</span> <span class='ocrx_word' id='word_1_139' title='bbox 982 1947 1009 1977; x_wconf 98' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_140' title='bbox 1026 1947 1212 1977; x_wconf 94' lang='eng' dir='ltr'>assembled</span> <span class='ocrx_word' id='word_1_141' title='bbox 1228 1947 1309 1977; x_wconf 95' lang='eng' dir='ltr'>bled</span> <span class='ocrx_word' id='word_1_142' title='bbox 1324 1947 1411 1977; x_wconf 90' lang='eng' dir='ltr'>from</span>
</span>
<span class='ocr_line' id='line_1_28' title="bbox 402 2004 1412 2048; baseline 0 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_143' title='bbox 402 2004 597 2047; x_wconf 85' lang='eng' dir='ltr'>asignifying</span> <span class='ocrx_word' id='word_1_144' title='bbox 610 2006 773 2036; x_wconf 95' lang='eng' dir='ltr'>materials</span> <span class='ocrx_word' id='word_1_145' title='bbox 788 2006 864 2036; x_wconf 97' lang='eng' dir='ltr'>with</span> <span class='ocrx_word' id='word_1_146' title='bbox 880 2006 993 2037; x_wconf 91' lang='eng' dir='ltr'>CATA</span> <span class='ocrx_word' id='word_1_147' title='bbox 1005 2006 1155 2047; x_wconf 91' lang='eng' dir='ltr'>catalytic</span> <span class='ocrx_word' id='word_1_148' title='bbox 1173 2004 1222 2048; x_wconf 93' lang='eng' dir='ltr'>(or</span> <span class='ocrx_word' id='word_1_149' title='bbox 1236 2006 1412 2047; x_wconf 97' lang='eng' dir='ltr'>positively</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_3' title="bbox 872 2130 935 2153">
<p class='ocr_par' dir='ltr' id='par_1_9' title="bbox 872 2130 935 2153">
<span class='ocr_line' id='line_1_29' title="bbox 872 2130 935 2153; baseline 0 0; x_size 31; x_descenders 7.75; x_ascenders 7.75"><span class='ocrx_word' id='word_1_150' title='bbox 872 2130 935 2153; x_wconf 84' lang='eng'>384</span>
</span>
</p>
</div>
</div>
</body>
</html>

94
hypervirus/3.html
Unescape Escape View File

@ -0,0 +1,94 @@
<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
<head>
<title></title>
<meta http-equiv="Content-Type" content="text/html;charset=utf-8" />
<meta name='ocr-system' content='tesseract 3.04.01' />
<meta name='ocr-capabilities' content='ocr_page ocr_carea ocr_par ocr_line ocrx_word'/>
</head>
<body>
<div class='ocr_page' id='page_1' title='image "hypervirus-03.tif"; bbox 0 0 1749 2481; ppageno 0'>
<div class='ocr_carea' id='block_1_1' title="bbox 733 371 950 392">
<p class='ocr_par' dir='ltr' id='par_1_1' title="bbox 733 371 950 392">
<span class='ocr_line' id='line_1_1' title="bbox 733 371 950 392; baseline 0 0; x_size 27.333334; x_descenders 6.8333335; x_ascenders 6.8333335"><span class='ocrx_word' id='word_1_1' title='bbox 733 371 950 392; x_wconf 84' lang='eng' dir='ltr'><strong>HYPERVIRUS</strong></span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_2' title="bbox 332 477 1343 2025">
<p class='ocr_par' dir='ltr' id='par_1_2' title="bbox 333 477 1343 755">
<span class='ocr_line' id='line_1_2' title="bbox 333 477 1343 521; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_2' title='bbox 333 477 646 521; x_wconf 85' lang='eng' dir='ltr'>disproportionate)</span> <span class='ocrx_word' id='word_1_3' title='bbox 657 479 831 519; x_wconf 80' lang='eng' dir='ltr'>efficiency:</span> <span class='ocrx_word' id='word_1_4' title='bbox 842 479 987 509; x_wconf 85' lang='eng' dir='ltr'>intruder</span> <span class='ocrx_word' id='word_1_5' title='bbox 994 479 1162 519; x_wconf 98' lang='eng' dir='ltr'>passcode,</span> <span class='ocrx_word' id='word_1_6' title='bbox 1172 479 1343 509; x_wconf 90' lang='eng' dir='ltr'>locational</span>
</span>
<span class='ocr_line' id='line_1_3' title="bbox 334 537 1342 578; baseline 0 -11; x_size 37; x_descenders 7; x_ascenders 10"><span class='ocrx_word' id='word_1_7' title='bbox 334 537 495 574; x_wconf 83' lang='eng' dir='ltr'>ZIP-code,</span> <span class='ocrx_word' id='word_1_8' title='bbox 509 537 799 578; x_wconf 95' lang='eng' dir='ltr'>pseudogenomic</span> <span class='ocrx_word' id='word_1_9' title='bbox 813 537 991 567; x_wconf 89' lang='eng' dir='ltr'>substitute</span> <span class='ocrx_word' id='word_1_10' title='bbox 1005 537 1226 574; x_wconf 86' lang='eng' dir='ltr'>instructions,</span> <span class='ocrx_word' id='word_1_11' title='bbox 1242 543 1342 567; x_wconf 92' lang='eng' dir='ltr'>muta-</span>
</span>
<span class='ocr_line' id='line_1_4' title="bbox 334 594 1342 639; baseline 0.003 -13; x_size 43; x_descenders 11; x_ascenders 12"><span class='ocrx_word' id='word_1_12' title='bbox 334 596 437 631; x_wconf 86' lang='eng' dir='ltr'>tional</span> <span class='ocrx_word' id='word_1_13' title='bbox 444 596 532 637; x_wconf 86' lang='eng' dir='ltr'>junk</span> <span class='ocrx_word' id='word_1_14' title='bbox 545 594 718 639; x_wconf 90' lang='eng' dir='ltr'>(complex</span> <span class='ocrx_word' id='word_1_15' title='bbox 729 596 790 626; x_wconf 95' lang='eng' dir='ltr'>but</span> <span class='ocrx_word' id='word_1_16' title='bbox 803 596 906 626; x_wconf 99' lang='eng' dir='ltr'>latent</span> <span class='ocrx_word' id='word_1_17' title='bbox 918 594 1109 638; x_wconf 86' lang='eng' dir='ltr'>segments),</span> <span class='ocrx_word' id='word_1_18' title='bbox 1123 596 1189 626; x_wconf 99' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_19' title='bbox 1200 598 1342 639; x_wconf 85' lang='eng' dir='ltr'>garbage</span>
</span>
<span class='ocr_line' id='line_1_5' title="bbox 334 652 1342 697; baseline 0 -13; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_20' title='bbox 334 652 547 697; x_wconf 92' lang='eng' dir='ltr'>(redundant</span> <span class='ocrx_word' id='word_1_21' title='bbox 566 664 1342 694; x_wconf 93' lang='eng' dir='ltr'>scrapcrapcrapcrapcrapcrapcrapcrapcrap-</span>
</span>
<span class='ocr_line' id='line_1_6' title="bbox 333 711 683 755; baseline 0 -12; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_22' title='bbox 333 711 683 755; x_wconf 95' lang='eng' dir='ltr'>crapcrapcrapcrap).</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_3' title="bbox 332 771 1343 1163">
<span class='ocr_line' id='line_1_7' title="bbox 398 771 1343 812; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_23' title='bbox 398 771 547 801; x_wconf 93' lang='eng' dir='ltr'>Biovirus</span> <span class='ocrx_word' id='word_1_24' title='bbox 561 771 621 801; x_wconf 90' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_25' title='bbox 630 771 691 801; x_wconf 91' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_26' title='bbox 699 771 760 801; x_wconf 91' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_27' title='bbox 774 777 893 812; x_wconf 98' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_28' title='bbox 910 771 1101 812; x_wconf 86' lang='eng' dir='ltr'>organisms,</span> <span class='ocrx_word' id='word_1_29' title='bbox 1120 771 1262 812; x_wconf 82' lang='eng' dir='ltr'>hacking</span> <span class='ocrx_word' id='word_1_30' title='bbox 1274 771 1343 801; x_wconf 92' lang='eng' dir='ltr'>and</span>
</span>
<span class='ocr_line' id='line_1_8' title="bbox 333 829 1343 870; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_31' title='bbox 333 829 616 870; x_wconf 98' lang='eng' dir='ltr'>reprogramming</span> <span class='ocrx_word' id='word_1_32' title='bbox 622 829 1343 859; x_wconf 67' lang='eng' dir='ltr'><strong>ATGAmATCCACGGTACATFCAGT</strong></span>
</span>
<span class='ocr_line' id='line_1_9' title="bbox 333 887 1341 927; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_33' title='bbox 333 887 467 917; x_wconf 95' lang='eng' dir='ltr'>cellular</span> <span class='ocrx_word' id='word_1_34' title='bbox 477 896 553 917; x_wconf 89' lang='eng' dir='ltr'>DNA</span> <span class='ocrx_word' id='word_1_35' title='bbox 567 893 599 917; x_wconf 99' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_36' title='bbox 609 887 759 927; x_wconf 94' lang='eng' dir='ltr'>produce</span> <span class='ocrx_word' id='word_1_37' title='bbox 770 897 862 917; x_wconf 99' lang='eng' dir='ltr'>more</span> <span class='ocrx_word' id='word_1_38' title='bbox 871 887 959 917; x_wconf 93' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_39' title='bbox 969 887 1054 917; x_wconf 93' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_40' title='bbox 1064 887 1151 917; x_wconf 94' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_41' title='bbox 1160 887 1246 917; x_wconf 95' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_42' title='bbox 1255 887 1341 917; x_wconf 94' lang='eng' dir='ltr'>virus</span>
</span>
<span class='ocr_line' id='line_1_10' title="bbox 333 946 1340 986; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_43' title='bbox 333 946 420 976; x_wconf 94' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_44' title='bbox 434 946 522 976; x_wconf 95' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_45' title='bbox 538 946 635 976; x_wconf 92' lang='eng' dir='ltr'>virus.</span> <span class='ocrx_word' id='word_1_46' title='bbox 655 947 701 976; x_wconf 95' lang='eng' dir='ltr'>Its</span> <span class='ocrx_word' id='word_1_47' title='bbox 715 946 864 986; x_wconf 94' lang='eng' dir='ltr'>enzymic</span> <span class='ocrx_word' id='word_1_48' title='bbox 880 946 1102 986; x_wconf 94' lang='eng' dir='ltr'>cut-and-past</span> <span class='ocrx_word' id='word_1_49' title='bbox 1116 946 1340 976; x_wconf 92' lang='eng' dir='ltr'>recombinant</span>
</span>
<span class='ocr_line' id='line_1_11' title="bbox 332 1005 1340 1046; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_50' title='bbox 332 1005 653 1046; x_wconf 90' lang='eng' dir='ltr'>wetware-splicing</span> <span class='ocrx_word' id='word_1_51' title='bbox 674 1015 804 1035; x_wconf 98' lang='eng' dir='ltr'>crosses</span> <span class='ocrx_word' id='word_1_52' title='bbox 827 1005 1029 1046; x_wconf 92' lang='eng' dir='ltr'>singularity</span> <span class='ocrx_word' id='word_1_53' title='bbox 1049 1005 1148 1035; x_wconf 91' lang='eng' dir='ltr'>when</span> <span class='ocrx_word' id='word_1_54' title='bbox 1170 1005 1340 1035; x_wconf 98' lang='eng' dir='ltr'>retroviral</span>
</span>
<span class='ocr_line' id='line_1_12' title="bbox 333 1061 1339 1106; baseline 0 -13; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_55' title='bbox 333 1063 698 1103; x_wconf 94' lang='eng' dir='ltr'>reverse-transcriptase</span> <span class='ocrx_word' id='word_1_56' title='bbox 708 1063 807 1093; x_wconf 92' lang='eng' dir='ltr'>clicks</span> <span class='ocrx_word' id='word_1_57' title='bbox 816 1063 851 1093; x_wconf 99' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_58' title='bbox 862 1061 1032 1106; x_wconf 91' lang='eng' dir='ltr'>(enabling</span> <span class='ocrx_word' id='word_1_59' title='bbox 1040 1063 1246 1104; x_wconf 98' lang='eng' dir='ltr'>ontogenetic</span> <span class='ocrx_word' id='word_1_60' title='bbox 1256 1072 1339 1093; x_wconf 91' lang='eng' dir='ltr'><strong>DNA-</strong></span>
</span>
<span class='ocr_line' id='line_1_13' title="bbox 335 1119 1162 1163; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_61' title='bbox 335 1130 408 1151; x_wconf 90' lang='eng' dir='ltr'>RNA</span> <span class='ocrx_word' id='word_1_62' title='bbox 421 1121 574 1161; x_wconf 92' lang='eng' dir='ltr'>circuitry</span> <span class='ocrx_word' id='word_1_63' title='bbox 586 1121 655 1151; x_wconf 98' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_64' title='bbox 667 1121 895 1151; x_wconf 94' lang='eng' dir='ltr'>endocellular</span> <span class='ocrx_word' id='word_1_65' title='bbox 907 1119 1162 1163; x_wconf 92' lang='eng' dir='ltr'>computation).</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_4' title="bbox 332 1179 1339 1501">
<span class='ocr_line' id='line_1_14' title="bbox 394 1179 1339 1209; baseline 0 0; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_66' title='bbox 394 1179 1339 1209; x_wconf 90' lang='eng' dir='ltr'><strong>ATAGGTCATGAATCTACCGATTGCAGCTGC</strong></span>
</span>
<span class='ocr_line' id='line_1_15' title="bbox 332 1238 1338 1268; baseline 0 0; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_67' title='bbox 332 1238 1338 1268; x_wconf 90' lang='eng' dir='ltr'><strong>TATTCCTCGATGATCGCATGGGCTGTGATG</strong></span>
</span>
<span class='ocr_line' id='line_1_16' title="bbox 333 1296 1338 1326; baseline 0 0; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_68' title='bbox 333 1296 1338 1326; x_wconf 76' lang='eng' dir='ltr'><strong>GCATCGTATCCGATCGATI‘CGAGCGATI‘GCAGC</strong></span>
</span>
<span class='ocr_line' id='line_1_17' title="bbox 332 1355 1337 1386; baseline 0 -1; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_69' title='bbox 332 1355 1337 1386; x_wconf 76' lang='eng' dir='ltr'><strong>TACGCTATI‘CCTCCGAGGGATTGCAGCTACGTC</strong></span>
</span>
<span class='ocr_line' id='line_1_18' title="bbox 333 1412 1338 1443; baseline 0 0; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_70' title='bbox 333 1412 1338 1443; x_wconf 88' lang='eng' dir='ltr'><strong>GCATCGGGCTCAGATGTAGGTCATGAATCTACC</strong></span>
</span>
<span class='ocr_line' id='line_1_19' title="bbox 334 1471 1302 1501; baseline 0 0; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_71' title='bbox 334 1471 1302 1501; x_wconf 76' lang='eng' dir='ltr'><strong>GA&#39;ITGCATGAC’I&#39;TATCCACGGTACA’ITCGACTC</strong></span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_5' title="bbox 333 1530 1337 2025">
<span class='ocr_line' id='line_1_20' title="bbox 398 1530 1337 1571; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_72' title='bbox 398 1530 598 1560; x_wconf 88' lang='eng' dir='ltr'>Ethnovirus</span> <span class='ocrx_word' id='word_1_73' title='bbox 614 1536 734 1571; x_wconf 99' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_74' title='bbox 749 1530 859 1560; x_wconf 98' lang='eng' dir='ltr'>brains</span> <span class='ocrx_word' id='word_1_75' title='bbox 872 1530 1092 1560; x_wconf 92' lang='eng' dir='ltr'>Technovirus</span> <span class='ocrx_word' id='word_1_76' title='bbox 1107 1536 1223 1571; x_wconf 95' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_77' title='bbox 1237 1530 1337 1560; x_wconf 94' lang='eng' dir='ltr'>socio-</span>
</span>
<span class='ocr_line' id='line_1_21' title="bbox 333 1588 1336 1628; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_78' title='bbox 333 1588 506 1618; x_wconf 98' lang='eng' dir='ltr'>economic</span> <span class='ocrx_word' id='word_1_79' title='bbox 524 1598 586 1628; x_wconf 98' lang='eng' dir='ltr'>pro</span> <span class='ocrx_word' id='word_1_80' title='bbox 603 1598 665 1628; x_wconf 98' lang='eng' dir='ltr'>pro</span> <span class='ocrx_word' id='word_1_81' title='bbox 682 1588 887 1628; x_wconf 95' lang='eng' dir='ltr'>production</span> <span class='ocrx_word' id='word_1_82' title='bbox 904 1598 965 1628; x_wconf 98' lang='eng' dir='ltr'>pro</span> <span class='ocrx_word' id='word_1_83' title='bbox 982 1598 1157 1628; x_wconf 92' lang='eng' dir='ltr'>processes.</span> <span class='ocrx_word' id='word_1_84' title='bbox 1177 1588 1336 1618; x_wconf 87' lang='eng' dir='ltr'>Infovirus</span>
</span>
<span class='ocr_line' id='line_1_22' title="bbox 335 1646 1336 1687; baseline -0.001 -11; x_size 41; x_descenders 11; x_ascenders 9"><span class='ocrx_word' id='word_1_85' title='bbox 335 1652 449 1687; x_wconf 93' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_86' title='bbox 459 1646 572 1687; x_wconf 96' lang='eng' dir='ltr'>digital</span> <span class='ocrx_word' id='word_1_87' title='bbox 581 1654 1336 1676; x_wconf 89' lang='eng'>010010010001011110100001001101010101010</span>
</span>
<span class='ocr_line' id='line_1_23' title="bbox 335 1711 1335 1745; baseline 0 -10; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_88' title='bbox 335 1711 1335 1745; x_wconf 91' lang='eng' dir='ltr'>10001001101010010010100computers100101001011010010</span>
</span>
<span class='ocr_line' id='line_1_24' title="bbox 335 1771 1335 1792; baseline 0.001 -1; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_89' title='bbox 335 1771 1335 1792; x_wconf 88' lang='eng'>101111010001010101010101010010101001010110101001</span>
</span>
<span class='ocr_line' id='line_1_25' title="bbox 333 1829 1334 1851; baseline -0.001 0; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_90' title='bbox 333 1829 1334 1851; x_wconf 93' lang='eng' dir='ltr'>oooooo100010111010100100101010010100100101010101</span>
</span>
<span class='ocr_line' id='line_1_26' title="bbox 334 1887 1333 1909; baseline 0 0; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_91' title='bbox 334 1887 1333 1909; x_wconf 91' lang='eng' dir='ltr'>oo100010010010010010010010100100101011010100100</span>
</span>
<span class='ocr_line' id='line_1_27' title="bbox 335 1945 1333 1967; baseline 0.001 -1; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_92' title='bbox 335 1945 1333 1967; x_wconf 90' lang='eng'>10010101101010101010111101000010011010101010101000</span>
</span>
<span class='ocr_line' id='line_1_28' title="bbox 336 2003 1334 2025; baseline 0.001 -1; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_93' title='bbox 336 2003 1334 2025; x_wconf 91' lang='eng'>1001101101010101001100100010001010101110100001010</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_3' title="bbox 811 2119 871 2142">
<p class='ocr_par' dir='ltr' id='par_1_6' title="bbox 811 2119 871 2142">
<span class='ocr_line' id='line_1_29' title="bbox 811 2119 871 2142; baseline 0 0; x_size 31.333334; x_descenders 7.8333335; x_ascenders 7.8333335"><span class='ocrx_word' id='word_1_94' title='bbox 811 2119 871 2142; x_wconf 84' lang='eng'>385</span>
</span>
</p>
</div>
</div>
</body>
</html>

92
hypervirus/4.html
Unescape Escape View File

@ -0,0 +1,92 @@
<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
<head>
<title></title>
<meta http-equiv="Content-Type" content="text/html;charset=utf-8" />
<meta name='ocr-system' content='tesseract 3.04.01' />
<meta name='ocr-capabilities' content='ocr_page ocr_carea ocr_par ocr_line ocrx_word'/>
</head>
<body>
<div class='ocr_page' id='page_1' title='image "hypervirus-04.tif"; bbox 0 0 1749 2481; ppageno 0'>
<div class='ocr_carea' id='block_1_1' title="bbox 704 414 1039 434">
<p class='ocr_par' dir='ltr' id='par_1_1' title="bbox 704 414 1039 434">
<span class='ocr_line' id='line_1_1' title="bbox 704 414 1039 434; baseline 0 0; x_size 27.037037; x_descenders 6.7592592; x_ascenders 6.7592592"><span class='ocrx_word' id='word_1_1' title='bbox 704 414 843 434; x_wconf 86' lang='eng' dir='ltr'>FANGED</span> <span class='ocrx_word' id='word_1_2' title='bbox 860 414 1039 434; x_wconf 87' lang='eng' dir='ltr'>NOUMENA</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_2' title="bbox 365 530 1382 2019">
<p class='ocr_par' dir='ltr' id='par_1_2' title="bbox 365 530 1378 609">
<span class='ocr_line' id='line_1_2' title="bbox 365 530 1378 551; baseline 0 0; x_size 42.062042; x_descenders 10.992891; x_ascenders 10.569149"><span class='ocrx_word' id='word_1_3' title='bbox 365 530 1378 551; x_wconf 94' lang='eng'>110010100101000110010011100100010000000001001111</span>
</span>
<span class='ocr_line' id='line_1_3' title="bbox 365 587 686 609; baseline -0.003 0; x_size 42.062042; x_descenders 10.992891; x_ascenders 10.569149"><span class='ocrx_word' id='word_1_4' title='bbox 365 587 686 609; x_wconf 93' lang='eng'>1100010010010101</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_3' title="bbox 366 637 1380 1084">
<span class='ocr_line' id='line_1_4' title="bbox 430 637 1378 678; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_5' title='bbox 430 637 631 677; x_wconf 94' lang='eng' dir='ltr'>Hypervirus</span> <span class='ocrx_word' id='word_1_6' title='bbox 644 643 764 678; x_wconf 97' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_7' title='bbox 775 637 963 678; x_wconf 84' lang='eng' dir='ltr'>intelligent</span> <span class='ocrx_word' id='word_1_8' title='bbox 974 637 1269 677; x_wconf 98' lang='eng' dir='ltr'>immunosecurity</span> <span class='ocrx_word' id='word_1_9' title='bbox 1280 643 1378 667; x_wconf 97' lang='eng' dir='ltr'>struc-</span>
</span>
<span class='ocr_line' id='line_1_5' title="bbox 366 696 1378 737; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_10' title='bbox 366 703 463 726; x_wconf 89' lang='eng' dir='ltr'>tures:</span> <span class='ocrx_word' id='word_1_11' title='bbox 476 706 530 736; x_wconf 99' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_12' title='bbox 540 706 594 736; x_wconf 89' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_13' title='bbox 606 706 652 726; x_wconf 92' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_14' title='bbox 661 706 718 736; x_wconf 90' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_15' title='bbox 729 706 774 726; x_wconf 94' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_16' title='bbox 788 696 1009 736; x_wconf 97' lang='eng' dir='ltr'>nomadically</span> <span class='ocrx_word' id='word_1_17' title='bbox 1020 696 1225 737; x_wconf 85' lang='eng' dir='ltr'>abstracting</span> <span class='ocrx_word' id='word_1_18' title='bbox 1234 696 1274 726; x_wconf 99' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_19' title='bbox 1286 706 1378 736; x_wconf 97' lang='eng' dir='ltr'>proc-</span>
</span>
<span class='ocr_line' id='line_1_6' title="bbox 367 752 1377 796; baseline 0 -12; x_size 37; x_descenders 7; x_ascenders 10"><span class='ocrx_word' id='word_1_20' title='bbox 367 764 450 784; x_wconf 99' lang='eng' dir='ltr'>esses</span> <span class='ocrx_word' id='word_1_21' title='bbox 463 754 545 784; x_wconf 90' lang='eng' dir='ltr'>from</span> <span class='ocrx_word' id='word_1_22' title='bbox 558 754 687 794; x_wconf 88' lang='eng' dir='ltr'>specific</span> <span class='ocrx_word' id='word_1_23' title='bbox 700 754 808 784; x_wconf 91' lang='eng' dir='ltr'>media</span> <span class='ocrx_word' id='word_1_24' title='bbox 822 752 923 796; x_wconf 87' lang='eng' dir='ltr'>(DNA,</span> <span class='ocrx_word' id='word_1_25' title='bbox 934 754 1055 791; x_wconf 93' lang='eng' dir='ltr'>words,</span> <span class='ocrx_word' id='word_1_26' title='bbox 1066 754 1227 794; x_wconf 91' lang='eng' dir='ltr'>symbolic</span> <span class='ocrx_word' id='word_1_27' title='bbox 1238 754 1377 791; x_wconf 87' lang='eng' dir='ltr'>models,</span>
</span>
<span class='ocr_line' id='line_1_7' title="bbox 367 811 1378 854; baseline 0 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_28' title='bbox 367 811 638 854; x_wconf 91' lang='eng' dir='ltr'>bit-sequences),</span> <span class='ocrx_word' id='word_1_29' title='bbox 658 812 727 842; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_30' title='bbox 744 812 926 852; x_wconf 97' lang='eng' dir='ltr'>operantly</span> <span class='ocrx_word' id='word_1_31' title='bbox 943 812 1212 853; x_wconf 92' lang='eng' dir='ltr'>re-engineering</span> <span class='ocrx_word' id='word_1_32' title='bbox 1229 812 1327 842; x_wconf 82' lang='eng' dir='ltr'>itself.</span> <span class='ocrx_word' id='word_1_33' title='bbox 1351 813 1378 842; x_wconf 95' lang='eng' dir='ltr'>It</span>
</span>
<span class='ocr_line' id='line_1_8' title="bbox 367 870 1380 911; baseline 0 -11; x_size 37; x_descenders 7; x_ascenders 10"><span class='ocrx_word' id='word_1_34' title='bbox 367 870 454 900; x_wconf 82' lang='eng' dir='ltr'>folds</span> <span class='ocrx_word' id='word_1_35' title='bbox 468 870 538 900; x_wconf 94' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_36' title='bbox 550 870 644 907; x_wconf 82' lang='eng' dir='ltr'>itself,</span> <span class='ocrx_word' id='word_1_37' title='bbox 658 870 834 907; x_wconf 98' lang='eng' dir='ltr'>involutes,</span> <span class='ocrx_word' id='word_1_38' title='bbox 848 880 887 900; x_wconf 98' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_39' title='bbox 898 870 1023 910; x_wconf 89' lang='eng' dir='ltr'>plexes,</span> <span class='ocrx_word' id='word_1_40' title='bbox 1039 870 1083 910; x_wconf 91' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_41' title='bbox 1094 870 1380 911; x_wconf 87' lang='eng' dir='ltr'>reprogramming</span>
</span>
<span class='ocr_line' id='line_1_9' title="bbox 366 928 1377 969; baseline 0 -11; x_size 42.062042; x_descenders 10.992891; x_ascenders 10.569149"><span class='ocrx_word' id='word_1_42' title='bbox 366 928 578 968; x_wconf 90' lang='eng' dir='ltr'>corpuscular</span> <span class='ocrx_word' id='word_1_43' title='bbox 595 928 680 958; x_wconf 93' lang='eng' dir='ltr'>code</span> <span class='ocrx_word' id='word_1_44' title='bbox 701 934 735 958; x_wconf 98' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_45' title='bbox 754 938 946 969; x_wconf 95' lang='eng' dir='ltr'>reprogram</span> <span class='ocrx_word' id='word_1_46' title='bbox 965 928 1252 969; x_wconf 95' lang='eng' dir='ltr'>reprogramming</span> <span class='ocrx_word' id='word_1_47' title='bbox 1270 938 1377 968; x_wconf 95' lang='eng' dir='ltr'>repro-</span>
</span>
<span class='ocr_line' id='line_1_10' title="bbox 366 986 1378 1027; baseline 0.001 -12; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_48' title='bbox 366 986 552 1027; x_wconf 90' lang='eng' dir='ltr'>gramming</span> <span class='ocrx_word' id='word_1_49' title='bbox 561 986 855 1027; x_wconf 92' lang='eng' dir='ltr'>reprogramming.</span> <span class='ocrx_word' id='word_1_50' title='bbox 870 995 951 1016; x_wconf 85' lang='eng' dir='ltr'>ROM</span> <span class='ocrx_word' id='word_1_51' title='bbox 964 986 991 1016; x_wconf 99' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_52' title='bbox 1002 986 1126 1016; x_wconf 99' lang='eng' dir='ltr'>melted</span> <span class='ocrx_word' id='word_1_53' title='bbox 1135 986 1208 1016; x_wconf 98' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_54' title='bbox 1218 986 1378 1016; x_wconf 93' lang='eng' dir='ltr'>recursive</span>
</span>
<span class='ocr_line' id='line_1_11' title="bbox 367 1044 671 1084; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_55' title='bbox 367 1044 671 1084; x_wconf 89' lang='eng' dir='ltr'>experimentation.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_4' title="bbox 368 1111 1379 1434">
<span class='ocr_line' id='line_1_12' title="bbox 429 1111 1378 1132; baseline -0.001 0; x_size 42.062042; x_descenders 10.992891; x_ascenders 10.569149"><span class='ocrx_word' id='word_1_56' title='bbox 429 1111 1378 1132; x_wconf 94' lang='eng'>001010010010010110000101010101011101010010100</span>
</span>
<span class='ocr_line' id='line_1_13' title="bbox 368 1169 1379 1190; baseline 0.001 -1; x_size 42.062042; x_descenders 10.992891; x_ascenders 10.569149"><span class='ocrx_word' id='word_1_57' title='bbox 368 1169 1379 1190; x_wconf 93' lang='eng'>10010101000011011001101001011000010001001001000</span>
</span>
<span class='ocr_line' id='line_1_14' title="bbox 369 1218 1379 1259; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_58' title='bbox 369 1218 554 1259; x_wconf 92' lang='eng' dir='ltr'>Recording</span> <span class='ocrx_word' id='word_1_59' title='bbox 562 1218 701 1248; x_wconf 90' lang='eng' dir='ltr'>devices.</span> <span class='ocrx_word' id='word_1_60' title='bbox 713 1218 862 1258; x_wconf 90' lang='eng' dir='ltr'>Copiers.</span> <span class='ocrx_word' id='word_1_61' title='bbox 875 1219 985 1248; x_wconf 89' lang='eng' dir='ltr'>Faxes.</span> <span class='ocrx_word' id='word_1_62' title='bbox 998 1218 1173 1258; x_wconf 92' lang='eng' dir='ltr'>Samplers.</span> <span class='ocrx_word' id='word_1_63' title='bbox 1187 1224 1379 1248; x_wconf 90' lang='eng' dir='ltr'>K-stammer</span>
</span>
<span class='ocr_line' id='line_1_15' title="bbox 369 1276 1378 1321; baseline 0 -14; x_size 43; x_descenders 12; x_ascenders 11"><span class='ocrx_word' id='word_1_64' title='bbox 369 1276 645 1321; x_wconf 88' lang='eng' dir='ltr'>(((re)re)reruns)</span> <span class='ocrx_word' id='word_1_65' title='bbox 661 1283 820 1307; x_wconf 94' lang='eng' dir='ltr'>cross-cut</span> <span class='ocrx_word' id='word_1_66' title='bbox 834 1277 878 1317; x_wconf 99' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_67' title='bbox 892 1277 1022 1317; x_wconf 96' lang='eng' dir='ltr'>orphan</span> <span class='ocrx_word' id='word_1_68' title='bbox 1038 1276 1123 1307; x_wconf 82' lang='eng' dir='ltr'>drift.</span> <span class='ocrx_word' id='word_1_69' title='bbox 1142 1278 1266 1317; x_wconf 90' lang='eng' dir='ltr'>Repeat</span> <span class='ocrx_word' id='word_1_70' title='bbox 1280 1277 1378 1307; x_wconf 97' lang='eng' dir='ltr'>infec-</span>
</span>
<span class='ocr_line' id='line_1_16' title="bbox 369 1336 1377 1376; baseline 0 -10; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_71' title='bbox 369 1336 448 1366; x_wconf 93' lang='eng' dir='ltr'>tion.</span> <span class='ocrx_word' id='word_1_72' title='bbox 467 1336 520 1366; x_wconf 98' lang='eng' dir='ltr'>All</span> <span class='ocrx_word' id='word_1_73' title='bbox 538 1336 625 1376; x_wconf 96' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_74' title='bbox 644 1336 733 1376; x_wconf 96' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_75' title='bbox 753 1336 840 1376; x_wconf 98' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_76' title='bbox 860 1336 947 1376; x_wconf 97' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_77' title='bbox 968 1336 1057 1376; x_wconf 99' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_78' title='bbox 1076 1336 1165 1376; x_wconf 98' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_79' title='bbox 1184 1336 1271 1376; x_wconf 99' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_80' title='bbox 1291 1336 1377 1376; x_wconf 98' lang='eng' dir='ltr'>hype</span>
</span>
<span class='ocr_line' id='line_1_17' title="bbox 369 1394 1243 1434; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_81' title='bbox 369 1394 557 1434; x_wconf 95' lang='eng' dir='ltr'>hypervirus</span> <span class='ocrx_word' id='word_1_82' title='bbox 570 1394 687 1424; x_wconf 98' lang='eng' dir='ltr'>strains</span> <span class='ocrx_word' id='word_1_83' title='bbox 701 1404 753 1424; x_wconf 99' lang='eng' dir='ltr'>are</span> <span class='ocrx_word' id='word_1_84' title='bbox 766 1394 885 1434; x_wconf 96' lang='eng' dir='ltr'>plastic</span> <span class='ocrx_word' id='word_1_85' title='bbox 899 1394 965 1424; x_wconf 98' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_86' title='bbox 979 1394 1243 1434; x_wconf 98' lang='eng' dir='ltr'>interoperative.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_5' title="bbox 367 1451 1382 2019">
<span class='ocr_line' id='line_1_18' title="bbox 430 1451 1377 1492; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_87' title='bbox 430 1452 592 1481; x_wconf 58' lang='eng' dir='ltr'>INSERT.</span> <span class='ocrx_word' id='word_1_88' title='bbox 608 1451 890 1492; x_wconf 72' lang='eng' dir='ltr'>hyper-prefixing</span> <span class='ocrx_word' id='word_1_89' title='bbox 901 1451 1051 1482; x_wconf 84' lang='eng' dir='ltr'>semiotic</span> <span class='ocrx_word' id='word_1_90' title='bbox 1063 1457 1184 1481; x_wconf 83' lang='eng' dir='ltr'>sectors</span> <span class='ocrx_word' id='word_1_91' title='bbox 1192 1451 1284 1481; x_wconf 86' lang='eng' dir='ltr'>TAG</span> <span class='ocrx_word' id='word_1_92' title='bbox 1290 1451 1377 1481; x_wconf 87' lang='eng' dir='ltr'>TAG</span>
</span>
<span class='ocr_line' id='line_1_19' title="bbox 367 1508 1377 1552; baseline 0 -12; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_93' title='bbox 367 1510 451 1540; x_wconf 90' lang='eng' dir='ltr'>TAG</span> <span class='ocrx_word' id='word_1_94' title='bbox 460 1516 526 1551; x_wconf 95' lang='eng' dir='ltr'>tags</span> <span class='ocrx_word' id='word_1_95' title='bbox 535 1510 621 1540; x_wconf 93' lang='eng' dir='ltr'>them</span> <span class='ocrx_word' id='word_1_96' title='bbox 630 1510 680 1540; x_wconf 98' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_97' title='bbox 689 1510 822 1540; x_wconf 98' lang='eng' dir='ltr'>transfer</span> <span class='ocrx_word' id='word_1_98' title='bbox 830 1510 899 1540; x_wconf 98' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_99' title='bbox 907 1510 1046 1540; x_wconf 99' lang='eng' dir='ltr'>abstract</span> <span class='ocrx_word' id='word_1_100' title='bbox 1054 1510 1139 1540; x_wconf 88' lang='eng' dir='ltr'>ACT</span> <span class='ocrx_word' id='word_1_101' title='bbox 1145 1510 1231 1540; x_wconf 88' lang='eng' dir='ltr'>ACT</span> <span class='ocrx_word' id='word_1_102' title='bbox 1239 1508 1377 1552; x_wconf 92' lang='eng' dir='ltr'>(nonlin-</span>
</span>
<span class='ocr_line' id='line_1_20' title="bbox 368 1567 1380 1610; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_103' title='bbox 368 1578 420 1598; x_wconf 91' lang='eng' dir='ltr'>ear</span> <span class='ocrx_word' id='word_1_104' title='bbox 429 1567 663 1610; x_wconf 91' lang='eng' dir='ltr'>transcodable)</span> <span class='ocrx_word' id='word_1_105' title='bbox 672 1568 834 1598; x_wconf 98' lang='eng' dir='ltr'>machinic</span> <span class='ocrx_word' id='word_1_106' title='bbox 843 1574 986 1608; x_wconf 86' lang='eng' dir='ltr'>systems,</span> <span class='ocrx_word' id='word_1_107' title='bbox 997 1568 1099 1598; x_wconf 99' lang='eng' dir='ltr'>tuned</span> <span class='ocrx_word' id='word_1_108' title='bbox 1108 1574 1141 1598; x_wconf 98' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_109' title='bbox 1149 1568 1334 1598; x_wconf 98' lang='eng' dir='ltr'>virtualities</span> <span class='ocrx_word' id='word_1_110' title='bbox 1343 1578 1380 1598; x_wconf 99' lang='eng' dir='ltr'>or</span>
</span>
<span class='ocr_line' id='line_1_21' title="bbox 370 1626 1376 1670; baseline 0 -13; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_111' title='bbox 370 1627 581 1667; x_wconf 92' lang='eng' dir='ltr'>hyperspeeds</span> <span class='ocrx_word' id='word_1_112' title='bbox 591 1626 725 1670; x_wconf 90' lang='eng' dir='ltr'>(futural</span> <span class='ocrx_word' id='word_1_113' title='bbox 734 1627 911 1657; x_wconf 99' lang='eng' dir='ltr'>currencies</span> <span class='ocrx_word' id='word_1_114' title='bbox 920 1627 1143 1667; x_wconf 99' lang='eng' dir='ltr'>independent</span> <span class='ocrx_word' id='word_1_115' title='bbox 1151 1627 1189 1657; x_wconf 96' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_116' title='bbox 1195 1627 1252 1657; x_wconf 98' lang='eng' dir='ltr'>def</span> <span class='ocrx_word' id='word_1_117' title='bbox 1253 1627 1376 1657; x_wconf 97' lang='eng' dir='ltr'>uturali-</span>
</span>
<span class='ocr_line' id='line_1_22' title="bbox 370 1684 1379 1727; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_118' title='bbox 370 1684 500 1727; x_wconf 87' lang='eng' dir='ltr'>zation).</span> <span class='ocrx_word' id='word_1_119' title='bbox 512 1685 731 1725; x_wconf 95' lang='eng' dir='ltr'>Hypermedia</span> <span class='ocrx_word' id='word_1_120' title='bbox 739 1685 905 1726; x_wconf 88' lang='eng' dir='ltr'>configure</span> <span class='ocrx_word' id='word_1_121' title='bbox 915 1695 947 1715; x_wconf 99' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_122' title='bbox 957 1695 989 1715; x_wconf 99' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_123' title='bbox 998 1695 1093 1725; x_wconf 92' lang='eng' dir='ltr'>every</span> <span class='ocrx_word' id='word_1_124' title='bbox 1100 1685 1379 1725; x_wconf 98' lang='eng' dir='ltr'>implementation</span>
</span>
<span class='ocr_line' id='line_1_23' title="bbox 368 1743 1382 1783; baseline 0.001 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_125' title='bbox 368 1743 482 1773; x_wconf 93' lang='eng' dir='ltr'>within</span> <span class='ocrx_word' id='word_1_126' title='bbox 492 1753 510 1773; x_wconf 99' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_127' title='bbox 522 1743 652 1783; x_wconf 88' lang='eng' dir='ltr'>specific</span> <span class='ocrx_word' id='word_1_128' title='bbox 666 1743 812 1773; x_wconf 93' lang='eng' dir='ltr'>medium</span> <span class='ocrx_word' id='word_1_129' title='bbox 825 1753 863 1773; x_wconf 98' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_130' title='bbox 875 1743 1027 1783; x_wconf 93' lang='eng' dir='ltr'>territory</span> <span class='ocrx_word' id='word_1_131' title='bbox 1037 1753 1072 1773; x_wconf 99' lang='eng' dir='ltr'>as</span> <span class='ocrx_word' id='word_1_132' title='bbox 1084 1753 1102 1773; x_wconf 99' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_133' title='bbox 1113 1743 1332 1773; x_wconf 92' lang='eng' dir='ltr'>subfunction</span> <span class='ocrx_word' id='word_1_134' title='bbox 1344 1743 1382 1773; x_wconf 98' lang='eng' dir='ltr'>of</span>
</span>
<span class='ocr_line' id='line_1_24' title="bbox 369 1800 1377 1845; baseline 0 -13; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_135' title='bbox 369 1802 629 1832; x_wconf 89' lang='eng' dir='ltr'>extraterritorial</span> <span class='ocrx_word' id='word_1_136' title='bbox 640 1812 820 1842; x_wconf 87' lang='eng' dir='ltr'>processes.</span> <span class='ocrx_word' id='word_1_137' title='bbox 835 1802 951 1843; x_wconf 92' lang='eng' dir='ltr'>Going</span> <span class='ocrx_word' id='word_1_138' title='bbox 964 1800 993 1845; x_wconf 92' lang='eng'>((</span> <span class='ocrx_word' id='word_1_139' title='bbox 1007 1800 1019 1844; x_wconf 91' lang='eng'>(</span> <span class='ocrx_word' id='word_1_140' title='bbox 1033 1800 1080 1845; x_wconf 91' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_141' title='bbox 1094 1800 1106 1844; x_wconf 91' lang='eng'>(</span> <span class='ocrx_word' id='word_1_142' title='bbox 1120 1800 1132 1844; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_143' title='bbox 1148 1800 1159 1844; x_wconf 91' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_144' title='bbox 1172 1800 1184 1844; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_145' title='bbox 1201 1800 1229 1845; x_wconf 89' lang='eng'>((</span> <span class='ocrx_word' id='word_1_146' title='bbox 1242 1800 1254 1845; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_147' title='bbox 1278 1800 1290 1845; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_148' title='bbox 1306 1801 1334 1845; x_wconf 90' lang='eng'>((</span> <span class='ocrx_word' id='word_1_149' title='bbox 1348 1800 1377 1845; x_wconf 85' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_25' title="bbox 372 1860 1379 1904; baseline 0 -13; x_size 42; x_descenders 11; x_ascenders 11"><span class='ocrx_word' id='word_1_150' title='bbox 372 1860 383 1904; x_wconf 90' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_151' title='bbox 397 1860 409 1904; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_152' title='bbox 425 1861 524 1901; x_wconf 98' lang='eng' dir='ltr'>hyper</span> <span class='ocrx_word' id='word_1_153' title='bbox 537 1861 695 1891; x_wconf 98' lang='eng' dir='ltr'>dissolves</span> <span class='ocrx_word' id='word_1_154' title='bbox 709 1861 811 1902; x_wconf 97' lang='eng' dir='ltr'>being</span> <span class='ocrx_word' id='word_1_155' title='bbox 823 1861 895 1891; x_wconf 98' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_156' title='bbox 906 1861 995 1891; x_wconf 92' lang='eng' dir='ltr'>ACT</span> <span class='ocrx_word' id='word_1_157' title='bbox 1004 1861 1094 1891; x_wconf 88' lang='eng' dir='ltr'>ACT</span> <span class='ocrx_word' id='word_1_158' title='bbox 1104 1861 1192 1891; x_wconf 88' lang='eng' dir='ltr'>ACT</span> <span class='ocrx_word' id='word_1_159' title='bbox 1205 1861 1345 1901; x_wconf 87' lang='eng' dir='ltr'>activity;</span> <span class='ocrx_word' id='word_1_160' title='bbox 1361 1871 1379 1891; x_wconf 99' lang='eng' dir='ltr'>a</span>
</span>
<span class='ocr_line' id='line_1_26' title="bbox 370 1920 1378 1960; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_161' title='bbox 370 1920 513 1950; x_wconf 90' lang='eng' dir='ltr'>material</span> <span class='ocrx_word' id='word_1_162' title='bbox 528 1920 891 1950; x_wconf 98' lang='eng' dir='ltr'>desubstantialisation</span> <span class='ocrx_word' id='word_1_163' title='bbox 908 1930 950 1950; x_wconf 98' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_164' title='bbox 969 1920 1019 1950; x_wconf 79' lang='eng' dir='ltr'>off</span> <span class='ocrx_word' id='word_1_165' title='bbox 1033 1930 1075 1950; x_wconf 96' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_166' title='bbox 1093 1920 1150 1950; x_wconf 78' lang='eng' dir='ltr'>off.</span> <span class='ocrx_word' id='word_1_167' title='bbox 1169 1921 1378 1960; x_wconf 95' lang='eng' dir='ltr'>Hyperproc-</span>
</span>
<span class='ocr_line' id='line_1_27' title="bbox 368 1975 1378 2019; baseline 0 -12; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_168' title='bbox 368 1987 455 2007; x_wconf 92' lang='eng' dir='ltr'>esses</span> <span class='ocrx_word' id='word_1_169' title='bbox 465 1977 581 2017; x_wconf 99' lang='eng' dir='ltr'>spread</span> <span class='ocrx_word' id='word_1_170' title='bbox 591 1977 657 2007; x_wconf 92' lang='eng' dir='ltr'>like</span> <span class='ocrx_word' id='word_1_171' title='bbox 669 1977 883 2007; x_wconf 91' lang='eng' dir='ltr'>Heraklitean</span> <span class='ocrx_word' id='word_1_172' title='bbox 894 1977 953 2007; x_wconf 97' lang='eng' dir='ltr'>fire</span> <span class='ocrx_word' id='word_1_173' title='bbox 962 1987 997 2007; x_wconf 99' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_174' title='bbox 1007 1987 1042 2007; x_wconf 99' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_175' title='bbox 1052 1987 1086 2007; x_wconf 99' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_176' title='bbox 1099 1975 1276 2019; x_wconf 92' lang='eng' dir='ltr'>(although</span> <span class='ocrx_word' id='word_1_177' title='bbox 1289 1977 1378 2007; x_wconf 98' lang='eng' dir='ltr'>there</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_3' title="bbox 840 2161 901 2184">
<p class='ocr_par' dir='ltr' id='par_1_6' title="bbox 840 2161 901 2184">
<span class='ocr_line' id='line_1_28' title="bbox 840 2161 901 2184; baseline 0 0; x_size 31; x_descenders 7.75; x_ascenders 7.75"><span class='ocrx_word' id='word_1_178' title='bbox 840 2161 901 2184; x_wconf 84' lang='eng'>386</span>
</span>
</p>
</div>
</div>
</body>
</html>

91
hypervirus/5.html
Unescape Escape View File

@ -0,0 +1,91 @@
<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
<head>
<title></title>
<meta http-equiv="Content-Type" content="text/html;charset=utf-8" />
<meta name='ocr-system' content='tesseract 3.04.01' />
<meta name='ocr-capabilities' content='ocr_page ocr_carea ocr_par ocr_line ocrx_word'/>
</head>
<body>
<div class='ocr_page' id='page_1' title='image "hypervirus-05.tif"; bbox 0 0 1749 2481; ppageno 0'>
<div class='ocr_carea' id='block_1_1' title="bbox 768 360 986 381">
<p class='ocr_par' dir='ltr' id='par_1_1' title="bbox 768 360 986 381">
<span class='ocr_line' id='line_1_1' title="bbox 768 360 986 381; baseline 0 0; x_size 27.407408; x_descenders 6.8518519; x_ascenders 6.8518519"><span class='ocrx_word' id='word_1_1' title='bbox 768 360 986 381; x_wconf 86' lang='eng' dir='ltr'><strong>HYPERVIRUS</strong></span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_2' title="bbox 364 467 1377 2014">
<p class='ocr_par' dir='ltr' id='par_1_2' title="bbox 367 467 1376 568">
<span class='ocr_line' id='line_1_2' title="bbox 367 467 1376 508; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_2' title='bbox 367 477 423 497; x_wconf 98' lang='eng' dir='ltr'>are</span> <span class='ocrx_word' id='word_1_3' title='bbox 437 477 481 497; x_wconf 90' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_4' title='bbox 495 467 665 508; x_wconf 82' lang='eng' dir='ltr'>analogies</span> <span class='ocrx_word' id='word_1_5' title='bbox 681 477 719 497; x_wconf 99' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_6' title='bbox 733 467 924 507; x_wconf 83' lang='eng' dir='ltr'>metaphors</span> <span class='ocrx_word' id='word_1_7' title='bbox 941 467 975 497; x_wconf 98' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_8' title='bbox 990 467 1075 508; x_wconf 83' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_9' title='bbox 1091 467 1176 508; x_wconf 83' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_10' title='bbox 1192 467 1276 508; x_wconf 88' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_11' title='bbox 1292 467 1376 508; x_wconf 92' lang='eng' dir='ltr'>hype</span>
</span>
<span class='ocr_line' id='line_1_3' title="bbox 369 524 599 568; baseline 0.004 -13; x_size 42; x_descenders 10; x_ascenders 12"><span class='ocrx_word' id='word_1_12' title='bbox 369 524 599 568; x_wconf 92' lang='eng' dir='ltr'>hyperspace).</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_3' title="bbox 364 584 1377 1444">
<span class='ocr_line' id='line_1_4' title="bbox 433 584 1376 625; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_13' title='bbox 433 584 535 625; x_wconf 87' lang='eng' dir='ltr'>Being</span> <span class='ocrx_word' id='word_1_14' title='bbox 543 584 635 614; x_wconf 90' lang='eng' dir='ltr'>CAG</span> <span class='ocrx_word' id='word_1_15' title='bbox 643 584 734 614; x_wconf 90' lang='eng' dir='ltr'>CAG</span> <span class='ocrx_word' id='word_1_16' title='bbox 744 594 834 625; x_wconf 87' lang='eng' dir='ltr'>cages</span> <span class='ocrx_word' id='word_1_17' title='bbox 847 584 923 614; x_wconf 89' lang='eng' dir='ltr'>flow</span> <span class='ocrx_word' id='word_1_18' title='bbox 932 584 1040 614; x_wconf 85' lang='eng' dir='ltr'>within</span> <span class='ocrx_word' id='word_1_19' title='bbox 1051 594 1199 625; x_wconf 88' lang='eng' dir='ltr'>memory.</span> <span class='ocrx_word' id='word_1_20' title='bbox 1212 584 1376 614; x_wconf 88' lang='eng' dir='ltr'>Function-</span>
</span>
<span class='ocr_line' id='line_1_5' title="bbox 369 643 1377 684; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_21' title='bbox 369 643 427 684; x_wconf 99' lang='eng' dir='ltr'>ing</span> <span class='ocrx_word' id='word_1_22' title='bbox 438 653 471 673; x_wconf 93' lang='eng' dir='ltr'>as</span> <span class='ocrx_word' id='word_1_23' title='bbox 484 653 515 673; x_wconf 90' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_24' title='bbox 528 653 562 673; x_wconf 90' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_25' title='bbox 574 643 640 673; x_wconf 99' lang='eng' dir='ltr'>real</span> <span class='ocrx_word' id='word_1_26' title='bbox 652 643 892 684; x_wconf 95' lang='eng' dir='ltr'>antiontology,</span> <span class='ocrx_word' id='word_1_27' title='bbox 904 643 985 673; x_wconf 99' lang='eng' dir='ltr'>viral</span> <span class='ocrx_word' id='word_1_28' title='bbox 999 643 1139 673; x_wconf 92' lang='eng' dir='ltr'>amnesia</span> <span class='ocrx_word' id='word_1_29' title='bbox 1152 643 1377 684; x_wconf 85' lang='eng' dir='ltr'>machinically</span>
</span>
<span class='ocr_line' id='line_1_6' title="bbox 369 701 1376 742; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_30' title='bbox 369 701 501 731; x_wconf 90' lang='eng' dir='ltr'>realizes</span> <span class='ocrx_word' id='word_1_31' title='bbox 522 701 589 731; x_wconf 99' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_32' title='bbox 608 701 770 731; x_wconf 94' lang='eng' dir='ltr'>dissolves</span> <span class='ocrx_word' id='word_1_33' title='bbox 789 701 970 742; x_wconf 91' lang='eng' dir='ltr'>biological</span> <span class='ocrx_word' id='word_1_34' title='bbox 987 701 1376 731; x_wconf 65' lang='eng' dir='ltr'><strong>TGACTCACI&#39;ITAC-</strong></span>
</span>
<span class='ocr_line' id='line_1_7' title="bbox 370 759 1374 795; baseline 0 -6; x_size 36; x_descenders 6; x_ascenders 8"><span class='ocrx_word' id='word_1_35' title='bbox 370 759 554 795; x_wconf 75' lang='eng' dir='ltr'>OGA&#39;ITG,</span> <span class='ocrx_word' id='word_1_36' title='bbox 564 759 713 795; x_wconf 84' lang='eng' dir='ltr'>cultural,</span> <span class='ocrx_word' id='word_1_37' title='bbox 723 759 790 789; x_wconf 91' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_38' title='bbox 800 759 958 789; x_wconf 84' lang='eng' dir='ltr'>technical</span> <span class='ocrx_word' id='word_1_39' title='bbox 968 767 1374 789; x_wconf 90' lang='eng'>010110100100010110100</span>
</span>
<span class='ocr_line' id='line_1_8' title="bbox 370 818 1374 848; baseline 0 0; x_size 42.396393; x_descenders 11.313044; x_ascenders 10.553611"><span class='ocrx_word' id='word_1_40' title='bbox 370 826 1036 848; x_wconf 91' lang='eng'>101001001011101001010100100100100</span> <span class='ocrx_word' id='word_1_41' title='bbox 1044 818 1187 848; x_wconf 96' lang='eng' dir='ltr'>mnemic</span> <span class='ocrx_word' id='word_1_42' title='bbox 1195 824 1374 848; x_wconf 89' lang='eng' dir='ltr'>structures:</span>
</span>
<span class='ocr_line' id='line_1_9' title="bbox 369 876 1374 917; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_43' title='bbox 369 876 603 917; x_wconf 97' lang='eng' dir='ltr'>chopping-up</span> <span class='ocrx_word' id='word_1_44' title='bbox 623 876 1043 917; x_wconf 95' lang='eng' dir='ltr'>hierarchic-generational</span> <span class='ocrx_word' id='word_1_45' title='bbox 1062 876 1294 917; x_wconf 96' lang='eng' dir='ltr'>descendency,</span> <span class='ocrx_word' id='word_1_46' title='bbox 1312 876 1374 907; x_wconf 86' lang='eng' dir='ltr'>col-</span>
</span>
<span class='ocr_line' id='line_1_10' title="bbox 370 935 1376 976; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_47' title='bbox 370 935 500 976; x_wconf 99' lang='eng' dir='ltr'>lapsing</span> <span class='ocrx_word' id='word_1_48' title='bbox 511 935 749 976; x_wconf 97' lang='eng' dir='ltr'>phylogenetic</span> <span class='ocrx_word' id='word_1_49' title='bbox 762 935 804 965; x_wconf 97' lang='eng' dir='ltr'>tic</span> <span class='ocrx_word' id='word_1_50' title='bbox 818 935 1029 965; x_wconf 92' lang='eng' dir='ltr'>frozen-code</span> <span class='ocrx_word' id='word_1_51' title='bbox 1042 935 1112 965; x_wconf 99' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_52' title='bbox 1124 941 1296 976; x_wconf 84' lang='eng' dir='ltr'>ontogeny,</span> <span class='ocrx_word' id='word_1_53' title='bbox 1310 935 1376 965; x_wconf 85' lang='eng' dir='ltr'>and</span>
</span>
<span class='ocr_line' id='line_1_11' title="bbox 369 993 1374 1034; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_54' title='bbox 369 993 645 1034; x_wconf 92' lang='eng' dir='ltr'>immanentizing</span> <span class='ocrx_word' id='word_1_55' title='bbox 664 993 718 1023; x_wconf 99' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_56' title='bbox 736 999 811 1033; x_wconf 98' lang='eng' dir='ltr'>past</span> <span class='ocrx_word' id='word_1_57' title='bbox 830 999 865 1023; x_wconf 99' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_58' title='bbox 883 993 1051 1033; x_wconf 95' lang='eng' dir='ltr'>operative</span> <span class='ocrx_word' id='word_1_59' title='bbox 1069 999 1207 1023; x_wconf 87' lang='eng' dir='ltr'>current.</span> <span class='ocrx_word' id='word_1_60' title='bbox 1228 994 1271 1023; x_wconf 95' lang='eng' dir='ltr'>Its</span> <span class='ocrx_word' id='word_1_61' title='bbox 1290 1003 1374 1023; x_wconf 90' lang='eng' dir='ltr'>com-</span>
</span>
<span class='ocr_line' id='line_1_12' title="bbox 369 1052 1377 1093; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_62' title='bbox 369 1052 503 1092; x_wconf 99' lang='eng' dir='ltr'>petitive</span> <span class='ocrx_word' id='word_1_63' title='bbox 517 1052 729 1093; x_wconf 86' lang='eng' dir='ltr'>just-in-time</span> <span class='ocrx_word' id='word_1_64' title='bbox 747 1052 960 1082; x_wconf 95' lang='eng' dir='ltr'>innovations</span> <span class='ocrx_word' id='word_1_65' title='bbox 979 1052 1083 1082; x_wconf 94' lang='eng' dir='ltr'>delete</span> <span class='ocrx_word' id='word_1_66' title='bbox 1101 1058 1229 1093; x_wconf 87' lang='eng' dir='ltr'>storage</span> <span class='ocrx_word' id='word_1_67' title='bbox 1245 1052 1304 1082; x_wconf 91' lang='eng' dir='ltr'>CA</span> <span class='ocrx_word' id='word_1_68' title='bbox 1317 1052 1377 1082; x_wconf 91' lang='eng' dir='ltr'>CA</span>
</span>
<span class='ocr_line' id='line_1_13' title="bbox 369 1109 1374 1150; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_69' title='bbox 369 1109 522 1149; x_wconf 90' lang='eng' dir='ltr'>capacity,</span> <span class='ocrx_word' id='word_1_70' title='bbox 534 1109 581 1139; x_wconf 89' lang='eng' dir='ltr'>flu</span> <span class='ocrx_word' id='word_1_71' title='bbox 592 1109 637 1139; x_wconf 89' lang='eng' dir='ltr'>flu</span> <span class='ocrx_word' id='word_1_72' title='bbox 648 1109 695 1139; x_wconf 89' lang='eng' dir='ltr'>flu</span> <span class='ocrx_word' id='word_1_73' title='bbox 705 1109 855 1139; x_wconf 89' lang='eng' dir='ltr'>fluidizin</span> <span class='ocrx_word' id='word_1_74' title='bbox 857 1119 880 1150; x_wconf 99' lang='eng' dir='ltr'>g</span> <span class='ocrx_word' id='word_1_75' title='bbox 887 1109 1050 1150; x_wconf 97' lang='eng' dir='ltr'>energetic</span> <span class='ocrx_word' id='word_1_76' title='bbox 1059 1109 1125 1139; x_wconf 99' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_77' title='bbox 1134 1109 1374 1139; x_wconf 87' lang='eng' dir='ltr'>informational</span>
</span>
<span class='ocr_line' id='line_1_14' title="bbox 370 1168 1374 1208; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_78' title='bbox 370 1168 479 1198; x_wconf 97' lang='eng' dir='ltr'>stocks</span> <span class='ocrx_word' id='word_1_79' title='bbox 493 1168 565 1198; x_wconf 99' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_80' title='bbox 578 1168 647 1198; x_wconf 98' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_81' title='bbox 660 1168 727 1198; x_wconf 99' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_82' title='bbox 740 1178 778 1198; x_wconf 99' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_83' title='bbox 790 1168 859 1198; x_wconf 98' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_84' title='bbox 871 1168 940 1198; x_wconf 98' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_85' title='bbox 952 1178 990 1198; x_wconf 99' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_86' title='bbox 1002 1168 1285 1208; x_wconf 88' lang='eng' dir='ltr'>orphan-vampire</span> <span class='ocrx_word' id='word_1_87' title='bbox 1296 1178 1330 1198; x_wconf 99' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_88' title='bbox 1342 1178 1374 1198; x_wconf 98' lang='eng' dir='ltr'>re</span>
</span>
<span class='ocr_line' id='line_1_15' title="bbox 371 1226 1375 1256; baseline 0 0; x_size 42.123241; x_descenders 12.12324; x_ascenders 8"><span class='ocrx_word' id='word_1_89' title='bbox 371 1226 562 1256; x_wconf 91' lang='eng' dir='ltr'>transversal</span> <span class='ocrx_word' id='word_1_90' title='bbox 572 1234 913 1256; x_wconf 90' lang='eng'>110111100010101010</span> <span class='ocrx_word' id='word_1_91' title='bbox 923 1226 969 1256; x_wconf 92' lang='eng' dir='ltr'>vir</span> <span class='ocrx_word' id='word_1_92' title='bbox 977 1226 1025 1256; x_wconf 93' lang='eng' dir='ltr'>vir</span> <span class='ocrx_word' id='word_1_93' title='bbox 1031 1226 1375 1256; x_wconf 85' lang='eng' dir='ltr'>virocommunication</span>
</span>
<span class='ocr_line' id='line_1_16' title="bbox 369 1283 1371 1327; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_94' title='bbox 369 1295 515 1325; x_wconf 90' lang='eng' dir='ltr'>process,</span> <span class='ocrx_word' id='word_1_95' title='bbox 534 1285 731 1326; x_wconf 95' lang='eng' dir='ltr'>expressing</span> <span class='ocrx_word' id='word_1_96' title='bbox 749 1295 767 1315; x_wconf 99' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_97' title='bbox 786 1285 919 1325; x_wconf 98' lang='eng' dir='ltr'>surplus</span> <span class='ocrx_word' id='word_1_98' title='bbox 939 1285 1034 1315; x_wconf 98' lang='eng' dir='ltr'>value</span> <span class='ocrx_word' id='word_1_99' title='bbox 1052 1285 1091 1315; x_wconf 99' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_100' title='bbox 1105 1285 1189 1315; x_wconf 94' lang='eng' dir='ltr'>code</span> <span class='ocrx_word' id='word_1_101' title='bbox 1209 1283 1371 1327; x_wconf 90' lang='eng' dir='ltr'>(content)</span>
</span>
<span class='ocr_line' id='line_1_17' title="bbox 369 1341 1372 1385; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_102' title='bbox 369 1353 403 1373; x_wconf 99' lang='eng' dir='ltr'>as</span> <span class='ocrx_word' id='word_1_103' title='bbox 422 1343 910 1383; x_wconf 95' lang='eng' dir='ltr'>xenoreplication-behaviour</span> <span class='ocrx_word' id='word_1_104' title='bbox 929 1341 1068 1385; x_wconf 94' lang='eng' dir='ltr'>(and/or</span> <span class='ocrx_word' id='word_1_105' title='bbox 1085 1341 1290 1385; x_wconf 97' lang='eng' dir='ltr'>con(nective</span> <span class='ocrx_word' id='word_1_106' title='bbox 1307 1341 1372 1385; x_wconf 91' lang='eng' dir='ltr'>dis)</span>
</span>
<span class='ocr_line' id='line_1_18' title="bbox 364 1400 547 1444; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_107' title='bbox 364 1400 547 1444; x_wconf 86' lang='eng' dir='ltr'>junction).</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_4' title="bbox 367 1460 1374 2014">
<span class='ocr_line' id='line_1_19' title="bbox 430 1460 1371 1501; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_108' title='bbox 430 1461 474 1490; x_wconf 95' lang='eng' dir='ltr'>As</span> <span class='ocrx_word' id='word_1_109' title='bbox 483 1470 549 1490; x_wconf 91' lang='eng' dir='ltr'>war</span> <span class='ocrx_word' id='word_1_110' title='bbox 557 1460 716 1490; x_wconf 97' lang='eng' dir='ltr'>increases</span> <span class='ocrx_word' id='word_1_111' title='bbox 726 1460 759 1490; x_wconf 99' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_112' title='bbox 768 1460 803 1490; x_wconf 98' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_113' title='bbox 812 1460 846 1490; x_wconf 98' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_114' title='bbox 855 1460 1070 1501; x_wconf 87' lang='eng' dir='ltr'>intelligence,</span> <span class='ocrx_word' id='word_1_115' title='bbox 1079 1460 1102 1490; x_wconf 99' lang='eng' dir='ltr'>it</span> <span class='ocrx_word' id='word_1_116' title='bbox 1111 1460 1260 1490; x_wconf 91' lang='eng' dir='ltr'>becomes</span> <span class='ocrx_word' id='word_1_117' title='bbox 1270 1460 1371 1490; x_wconf 87' lang='eng' dir='ltr'>softer.</span>
</span>
<span class='ocr_line' id='line_1_20' title="bbox 372 1519 1374 1560; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_118' title='bbox 372 1520 417 1560; x_wconf 93' lang='eng' dir='ltr'>By</span> <span class='ocrx_word' id='word_1_119' title='bbox 428 1519 577 1560; x_wconf 99' lang='eng' dir='ltr'>trashing</span> <span class='ocrx_word' id='word_1_120' title='bbox 587 1519 672 1549; x_wconf 99' lang='eng' dir='ltr'>their</span> <span class='ocrx_word' id='word_1_121' title='bbox 681 1519 772 1549; x_wconf 99' lang='eng' dir='ltr'>hosts</span> <span class='ocrx_word' id='word_1_122' title='bbox 784 1519 882 1549; x_wconf 97' lang='eng' dir='ltr'>crude</span> <span class='ocrx_word' id='word_1_123' title='bbox 893 1519 1016 1549; x_wconf 98' lang='eng' dir='ltr'>viruses</span> <span class='ocrx_word' id='word_1_124' title='bbox 1028 1519 1187 1549; x_wconf 86' lang='eng' dir='ltr'>feedback</span> <span class='ocrx_word' id='word_1_125' title='bbox 1195 1519 1374 1560; x_wconf 94' lang='eng' dir='ltr'>negatively</span>
</span>
<span class='ocr_line' id='line_1_21' title="bbox 370 1576 1372 1617; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_126' title='bbox 370 1586 464 1616; x_wconf 98' lang='eng' dir='ltr'>upon</span> <span class='ocrx_word' id='word_1_127' title='bbox 482 1576 690 1612; x_wconf 98' lang='eng' dir='ltr'>themselves,</span> <span class='ocrx_word' id='word_1_128' title='bbox 708 1576 936 1617; x_wconf 98' lang='eng' dir='ltr'>autolimiting</span> <span class='ocrx_word' id='word_1_129' title='bbox 954 1576 1033 1606; x_wconf 99' lang='eng' dir='ltr'>their</span> <span class='ocrx_word' id='word_1_130' title='bbox 1050 1586 1149 1617; x_wconf 98' lang='eng' dir='ltr'>range</span> <span class='ocrx_word' id='word_1_131' title='bbox 1165 1576 1204 1606; x_wconf 99' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_132' title='bbox 1217 1586 1248 1606; x_wconf 99' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_133' title='bbox 1265 1586 1372 1617; x_wconf 87' lang='eng' dir='ltr'>regen-</span>
</span>
<span class='ocr_line' id='line_1_22' title="bbox 369 1635 1374 1675; baseline -0.001 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_134' title='bbox 369 1635 489 1665; x_wconf 99' lang='eng' dir='ltr'>erative</span> <span class='ocrx_word' id='word_1_135' title='bbox 506 1635 724 1665; x_wconf 90' lang='eng' dir='ltr'>infilitration.</span> <span class='ocrx_word' id='word_1_136' title='bbox 744 1635 852 1675; x_wconf 91' lang='eng' dir='ltr'>Crazy</span> <span class='ocrx_word' id='word_1_137' title='bbox 867 1635 1004 1665; x_wconf 99' lang='eng' dir='ltr'>vandals</span> <span class='ocrx_word' id='word_1_138' title='bbox 1022 1635 1085 1665; x_wconf 91' lang='eng' dir='ltr'>like</span> <span class='ocrx_word' id='word_1_139' title='bbox 1103 1635 1207 1665; x_wconf 90' lang='eng' dir='ltr'>Ebola</span> <span class='ocrx_word' id='word_1_140' title='bbox 1223 1635 1374 1666; x_wconf 90' lang='eng' dir='ltr'>CGCGT</span>
</span>
<span class='ocr_line' id='line_1_23' title="bbox 369 1692 1371 1736; baseline 0 -12; x_size 42.396393; x_descenders 11.313044; x_ascenders 10.553611"><span class='ocrx_word' id='word_1_141' title='bbox 369 1694 1016 1724; x_wconf 73' lang='eng' dir='ltr'>GAGCAATCGGACTCGGCTGCI‘</span> <span class='ocrx_word' id='word_1_142' title='bbox 1017 1694 1195 1724; x_wconf 66' lang='eng' dir='ltr'><strong>GTGCFF</strong></span> <span class='ocrx_word' id='word_1_143' title='bbox 1196 1694 1228 1724; x_wconf 90' lang='eng' dir='ltr'>G</span> <span class='ocrx_word' id='word_1_144' title='bbox 1243 1692 1371 1736; x_wconf 91' lang='eng' dir='ltr'>(bodies</span>
</span>
<span class='ocr_line' id='line_1_24' title="bbox 369 1750 1372 1794; baseline 0 -12; x_size 43; x_descenders 11; x_ascenders 12"><span class='ocrx_word' id='word_1_145' title='bbox 369 1752 538 1782; x_wconf 98' lang='eng' dir='ltr'>dissolved</span> <span class='ocrx_word' id='word_1_146' title='bbox 548 1752 684 1792; x_wconf 91' lang='eng' dir='ltr'>quickly</span> <span class='ocrx_word' id='word_1_147' title='bbox 693 1752 765 1782; x_wconf 99' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_148' title='bbox 777 1750 885 1794; x_wconf 98' lang='eng' dir='ltr'>slime)</span> <span class='ocrx_word' id='word_1_149' title='bbox 897 1750 998 1782; x_wconf 79' lang='eng' dir='ltr'>aren’t</span> <span class='ocrx_word' id='word_1_150' title='bbox 1005 1762 1082 1782; x_wconf 98' lang='eng' dir='ltr'>ever</span> <span class='ocrx_word' id='word_1_151' title='bbox 1089 1752 1191 1793; x_wconf 97' lang='eng' dir='ltr'>going</span> <span class='ocrx_word' id='word_1_152' title='bbox 1203 1758 1235 1782; x_wconf 99' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_153' title='bbox 1244 1752 1339 1782; x_wconf 85' lang='eng' dir='ltr'>make</span> <span class='ocrx_word' id='word_1_154' title='bbox 1348 1752 1372 1782; x_wconf 99' lang='eng' dir='ltr'>it</span>
</span>
<span class='ocr_line' id='line_1_25' title="bbox 370 1809 1373 1850; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_155' title='bbox 370 1809 434 1850; x_wconf 98' lang='eng' dir='ltr'>big.</span> <span class='ocrx_word' id='word_1_156' title='bbox 445 1809 586 1839; x_wconf 90' lang='eng' dir='ltr'>General</span> <span class='ocrx_word' id='word_1_157' title='bbox 594 1809 753 1849; x_wconf 97' lang='eng' dir='ltr'>principle</span> <span class='ocrx_word' id='word_1_158' title='bbox 764 1809 815 1839; x_wconf 99' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_159' title='bbox 821 1809 901 1839; x_wconf 98' lang='eng' dir='ltr'>viral</span> <span class='ocrx_word' id='word_1_160' title='bbox 911 1809 1084 1839; x_wconf 96' lang='eng' dir='ltr'>take-overs</span> <span class='ocrx_word' id='word_1_161' title='bbox 1094 1809 1127 1839; x_wconf 99' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_162' title='bbox 1134 1809 1189 1839; x_wconf 99' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_163' title='bbox 1197 1809 1306 1839; x_wconf 86' lang='eng' dir='ltr'>media:</span> <span class='ocrx_word' id='word_1_164' title='bbox 1318 1809 1373 1839; x_wconf 95' lang='eng' dir='ltr'>the</span>
</span>
<span class='ocr_line' id='line_1_26' title="bbox 367 1868 1372 1909; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_165' title='bbox 367 1878 461 1898; x_wconf 99' lang='eng' dir='ltr'>more</span> <span class='ocrx_word' id='word_1_166' title='bbox 469 1868 752 1908; x_wconf 97' lang='eng' dir='ltr'>unsophisticated</span> <span class='ocrx_word' id='word_1_167' title='bbox 760 1868 816 1898; x_wconf 98' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_168' title='bbox 824 1868 1012 1909; x_wconf 97' lang='eng' dir='ltr'>contagion,</span> <span class='ocrx_word' id='word_1_169' title='bbox 1021 1868 1077 1898; x_wconf 98' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_170' title='bbox 1085 1868 1196 1909; x_wconf 89' lang='eng' dir='ltr'>bigger</span> <span class='ocrx_word' id='word_1_171' title='bbox 1205 1868 1255 1898; x_wconf 89' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_172' title='bbox 1265 1868 1372 1908; x_wconf 90' lang='eng' dir='ltr'>splash</span>
</span>
<span class='ocr_line' id='line_1_27' title="bbox 371 1924 1372 1968; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_173' title='bbox 371 1924 620 1968; x_wconf 90' lang='eng' dir='ltr'>(diversionary</span> <span class='ocrx_word' id='word_1_174' title='bbox 640 1926 755 1956; x_wconf 97' lang='eng' dir='ltr'>tactics</span> <span class='ocrx_word' id='word_1_175' title='bbox 775 1924 971 1968; x_wconf 95' lang='eng' dir='ltr'>excepted).</span> <span class='ocrx_word' id='word_1_176' title='bbox 991 1926 1372 1956; x_wconf 75' lang='eng' dir='ltr'><strong>CAGCTACGCTA&#39;I&#39;I‘</strong></span>
</span>
<span class='ocr_line' id='line_1_28' title="bbox 370 1984 1372 2014; baseline 0 0; x_size 42.396393; x_descenders 11.313044; x_ascenders 10.553611"><span class='ocrx_word' id='word_1_177' title='bbox 370 1984 1372 2014; x_wconf 90' lang='eng' dir='ltr'>CTCCGAGGCTAGATTGCAGCTACGTCGCATCG</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_3' title="bbox 848 2107 910 2130">
<p class='ocr_par' dir='ltr' id='par_1_5' title="bbox 848 2107 910 2130">
<span class='ocr_line' id='line_1_29' title="bbox 848 2107 910 2130; baseline 0 0; x_size 31; x_descenders 7.75; x_ascenders 7.75"><span class='ocrx_word' id='word_1_178' title='bbox 848 2107 910 2130; x_wconf 87' lang='eng'>387</span>
</span>
</p>
</div>
</div>
</body>
</html>

91
hypervirus/6.html
Unescape Escape View File

@ -0,0 +1,91 @@
<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
<head>
<title></title>
<meta http-equiv="Content-Type" content="text/html;charset=utf-8" />
<meta name='ocr-system' content='tesseract 3.04.01' />
<meta name='ocr-capabilities' content='ocr_page ocr_carea ocr_par ocr_line ocrx_word'/>
</head>
<body>
<div class='ocr_page' id='page_1' title='image "hypervirus-06.tif"; bbox 0 0 1749 2481; ppageno 0'>
<div class='ocr_carea' id='block_1_1' title="bbox 702 358 1036 378">
<p class='ocr_par' dir='ltr' id='par_1_1' title="bbox 702 358 1036 378">
<span class='ocr_line' id='line_1_1' title="bbox 702 358 1036 378; baseline 0 0; x_size 27.333334; x_descenders 6.8333335; x_ascenders 6.8333335"><span class='ocrx_word' id='word_1_1' title='bbox 702 358 840 378; x_wconf 85' lang='eng' dir='ltr'><strong>FANGED</strong></span> <span class='ocrx_word' id='word_1_2' title='bbox 857 358 1036 378; x_wconf 85' lang='eng' dir='ltr'><strong>NOUMENA</strong></span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_2' title="bbox 364 466 1379 2024">
<p class='ocr_par' dir='ltr' id='par_1_2' title="bbox 364 466 1377 1030">
<span class='ocr_line' id='line_1_2' title="bbox 364 466 1377 496; baseline 0 0; x_size 42.400703; x_descenders 11.344193; x_ascenders 10.541037"><span class='ocrx_word' id='word_1_3' title='bbox 364 466 1377 496; x_wconf 73' lang='eng' dir='ltr'><strong>GGCTGACCGATGTAGGTCATGAATCTACCGA’IT</strong></span>
</span>
<span class='ocr_line' id='line_1_3' title="bbox 364 524 1377 555; baseline 0 0; x_size 42.400703; x_descenders 11.344193; x_ascenders 10.541037"><span class='ocrx_word' id='word_1_4' title='bbox 364 524 1377 555; x_wconf 71' lang='eng' dir='ltr'><strong>GCACATGACTTATCCACGGTCTA&#39;ITCCTCGAT</strong></span>
</span>
<span class='ocr_line' id='line_1_4' title="bbox 365 583 1373 613; baseline 0 0; x_size 42.400703; x_descenders 11.344193; x_ascenders 10.541037"><span class='ocrx_word' id='word_1_5' title='bbox 365 583 717 613; x_wconf 90' lang='eng' dir='ltr'><strong>GATCGCATCGGG</strong></span> <span class='ocrx_word' id='word_1_6' title='bbox 720 583 1248 613; x_wconf 90' lang='eng' dir='ltr'><strong>CTGACCGATGGCATCGTA</strong></span> <span class='ocrx_word' id='word_1_7' title='bbox 1253 583 1373 613; x_wconf 88' lang='eng' dir='ltr'>COPY.</span>
</span>
<span class='ocr_line' id='line_1_5' title="bbox 365 639 1375 681; baseline -0.001 -10; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_8' title='bbox 365 641 462 671; x_wconf 90' lang='eng' dir='ltr'>CUT.</span> <span class='ocrx_word' id='word_1_9' title='bbox 478 640 615 670; x_wconf 86' lang='eng' dir='ltr'><strong>PASTE.</strong></span> <span class='ocrx_word' id='word_1_10' title='bbox 632 640 748 670; x_wconf 82' lang='eng' dir='ltr'>Subtle</span> <span class='ocrx_word' id='word_1_11' title='bbox 761 640 886 670; x_wconf 82' lang='eng' dir='ltr'>viruses</span> <span class='ocrx_word' id='word_1_12' title='bbox 900 650 953 670; x_wconf 97' lang='eng' dir='ltr'>are</span> <span class='ocrx_word' id='word_1_13' title='bbox 968 640 1056 677; x_wconf 97' lang='eng' dir='ltr'>slow,</span> <span class='ocrx_word' id='word_1_14' title='bbox 1071 640 1228 681; x_wconf 97' lang='eng' dir='ltr'>synergic,</span> <span class='ocrx_word' id='word_1_15' title='bbox 1245 639 1375 670; x_wconf 82' lang='eng' dir='ltr'>flexible</span>
</span>
<span class='ocr_line' id='line_1_6' title="bbox 365 699 1374 740; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_16' title='bbox 365 699 432 729; x_wconf 98' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_17' title='bbox 452 699 585 729; x_wconf 98' lang='eng' dir='ltr'>elusive.</span> <span class='ocrx_word' id='word_1_18' title='bbox 606 699 697 740; x_wconf 87' lang='eng' dir='ltr'>They</span> <span class='ocrx_word' id='word_1_19' title='bbox 716 705 856 729; x_wconf 87' lang='eng' dir='ltr'>execute</span> <span class='ocrx_word' id='word_1_20' title='bbox 876 699 1036 729; x_wconf 87' lang='eng' dir='ltr'>sensitive</span> <span class='ocrx_word' id='word_1_21' title='bbox 1056 699 1276 729; x_wconf 89' lang='eng' dir='ltr'>behavioural</span> <span class='ocrx_word' id='word_1_22' title='bbox 1296 709 1374 729; x_wconf 97' lang='eng' dir='ltr'>con-</span>
</span>
<span class='ocr_line' id='line_1_7' title="bbox 367 757 1374 798; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_23' title='bbox 367 757 426 787; x_wconf 94' lang='eng' dir='ltr'>trol</span> <span class='ocrx_word' id='word_1_24' title='bbox 442 757 513 787; x_wconf 89' lang='eng' dir='ltr'>that</span> <span class='ocrx_word' id='word_1_25' title='bbox 523 757 684 798; x_wconf 87' lang='eng' dir='ltr'>prolongs</span> <span class='ocrx_word' id='word_1_26' title='bbox 700 757 754 787; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_27' title='bbox 769 757 824 787; x_wconf 88' lang='eng' dir='ltr'>life</span> <span class='ocrx_word' id='word_1_28' title='bbox 838 757 877 787; x_wconf 88' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_29' title='bbox 889 757 944 787; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_30' title='bbox 959 757 1183 787; x_wconf 93' lang='eng' dir='ltr'>biomachinic</span> <span class='ocrx_word' id='word_1_31' title='bbox 1198 767 1374 794; x_wconf 90' lang='eng' dir='ltr'>resources,</span>
</span>
<span class='ocr_line' id='line_1_8' title="bbox 366 815 1375 856; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_32' title='bbox 366 815 553 845; x_wconf 91' lang='eng' dir='ltr'>maximizes</span> <span class='ocrx_word' id='word_1_33' title='bbox 562 815 810 855; x_wconf 92' lang='eng' dir='ltr'>opportunities</span> <span class='ocrx_word' id='word_1_34' title='bbox 820 815 872 845; x_wconf 88' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_35' title='bbox 879 815 1118 856; x_wconf 97' lang='eng' dir='ltr'>propogation,</span> <span class='ocrx_word' id='word_1_36' title='bbox 1129 815 1299 845; x_wconf 88' lang='eng' dir='ltr'>infiltrates</span> <span class='ocrx_word' id='word_1_37' title='bbox 1309 815 1375 845; x_wconf 97' lang='eng' dir='ltr'>and</span>
</span>
<span class='ocr_line' id='line_1_9' title="bbox 365 873 1374 914; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_38' title='bbox 365 873 508 903; x_wconf 92' lang='eng' dir='ltr'>disables</span> <span class='ocrx_word' id='word_1_39' title='bbox 526 873 643 903; x_wconf 96' lang='eng' dir='ltr'>hostile</span> <span class='ocrx_word' id='word_1_40' title='bbox 663 873 806 914; x_wconf 90' lang='eng' dir='ltr'>security</span> <span class='ocrx_word' id='word_1_41' title='bbox 824 879 973 914; x_wconf 90' lang='eng' dir='ltr'>systems,</span> <span class='ocrx_word' id='word_1_42' title='bbox 993 873 1060 903; x_wconf 97' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_43' title='bbox 1080 873 1271 903; x_wconf 88' lang='eng' dir='ltr'>feeds-back</span> <span class='ocrx_word' id='word_1_44' title='bbox 1287 873 1374 913; x_wconf 88' lang='eng' dir='ltr'>posi-</span>
</span>
<span class='ocr_line' id='line_1_10' title="bbox 367 931 1376 961; baseline 0 0; x_size 41.059158; x_descenders 11.059156; x_ascenders 10"><span class='ocrx_word' id='word_1_45' title='bbox 367 931 428 961; x_wconf 94' lang='eng' dir='ltr'>tive</span> <span class='ocrx_word' id='word_1_46' title='bbox 446 942 608 959; x_wconf 91' lang='eng'>-+-++-+-++</span> <span class='ocrx_word' id='word_1_47' title='bbox 625 931 659 961; x_wconf 90' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_48' title='bbox 675 931 708 961; x_wconf 97' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_49' title='bbox 724 931 758 961; x_wconf 99' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_50' title='bbox 774 931 971 961; x_wconf 91' lang='eng' dir='ltr'>innovation</span> <span class='ocrx_word' id='word_1_51' title='bbox 987 931 1247 961; x_wconf 95' lang='eng' dir='ltr'>technoscience.</span> <span class='ocrx_word' id='word_1_52' title='bbox 1267 932 1305 961; x_wconf 90' lang='eng' dir='ltr'>In</span> <span class='ocrx_word' id='word_1_53' title='bbox 1321 931 1376 961; x_wconf 96' lang='eng' dir='ltr'>the</span>
</span>
<span class='ocr_line' id='line_1_11' title="bbox 366 987 1372 1030; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_54' title='bbox 366 989 614 1026; x_wconf 96' lang='eng' dir='ltr'>macroversion,</span> <span class='ocrx_word' id='word_1_55' title='bbox 628 999 646 1019; x_wconf 97' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_56' title='bbox 658 998 706 1019; x_wconf 83' lang='eng' dir='ltr'>VR</span> <span class='ocrx_word' id='word_1_57' title='bbox 718 999 800 1030; x_wconf 98' lang='eng' dir='ltr'>prey</span> <span class='ocrx_word' id='word_1_58' title='bbox 812 989 933 1019; x_wconf 91' lang='eng' dir='ltr'>animal</span> <span class='ocrx_word' id='word_1_59' title='bbox 948 989 1006 1019; x_wconf 94' lang='eng' dir='ltr'>hid</span> <span class='ocrx_word' id='word_1_60' title='bbox 1020 989 1055 1019; x_wconf 90' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_61' title='bbox 1068 989 1108 1019; x_wconf 99' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_62' title='bbox 1121 987 1263 1030; x_wconf 79' lang='eng' dir='ltr'>enemy’s</span> <span class='ocrx_word' id='word_1_63' title='bbox 1276 989 1372 1019; x_wconf 86' lang='eng' dir='ltr'>head.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_3' title="bbox 367 1047 1377 1847">
<span class='ocr_line' id='line_1_12' title="bbox 426 1047 1377 1088; baseline 0.001 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_64' title='bbox 426 1047 532 1077; x_wconf 92' lang='eng' dir='ltr'>When</span> <span class='ocrx_word' id='word_1_65' title='bbox 545 1047 687 1088; x_wconf 87' lang='eng' dir='ltr'>hunting</span> <span class='ocrx_word' id='word_1_66' title='bbox 699 1047 751 1077; x_wconf 88' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_67' title='bbox 761 1047 849 1088; x_wconf 96' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_68' title='bbox 861 1047 1056 1088; x_wconf 96' lang='eng' dir='ltr'>hypervirus</span> <span class='ocrx_word' id='word_1_69' title='bbox 1068 1047 1148 1077; x_wconf 89' lang='eng' dir='ltr'>look</span> <span class='ocrx_word' id='word_1_70' title='bbox 1158 1047 1204 1077; x_wconf 98' lang='eng' dir='ltr'>ok</span> <span class='ocrx_word' id='word_1_71' title='bbox 1215 1047 1258 1077; x_wconf 95' lang='eng' dir='ltr'>ok</span> <span class='ocrx_word' id='word_1_72' title='bbox 1269 1047 1314 1077; x_wconf 99' lang='eng' dir='ltr'>ok</span> <span class='ocrx_word' id='word_1_73' title='bbox 1325 1047 1377 1077; x_wconf 88' lang='eng' dir='ltr'>for</span>
</span>
<span class='ocr_line' id='line_1_13' title="bbox 367 1104 1374 1147; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_74' title='bbox 367 1106 404 1136; x_wconf 95' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_75' title='bbox 416 1106 559 1147; x_wconf 92' lang='eng' dir='ltr'>primary</span> <span class='ocrx_word' id='word_1_76' title='bbox 569 1106 644 1136; x_wconf 96' lang='eng' dir='ltr'>host</span> <span class='ocrx_word' id='word_1_77' title='bbox 655 1106 793 1146; x_wconf 93' lang='eng' dir='ltr'>species,</span> <span class='ocrx_word' id='word_1_78' title='bbox 804 1106 912 1136; x_wconf 93' lang='eng' dir='ltr'>which</span> <span class='ocrx_word' id='word_1_79' title='bbox 924 1106 990 1136; x_wconf 93' lang='eng' dir='ltr'>will</span> <span class='ocrx_word' id='word_1_80' title='bbox 1004 1106 1043 1136; x_wconf 99' lang='eng' dir='ltr'>be</span> <span class='ocrx_word' id='word_1_81' title='bbox 1057 1104 1268 1146; x_wconf 85' lang='eng' dir='ltr'>undergoing</span> <span class='ocrx_word' id='word_1_82' title='bbox 1280 1106 1374 1147; x_wconf 93' lang='eng' dir='ltr'>logis-</span>
</span>
<span class='ocr_line' id='line_1_14' title="bbox 367 1164 1375 1205; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_83' title='bbox 367 1164 440 1194; x_wconf 97' lang='eng' dir='ltr'>tical</span> <span class='ocrx_word' id='word_1_84' title='bbox 454 1164 644 1194; x_wconf 91' lang='eng' dir='ltr'>behavioral</span> <span class='ocrx_word' id='word_1_85' title='bbox 659 1164 914 1204; x_wconf 92' lang='eng' dir='ltr'>sophistication</span> <span class='ocrx_word' id='word_1_86' title='bbox 932 1164 1073 1194; x_wconf 98' lang='eng' dir='ltr'>indexed</span> <span class='ocrx_word' id='word_1_87' title='bbox 1092 1164 1135 1205; x_wconf 98' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_88' title='bbox 1149 1174 1191 1194; x_wconf 97' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_89' title='bbox 1207 1164 1375 1204; x_wconf 98' lang='eng' dir='ltr'>explosive</span>
</span>
<span class='ocr_line' id='line_1_15' title="bbox 368 1223 1374 1264; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_90' title='bbox 368 1223 505 1253; x_wconf 92' lang='eng' dir='ltr'>increase</span> <span class='ocrx_word' id='word_1_91' title='bbox 518 1223 552 1253; x_wconf 90' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_92' title='bbox 562 1223 839 1253; x_wconf 91' lang='eng' dir='ltr'>communicative</span> <span class='ocrx_word' id='word_1_93' title='bbox 850 1223 1013 1264; x_wconf 97' lang='eng' dir='ltr'>intensity,</span> <span class='ocrx_word' id='word_1_94' title='bbox 1025 1223 1228 1263; x_wconf 91' lang='eng' dir='ltr'>population</span> <span class='ocrx_word' id='word_1_95' title='bbox 1238 1223 1374 1264; x_wconf 98' lang='eng' dir='ltr'>density,</span>
</span>
<span class='ocr_line' id='line_1_16' title="bbox 367 1281 1375 1322; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_96' title='bbox 367 1281 473 1311; x_wconf 91' lang='eng' dir='ltr'>sexual</span> <span class='ocrx_word' id='word_1_97' title='bbox 482 1281 761 1322; x_wconf 95' lang='eng' dir='ltr'>disorganisation,</span> <span class='ocrx_word' id='word_1_98' title='bbox 771 1281 908 1311; x_wconf 91' lang='eng' dir='ltr'>cultural</span> <span class='ocrx_word' id='word_1_99' title='bbox 917 1281 1135 1322; x_wconf 93' lang='eng' dir='ltr'>promiscuity,</span> <span class='ocrx_word' id='word_1_100' title='bbox 1144 1281 1209 1311; x_wconf 97' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_101' title='bbox 1220 1281 1375 1311; x_wconf 92' lang='eng' dir='ltr'>technical</span>
</span>
<span class='ocr_line' id='line_1_17' title="bbox 367 1337 1376 1381; baseline -0.001 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_102' title='bbox 367 1340 427 1370; x_wconf 99' lang='eng' dir='ltr'>sub</span> <span class='ocrx_word' id='word_1_103' title='bbox 437 1339 498 1369; x_wconf 99' lang='eng' dir='ltr'>sub</span> <span class='ocrx_word' id='word_1_104' title='bbox 508 1339 732 1369; x_wconf 93' lang='eng' dir='ltr'>subtilization</span> <span class='ocrx_word' id='word_1_105' title='bbox 743 1337 892 1381; x_wconf 92' lang='eng' dir='ltr'>(leading</span> <span class='ocrx_word' id='word_1_106' title='bbox 902 1345 936 1369; x_wconf 99' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_107' title='bbox 945 1339 1205 1380; x_wconf 94' lang='eng' dir='ltr'>neurogenomic</span> <span class='ocrx_word' id='word_1_108' title='bbox 1215 1339 1376 1369; x_wconf 88' lang='eng' dir='ltr'>feedback</span>
</span>
<span class='ocr_line' id='line_1_18' title="bbox 367 1397 1377 1438; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_109' title='bbox 367 1397 431 1427; x_wconf 97' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_110' title='bbox 450 1397 653 1427; x_wconf 89' lang='eng' dir='ltr'>fluidization</span> <span class='ocrx_word' id='word_1_111' title='bbox 671 1407 717 1427; x_wconf 98' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_112' title='bbox 733 1397 785 1427; x_wconf 75' lang='eng' dir='ltr'>off</span> <span class='ocrx_word' id='word_1_113' title='bbox 798 1407 844 1427; x_wconf 90' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_114' title='bbox 861 1397 912 1427; x_wconf 75' lang='eng' dir='ltr'>off</span> <span class='ocrx_word' id='word_1_115' title='bbox 925 1397 976 1427; x_wconf 75' lang='eng' dir='ltr'>off</span> <span class='ocrx_word' id='word_1_116' title='bbox 989 1407 1035 1427; x_wconf 98' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_117' title='bbox 1052 1397 1091 1427; x_wconf 88' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_118' title='bbox 1104 1397 1147 1427; x_wconf 92' lang='eng' dir='ltr'>all</span> <span class='ocrx_word' id='word_1_119' title='bbox 1165 1397 1377 1438; x_wconf 87' lang='eng' dir='ltr'>hard-wiring</span>
</span>
<span class='ocr_line' id='line_1_19' title="bbox 367 1453 1376 1497; baseline 0 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_120' title='bbox 367 1455 437 1485; x_wconf 96' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_121' title='bbox 456 1455 525 1485; x_wconf 95' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_122' title='bbox 543 1455 731 1496; x_wconf 90' lang='eng' dir='ltr'>cybernetic</span> <span class='ocrx_word' id='word_1_123' title='bbox 751 1453 883 1497; x_wconf 91' lang='eng' dir='ltr'>fluxes).</span> <span class='ocrx_word' id='word_1_124' title='bbox 901 1455 976 1496; x_wconf 91' lang='eng' dir='ltr'>Any</span> <span class='ocrx_word' id='word_1_125' title='bbox 994 1455 1094 1495; x_wconf 92' lang='eng' dir='ltr'>plane</span> <span class='ocrx_word' id='word_1_126' title='bbox 1112 1455 1227 1495; x_wconf 90' lang='eng' dir='ltr'>planet</span> <span class='ocrx_word' id='word_1_127' title='bbox 1245 1461 1301 1485; x_wconf 98' lang='eng' dir='ltr'>net</span> <span class='ocrx_word' id='word_1_128' title='bbox 1318 1461 1376 1485; x_wconf 98' lang='eng' dir='ltr'>net</span>
</span>
<span class='ocr_line' id='line_1_20' title="bbox 367 1513 1376 1554; baseline 0.001 -12; x_size 41; x_descenders 11; x_ascenders 8"><span class='ocrx_word' id='word_1_129' title='bbox 367 1521 820 1543; x_wconf 90' lang='eng'>00011011010010010101011</span> <span class='ocrx_word' id='word_1_130' title='bbox 832 1513 968 1554; x_wconf 94' lang='eng' dir='ltr'>hosting</span> <span class='ocrx_word' id='word_1_131' title='bbox 977 1513 1063 1543; x_wconf 94' lang='eng' dir='ltr'>such</span> <span class='ocrx_word' id='word_1_132' title='bbox 1073 1523 1115 1543; x_wconf 97' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_133' title='bbox 1126 1519 1223 1543; x_wconf 95' lang='eng' dir='ltr'>event</span> <span class='ocrx_word' id='word_1_134' title='bbox 1233 1513 1259 1543; x_wconf 94' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_135' title='bbox 1271 1513 1376 1543; x_wconf 89' lang='eng' dir='ltr'>about</span>
</span>
<span class='ocr_line' id='line_1_21' title="bbox 368 1570 1376 1614; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_136' title='bbox 368 1578 401 1602; x_wconf 96' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_137' title='bbox 412 1571 470 1612; x_wconf 88' lang='eng' dir='ltr'>flip</span> <span class='ocrx_word' id='word_1_138' title='bbox 479 1582 561 1602; x_wconf 96' lang='eng' dir='ltr'>over.</span> <span class='ocrx_word' id='word_1_139' title='bbox 573 1572 684 1602; x_wconf 90' lang='eng' dir='ltr'><strong>CATA</strong></span> <span class='ocrx_word' id='word_1_140' title='bbox 693 1572 915 1612; x_wconf 91' lang='eng' dir='ltr'>catastrophic</span> <span class='ocrx_word' id='word_1_141' title='bbox 925 1572 1163 1602; x_wconf 99' lang='eng' dir='ltr'>OKOOKOK</span> <span class='ocrx_word' id='word_1_142' title='bbox 1174 1572 1241 1602; x_wconf 93' lang='eng' dir='ltr'>OK</span> <span class='ocrx_word' id='word_1_143' title='bbox 1251 1582 1326 1602; x_wconf 93' lang='eng' dir='ltr'>zero</span> <span class='ocrx_word' id='word_1_144' title='bbox 1338 1570 1376 1614; x_wconf 87' lang='eng'>(0</span>
</span>
<span class='ocr_line' id='line_1_22' title="bbox 369 1628 1376 1673; baseline 0 -13; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_145' title='bbox 369 1628 431 1672; x_wconf 93' lang='eng' dir='ltr'>(or</span> <span class='ocrx_word' id='word_1_146' title='bbox 443 1628 488 1673; x_wconf 88' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_147' title='bbox 501 1628 514 1672; x_wconf 86' lang='eng'>(</span> <span class='ocrx_word' id='word_1_148' title='bbox 527 1628 554 1672; x_wconf 91' lang='eng'>))</span> <span class='ocrx_word' id='word_1_149' title='bbox 570 1628 598 1673; x_wconf 85' lang='eng'>((</span> <span class='ocrx_word' id='word_1_150' title='bbox 612 1628 624 1672; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_151' title='bbox 638 1628 650 1672; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_152' title='bbox 666 1628 679 1672; x_wconf 86' lang='eng'>(</span> <span class='ocrx_word' id='word_1_153' title='bbox 694 1628 721 1672; x_wconf 91' lang='eng'>))</span> <span class='ocrx_word' id='word_1_154' title='bbox 737 1628 748 1672; x_wconf 92' lang='eng'>)</span> <span class='ocrx_word' id='word_1_155' title='bbox 762 1629 835 1673; x_wconf 86' lang='eng' dir='ltr'>o°))</span> <span class='ocrx_word' id='word_1_156' title='bbox 848 1630 977 1660; x_wconf 87' lang='eng' dir='ltr'>K-virus</span> <span class='ocrx_word' id='word_1_157' title='bbox 989 1630 1057 1660; x_wconf 97' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_158' title='bbox 1070 1628 1156 1672; x_wconf 86' lang='eng' dir='ltr'><strong>(RT)</strong></span> <span class='ocrx_word' id='word_1_159' title='bbox 1171 1630 1376 1670; x_wconf 93' lang='eng' dir='ltr'>retroscripts</span>
</span>
<span class='ocr_line' id='line_1_23' title="bbox 369 1687 1374 1731; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_160' title='bbox 369 1687 490 1731; x_wconf 93' lang='eng' dir='ltr'>(Kobe,</span> <span class='ocrx_word' id='word_1_161' title='bbox 504 1689 626 1730; x_wconf 90' lang='eng' dir='ltr'>Tokyo,</span> <span class='ocrx_word' id='word_1_162' title='bbox 643 1689 836 1719; x_wconf 93' lang='eng' dir='ltr'>Oklahoma</span> <span class='ocrx_word' id='word_1_163' title='bbox 854 1687 1010 1731; x_wconf 93' lang='eng' dir='ltr'>(Koresh,</span> <span class='ocrx_word' id='word_1_164' title='bbox 1028 1687 1227 1731; x_wconf 94' lang='eng' dir='ltr'>Koernke)).</span> <span class='ocrx_word' id='word_1_165' title='bbox 1244 1689 1374 1729; x_wconf 97' lang='eng' dir='ltr'>Apoka-</span>
</span>
<span class='ocr_line' id='line_1_24' title="bbox 368 1745 1375 1788; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_166' title='bbox 368 1747 459 1788; x_wconf 98' lang='eng' dir='ltr'>lypse</span> <span class='ocrx_word' id='word_1_167' title='bbox 478 1747 596 1787; x_wconf 97' lang='eng' dir='ltr'>spread</span> <span class='ocrx_word' id='word_1_168' title='bbox 615 1747 660 1788; x_wconf 98' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_169' title='bbox 681 1747 734 1777; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_170' title='bbox 756 1747 838 1777; x_wconf 94' lang='eng' dir='ltr'>coke</span> <span class='ocrx_word' id='word_1_171' title='bbox 859 1747 1026 1777; x_wconf 86' lang='eng' dir='ltr'>machine.</span> <span class='ocrx_word' id='word_1_172' title='bbox 1046 1745 1267 1777; x_wconf 83' lang='eng' dir='ltr'>Tomorrow’s</span> <span class='ocrx_word' id='word_1_173' title='bbox 1286 1757 1375 1777; x_wconf 90' lang='eng' dir='ltr'>news</span>
</span>
<span class='ocr_line' id='line_1_25' title="bbox 367 1807 858 1847; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_174' title='bbox 367 1807 529 1847; x_wconf 94' lang='eng' dir='ltr'>brews-up</span> <span class='ocrx_word' id='word_1_175' title='bbox 541 1807 575 1837; x_wconf 90' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_176' title='bbox 587 1807 706 1844; x_wconf 93' lang='eng' dir='ltr'>Korea,</span> <span class='ocrx_word' id='word_1_177' title='bbox 721 1807 858 1837; x_wconf 99' lang='eng' dir='ltr'>Kosovo</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_4' title="bbox 367 1864 1379 2024">
<span class='ocr_line' id='line_1_26' title="bbox 429 1864 1379 1905; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_178' title='bbox 429 1864 598 1905; x_wconf 93' lang='eng' dir='ltr'>Climbing</span> <span class='ocrx_word' id='word_1_179' title='bbox 615 1870 676 1894; x_wconf 99' lang='eng' dir='ltr'>out</span> <span class='ocrx_word' id='word_1_180' title='bbox 692 1864 734 1894; x_wconf 88' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_181' title='bbox 748 1874 766 1894; x_wconf 97' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_182' title='bbox 785 1864 1053 1894; x_wconf 94' lang='eng' dir='ltr'>recombination</span> <span class='ocrx_word' id='word_1_183' title='bbox 1072 1870 1251 1904; x_wconf 97' lang='eng' dir='ltr'>apparatus</span> <span class='ocrx_word' id='word_1_184' title='bbox 1269 1864 1307 1894; x_wconf 88' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_185' title='bbox 1322 1864 1379 1894; x_wconf 92' lang='eng' dir='ltr'>TA</span>
</span>
<span class='ocr_line' id='line_1_27' title="bbox 367 1924 1375 1965; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_186' title='bbox 367 1924 420 1954; x_wconf 92' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_187' title='bbox 434 1924 488 1954; x_wconf 92' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_188' title='bbox 504 1924 759 1964; x_wconf 94' lang='eng' dir='ltr'>tape-recorders</span> <span class='ocrx_word' id='word_1_189' title='bbox 778 1924 841 1954; x_wconf 97' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_190' title='bbox 859 1930 1004 1964; x_wconf 94' lang='eng' dir='ltr'>cut-ups,</span> <span class='ocrx_word' id='word_1_191' title='bbox 1021 1924 1215 1965; x_wconf 95' lang='eng' dir='ltr'>hypervirus</span> <span class='ocrx_word' id='word_1_192' title='bbox 1231 1924 1375 1954; x_wconf 88' lang='eng' dir='ltr'>infected</span>
</span>
<span class='ocr_line' id='line_1_28' title="bbox 369 1980 1375 2024; baseline 0 -12; x_size 43; x_descenders 11; x_ascenders 12"><span class='ocrx_word' id='word_1_193' title='bbox 369 1982 556 2023; x_wconf 93' lang='eng' dir='ltr'>Burroughs</span> <span class='ocrx_word' id='word_1_194' title='bbox 571 1982 605 2012; x_wconf 99' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_195' title='bbox 621 1990 706 2023; x_wconf 83' lang='eng'>1972,</span> <span class='ocrx_word' id='word_1_196' title='bbox 723 1988 757 2012; x_wconf 97' lang='eng' dir='ltr'>at</span> <span class='ocrx_word' id='word_1_197' title='bbox 772 1982 828 2012; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_198' title='bbox 843 1992 925 2022; x_wconf 99' lang='eng' dir='ltr'>cusp</span> <span class='ocrx_word' id='word_1_199' title='bbox 941 1982 980 2012; x_wconf 88' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_200' title='bbox 993 1980 1340 2024; x_wconf 75' lang='eng' dir='ltr'>K(ondratieff)-wave</span> <span class='ocrx_word' id='word_1_201' title='bbox 1355 1990 1375 2023; x_wconf 85' lang='eng'><em>9</em></span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_3' title="bbox 839 2106 898 2129">
<p class='ocr_par' dir='ltr' id='par_1_5' title="bbox 839 2106 898 2129">
<span class='ocr_line' id='line_1_29' title="bbox 839 2106 898 2129; baseline 0 0; x_size 31.333334; x_descenders 7.8333335; x_ascenders 7.8333335"><span class='ocrx_word' id='word_1_202' title='bbox 839 2106 898 2129; x_wconf 88' lang='eng'>388</span>
</span>
</p>
</div>
</div>
</body>
</html>

99
hypervirus/7.html
Unescape Escape View File

@ -0,0 +1,99 @@
<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
<head>
<title></title>
<meta http-equiv="Content-Type" content="text/html;charset=utf-8" />
<meta name='ocr-system' content='tesseract 3.04.01' />
<meta name='ocr-capabilities' content='ocr_page ocr_carea ocr_par ocr_line ocrx_word'/>
</head>
<body>
<div class='ocr_page' id='page_1' title='image "hypervirus-07.tif"; bbox 0 0 1749 2481; ppageno 0'>
<div class='ocr_carea' id='block_1_1' title="bbox 734 344 952 365">
<p class='ocr_par' dir='ltr' id='par_1_1' title="bbox 734 344 952 365">
<span class='ocr_line' id='line_1_1' title="bbox 734 344 952 365; baseline 0 0; x_size 27.333334; x_descenders 6.8333335; x_ascenders 6.8333335"><span class='ocrx_word' id='word_1_1' title='bbox 734 345 821 365; x_wconf 84' lang='eng' dir='ltr'>HYPE</span> <span class='ocrx_word' id='word_1_2' title='bbox 829 344 952 365; x_wconf 89' lang='eng' dir='ltr'><strong>RVIRUS</strong></span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_2' title="bbox 333 450 1345 1835">
<p class='ocr_par' dir='ltr' id='par_1_2' title="bbox 333 450 1345 1125">
<span class='ocr_line' id='line_1_2' title="bbox 336 450 1345 495; baseline 0 -13; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_3' title='bbox 336 450 406 495; x_wconf 91' lang='eng' dir='ltr'>(the</span> <span class='ocrx_word' id='word_1_4' title='bbox 419 452 591 482; x_wconf 85' lang='eng' dir='ltr'>threshold</span> <span class='ocrx_word' id='word_1_5' title='bbox 603 452 639 482; x_wconf 86' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_6' title='bbox 648 451 945 495; x_wconf 87' lang='eng' dir='ltr'>postmodernity).</span> <span class='ocrx_word' id='word_1_7' title='bbox 961 453 986 482; x_wconf 95' lang='eng' dir='ltr'>It</span> <span class='ocrx_word' id='word_1_8' title='bbox 998 452 1125 492; x_wconf 90' lang='eng' dir='ltr'>rapidly</span> <span class='ocrx_word' id='word_1_9' title='bbox 1135 452 1345 492; x_wconf 83' lang='eng' dir='ltr'>reprocessed</span>
</span>
<span class='ocr_line' id='line_1_3' title="bbox 335 511 1345 552; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_10' title='bbox 335 511 375 541; x_wconf 99' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_11' title='bbox 391 517 494 552; x_wconf 98' lang='eng' dir='ltr'>target</span> <span class='ocrx_word' id='word_1_12' title='bbox 507 511 581 541; x_wconf 99' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_13' title='bbox 593 521 638 541; x_wconf 90' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_14' title='bbox 652 511 854 552; x_wconf 92' lang='eng' dir='ltr'>intelligenic</span> <span class='ocrx_word' id='word_1_15' title='bbox 870 521 915 541; x_wconf 91' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_16' title='bbox 925 521 984 551; x_wconf 90' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_17' title='bbox 995 521 1049 551; x_wconf 91' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_18' title='bbox 1065 521 1109 541; x_wconf 92' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_19' title='bbox 1124 521 1168 541; x_wconf 92' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_20' title='bbox 1183 521 1345 541; x_wconf 90' lang='eng' dir='ltr'>nova-war</span>
</span>
<span class='ocr_line' id='line_1_4' title="bbox 336 569 1343 610; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_21' title='bbox 336 569 532 609; x_wconf 85' lang='eng' dir='ltr'>laboratory,</span> <span class='ocrx_word' id='word_1_22' title='bbox 541 569 749 610; x_wconf 90' lang='eng' dir='ltr'>volatilizing</span> <span class='ocrx_word' id='word_1_23' title='bbox 759 569 813 599; x_wconf 85' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_24' title='bbox 825 569 951 609; x_wconf 85' lang='eng' dir='ltr'>history</span> <span class='ocrx_word' id='word_1_25' title='bbox 959 569 996 599; x_wconf 86' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_26' title='bbox 1003 569 1165 610; x_wconf 87' lang='eng' dir='ltr'>language</span> <span class='ocrx_word' id='word_1_27' title='bbox 1175 569 1246 599; x_wconf 98' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_28' title='bbox 1255 569 1343 599; x_wconf 90' lang='eng' dir='ltr'>invo-</span>
</span>
<span class='ocr_line' id='line_1_5' title="bbox 335 627 1341 668; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_29' title='bbox 335 627 501 667; x_wconf 92' lang='eng' dir='ltr'>lutionary</span> <span class='ocrx_word' id='word_1_30' title='bbox 509 627 716 657; x_wconf 92' lang='eng' dir='ltr'>word-virus.</span> <span class='ocrx_word' id='word_1_31' title='bbox 729 627 901 657; x_wconf 90' lang='eng' dir='ltr'>Mutation</span> <span class='ocrx_word' id='word_1_32' title='bbox 912 633 961 657; x_wconf 99' lang='eng' dir='ltr'>rat</span> <span class='ocrx_word' id='word_1_33' title='bbox 971 633 1018 657; x_wconf 99' lang='eng' dir='ltr'>rat</span> <span class='ocrx_word' id='word_1_34' title='bbox 1029 633 1077 657; x_wconf 99' lang='eng' dir='ltr'>rat</span> <span class='ocrx_word' id='word_1_35' title='bbox 1087 633 1135 657; x_wconf 99' lang='eng' dir='ltr'>rat</span> <span class='ocrx_word' id='word_1_36' title='bbox 1145 633 1230 657; x_wconf 98' lang='eng' dir='ltr'>rates</span> <span class='ocrx_word' id='word_1_37' title='bbox 1235 627 1341 668; x_wconf 80' lang='eng' dir='ltr'>jump.</span>
</span>
<span class='ocr_line' id='line_1_6' title="bbox 333 685 1344 726; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_38' title='bbox 333 686 450 715; x_wconf 90' lang='eng' dir='ltr'>Vector</span> <span class='ocrx_word' id='word_1_39' title='bbox 469 685 621 715; x_wconf 90' lang='eng' dir='ltr'>switches</span> <span class='ocrx_word' id='word_1_40' title='bbox 641 685 788 726; x_wconf 87' lang='eng' dir='ltr'>through</span> <span class='ocrx_word' id='word_1_41' title='bbox 808 685 929 722; x_wconf 86' lang='eng' dir='ltr'>Butler,</span> <span class='ocrx_word' id='word_1_42' title='bbox 948 685 1088 722; x_wconf 86' lang='eng' dir='ltr'>Gibson,</span> <span class='ocrx_word' id='word_1_43' title='bbox 1107 685 1176 715; x_wconf 98' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_44' title='bbox 1193 685 1344 726; x_wconf 92' lang='eng' dir='ltr'>Cadigan</span>
</span>
<span class='ocr_line' id='line_1_7' title="bbox 335 744 1342 785; baseline -0.001 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_45' title='bbox 335 745 494 775; x_wconf 89' lang='eng' dir='ltr'>fine-tune</span> <span class='ocrx_word' id='word_1_46' title='bbox 511 744 552 774; x_wconf 98' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_47' title='bbox 567 744 721 785; x_wconf 92' lang='eng' dir='ltr'>synergic</span> <span class='ocrx_word' id='word_1_48' title='bbox 736 744 1010 781; x_wconf 90' lang='eng' dir='ltr'>interexcitation,</span> <span class='ocrx_word' id='word_1_49' title='bbox 1027 744 1140 784; x_wconf 94' lang='eng' dir='ltr'>silt-up</span> <span class='ocrx_word' id='word_1_50' title='bbox 1156 744 1342 784; x_wconf 85' lang='eng' dir='ltr'>cybershift-</span>
</span>
<span class='ocr_line' id='line_1_8' title="bbox 335 801 1341 846; baseline 0 -13; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_51' title='bbox 335 803 498 844; x_wconf 92' lang='eng' dir='ltr'>inducing</span> <span class='ocrx_word' id='word_1_52' title='bbox 513 801 858 846; x_wconf 90' lang='eng' dir='ltr'>K(uang)-potential,</span> <span class='ocrx_word' id='word_1_53' title='bbox 876 803 943 833; x_wconf 99' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_54' title='bbox 959 803 1142 833; x_wconf 92' lang='eng' dir='ltr'>trend-lock</span> <span class='ocrx_word' id='word_1_55' title='bbox 1155 809 1238 833; x_wconf 99' lang='eng' dir='ltr'>onto</span> <span class='ocrx_word' id='word_1_56' title='bbox 1254 811 1341 834; x_wconf 80' lang='eng'>11001</span>
</span>
<span class='ocr_line' id='line_1_9' title="bbox 335 869 1342 891; baseline 0.001 -1; x_size 41.853848; x_descenders 10.853847; x_ascenders 10.449843"><span class='ocrx_word' id='word_1_57' title='bbox 335 869 1342 891; x_wconf 91' lang='eng'>01001001010111101001011101011001000100010100100010</span>
</span>
<span class='ocr_line' id='line_1_10' title="bbox 335 928 1342 950; baseline 0 0; x_size 41.853848; x_descenders 10.853847; x_ascenders 10.449843"><span class='ocrx_word' id='word_1_58' title='bbox 335 928 1342 950; x_wconf 93' lang='eng' dir='ltr'>0100100100100101oo10110100100100100100100100111010</span>
</span>
<span class='ocr_line' id='line_1_11' title="bbox 335 978 1342 1018; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 9"><span class='ocrx_word' id='word_1_59' title='bbox 335 987 981 1008; x_wconf 94' lang='eng'>0100100100011001000101100101010</span> <span class='ocrx_word' id='word_1_60' title='bbox 997 978 1128 1018; x_wconf 88' lang='eng' dir='ltr'>K-punk</span> <span class='ocrx_word' id='word_1_61' title='bbox 1139 978 1252 1018; x_wconf 92' lang='eng' dir='ltr'>pulses</span> <span class='ocrx_word' id='word_1_62' title='bbox 1262 978 1342 1008; x_wconf 94' lang='eng' dir='ltr'>with</span>
</span>
<span class='ocr_line' id='line_1_12' title="bbox 336 1036 1343 1077; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_63' title='bbox 336 1036 799 1077; x_wconf 90' lang='eng' dir='ltr'>telematically-accelerating</span> <span class='ocrx_word' id='word_1_64' title='bbox 809 1036 1048 1076; x_wconf 98' lang='eng' dir='ltr'>neoreplicator</span> <span class='ocrx_word' id='word_1_65' title='bbox 1057 1036 1196 1076; x_wconf 92' lang='eng' dir='ltr'>plicator</span> <span class='ocrx_word' id='word_1_66' title='bbox 1205 1036 1343 1076; x_wconf 89' lang='eng' dir='ltr'>plicator</span>
</span>
<span class='ocr_line' id='line_1_13' title="bbox 334 1095 610 1125; baseline 0 0; x_size 40.563274; x_descenders 10.563273; x_ascenders 10"><span class='ocrx_word' id='word_1_67' title='bbox 334 1095 610 1125; x_wconf 89' lang='eng' dir='ltr'>contamination.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_3' title="bbox 333 1150 1341 1417">
<span class='ocr_line' id='line_1_14' title="bbox 399 1150 1341 1194; baseline 0.002 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_68' title='bbox 399 1150 566 1194; x_wconf 78' lang='eng' dir='ltr'>‘Looking</span> <span class='ocrx_word' id='word_1_69' title='bbox 576 1153 632 1183; x_wconf 87' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_70' title='bbox 643 1163 662 1183; x_wconf 90' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_71' title='bbox 676 1153 724 1183; x_wconf 99' lang='eng' dir='ltr'>hit</span> <span class='ocrx_word' id='word_1_72' title='bbox 737 1153 776 1183; x_wconf 86' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_73' title='bbox 786 1151 1003 1183; x_wconf 81' lang='eng' dir='ltr'>snowcrash?’</span> <span class='ocrx_word' id='word_1_74' title='bbox 1016 1157 1036 1183; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_75' title='bbox 1047 1157 1108 1183; x_wconf 49' lang='eng' dir='ltr'>##fi</span> <span class='ocrx_word' id='word_1_76' title='bbox 1120 1157 1140 1183; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_77' title='bbox 1173 1157 1215 1183; x_wconf 72' lang='eng'>##</span> <span class='ocrx_word' id='word_1_78' title='bbox 1238 1158 1255 1183; x_wconf 74' lang='eng'>#</span> <span class='ocrx_word' id='word_1_79' title='bbox 1277 1159 1297 1185; x_wconf 71' lang='eng'>#</span> <span class='ocrx_word' id='word_1_80' title='bbox 1321 1159 1341 1185; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_15' title="bbox 333 1216 1341 1242; baseline 0 0; x_size 35.103226; x_descenders 9.1032257; x_ascenders 8.7643843"><span class='ocrx_word' id='word_1_81' title='bbox 333 1216 416 1242; x_wconf 71' lang='eng'>###</span> <span class='ocrx_word' id='word_1_82' title='bbox 449 1216 820 1242; x_wconf 55' lang='eng' dir='ltr'>##W########</span> <span class='ocrx_word' id='word_1_83' title='bbox 853 1216 959 1242; x_wconf 69' lang='eng'>####</span> <span class='ocrx_word' id='word_1_84' title='bbox 1011 1216 1175 1242; x_wconf 69' lang='eng'>######</span> <span class='ocrx_word' id='word_1_85' title='bbox 1218 1216 1238 1242; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_86' title='bbox 1267 1216 1288 1242; x_wconf 70' lang='eng'>#</span> <span class='ocrx_word' id='word_1_87' title='bbox 1321 1216 1341 1242; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_16' title="bbox 333 1274 1340 1302; baseline 0.001 -2; x_size 35.103226; x_descenders 9.1032257; x_ascenders 8.7643843"><span class='ocrx_word' id='word_1_88' title='bbox 333 1274 438 1300; x_wconf 70' lang='eng'>####</span> <span class='ocrx_word' id='word_1_89' title='bbox 472 1274 492 1300; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_90' title='bbox 528 1274 633 1300; x_wconf 47' lang='eng' dir='ltr'>##W</span> <span class='ocrx_word' id='word_1_91' title='bbox 668 1274 688 1300; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_92' title='bbox 723 1274 743 1300; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_93' title='bbox 778 1274 798 1300; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_94' title='bbox 832 1274 939 1300; x_wconf 71' lang='eng'>###</span> <span class='ocrx_word' id='word_1_95' title='bbox 972 1274 1213 1300; x_wconf 71' lang='eng'>#######</span> <span class='ocrx_word' id='word_1_96' title='bbox 1246 1276 1264 1300; x_wconf 73' lang='eng'>#</span> <span class='ocrx_word' id='word_1_97' title='bbox 1320 1276 1340 1302; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_17' title="bbox 333 1333 1341 1359; baseline 0 0; x_size 35.103226; x_descenders 9.1032257; x_ascenders 8.7643843"><span class='ocrx_word' id='word_1_98' title='bbox 333 1333 500 1359; x_wconf 71' lang='eng'>#######</span> <span class='ocrx_word' id='word_1_99' title='bbox 555 1333 703 1359; x_wconf 47' lang='eng' dir='ltr'>##fifi</span> <span class='ocrx_word' id='word_1_100' title='bbox 768 1333 810 1359; x_wconf 70' lang='eng'>##</span> <span class='ocrx_word' id='word_1_101' title='bbox 832 1333 979 1359; x_wconf 69' lang='eng'>#####</span> <span class='ocrx_word' id='word_1_102' title='bbox 1011 1333 1051 1359; x_wconf 70' lang='eng'>##</span> <span class='ocrx_word' id='word_1_103' title='bbox 1083 1333 1103 1359; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_104' title='bbox 1156 1333 1176 1359; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_105' title='bbox 1209 1333 1341 1359; x_wconf 68' lang='eng'>#####</span>
</span>
<span class='ocr_line' id='line_1_18' title="bbox 333 1391 1162 1417; baseline 0 0; x_size 35.103226; x_descenders 9.1032257; x_ascenders 8.7643843"><span class='ocrx_word' id='word_1_106' title='bbox 333 1391 417 1417; x_wconf 71' lang='eng'>###</span> <span class='ocrx_word' id='word_1_107' title='bbox 451 1391 972 1417; x_wconf 47' lang='eng' dir='ltr'>##W###########</span> <span class='ocrx_word' id='word_1_108' title='bbox 1015 1391 1055 1417; x_wconf 70' lang='eng'>##</span> <span class='ocrx_word' id='word_1_109' title='bbox 1088 1391 1108 1417; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_110' title='bbox 1141 1391 1162 1417; x_wconf 70' lang='eng'>#</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_4' title="bbox 333 1445 1341 1835">
<span class='ocr_line' id='line_1_19' title="bbox 395 1445 1340 1485; baseline 0.001 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_111' title='bbox 395 1445 440 1475; x_wconf 90' lang='eng' dir='ltr'>As</span> <span class='ocrx_word' id='word_1_112' title='bbox 448 1445 670 1485; x_wconf 91' lang='eng' dir='ltr'>postmodern</span> <span class='ocrx_word' id='word_1_113' title='bbox 679 1445 805 1475; x_wconf 92' lang='eng' dir='ltr'>culture</span> <span class='ocrx_word' id='word_1_114' title='bbox 815 1455 938 1475; x_wconf 92' lang='eng' dir='ltr'>crosses</span> <span class='ocrx_word' id='word_1_115' title='bbox 949 1451 982 1475; x_wconf 99' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_116' title='bbox 991 1445 1199 1485; x_wconf 90' lang='eng' dir='ltr'>hypermania</span> <span class='ocrx_word' id='word_1_117' title='bbox 1210 1445 1268 1475; x_wconf 91' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_118' title='bbox 1278 1450 1340 1476; x_wconf 43' lang='eng'>##4##</span>
</span>
<span class='ocr_line' id='line_1_20' title="bbox 333 1508 1341 1535; baseline 0 -1; x_size 35.103226; x_descenders 9.1032257; x_ascenders 8.7643843"><span class='ocrx_word' id='word_1_119' title='bbox 333 1508 1259 1534; x_wconf 47' lang='eng' dir='ltr'>##################WWW#</span> <span class='ocrx_word' id='word_1_120' title='bbox 1321 1509 1341 1535; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_21' title="bbox 333 1566 1339 1592; baseline 0 0; x_size 35.103226; x_descenders 9.1032257; x_ascenders 8.7643843"><span class='ocrx_word' id='word_1_121' title='bbox 333 1566 354 1592; x_wconf 70' lang='eng'>#</span> <span class='ocrx_word' id='word_1_122' title='bbox 387 1566 481 1592; x_wconf 71' lang='eng'>####</span> <span class='ocrx_word' id='word_1_123' title='bbox 515 1566 750 1592; x_wconf 69' lang='eng'>#######</span> <span class='ocrx_word' id='word_1_124' title='bbox 785 1566 805 1592; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_125' title='bbox 839 1566 1285 1592; x_wconf 56' lang='eng' dir='ltr'>##########W#</span> <span class='ocrx_word' id='word_1_126' title='bbox 1319 1566 1339 1592; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_22' title="bbox 333 1625 1340 1652; baseline 0 -1; x_size 35.103226; x_descenders 9.1032257; x_ascenders 8.7643843"><span class='ocrx_word' id='word_1_127' title='bbox 333 1625 912 1651; x_wconf 69' lang='eng'>#################</span> <span class='ocrx_word' id='word_1_128' title='bbox 954 1625 1014 1651; x_wconf 71' lang='eng'>##</span> <span class='ocrx_word' id='word_1_129' title='bbox 1054 1625 1074 1651; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_130' title='bbox 1117 1625 1276 1651; x_wconf 43' lang='eng' dir='ltr'>##fitfi</span> <span class='ocrx_word' id='word_1_131' title='bbox 1320 1626 1340 1652; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_23' title="bbox 333 1683 1339 1709; baseline 0 0; x_size 35.103226; x_descenders 9.1032257; x_ascenders 8.7643843"><span class='ocrx_word' id='word_1_132' title='bbox 333 1683 447 1709; x_wconf 72' lang='eng'>#####</span> <span class='ocrx_word' id='word_1_133' title='bbox 504 1683 545 1709; x_wconf 72' lang='eng'>##</span> <span class='ocrx_word' id='word_1_134' title='bbox 565 1683 708 1709; x_wconf 56' lang='eng'>######</span> <span class='ocrx_word' id='word_1_135' title='bbox 747 1683 798 1709; x_wconf 71' lang='eng'>##</span> <span class='ocrx_word' id='word_1_136' title='bbox 817 1683 838 1709; x_wconf 70' lang='eng'>#</span> <span class='ocrx_word' id='word_1_137' title='bbox 859 1683 920 1709; x_wconf 51' lang='eng' dir='ltr'><em>W</em></span> <span class='ocrx_word' id='word_1_138' title='bbox 939 1683 980 1709; x_wconf 71' lang='eng'>##</span> <span class='ocrx_word' id='word_1_139' title='bbox 1007 1683 1047 1709; x_wconf 70' lang='eng'>##</span> <span class='ocrx_word' id='word_1_140' title='bbox 1075 1683 1095 1709; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_141' title='bbox 1114 1683 1222 1709; x_wconf 71' lang='eng'>####</span> <span class='ocrx_word' id='word_1_142' title='bbox 1241 1683 1339 1709; x_wconf 45' lang='eng' dir='ltr'>##ifit</span>
</span>
<span class='ocr_line' id='line_1_24' title="bbox 333 1736 1339 1777; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_143' title='bbox 333 1741 354 1767; x_wconf 70' lang='eng'>#</span> <span class='ocrx_word' id='word_1_144' title='bbox 366 1742 443 1776; x_wconf 99' lang='eng' dir='ltr'>stop</span> <span class='ocrx_word' id='word_1_145' title='bbox 455 1742 532 1776; x_wconf 99' lang='eng' dir='ltr'>stop</span> <span class='ocrx_word' id='word_1_146' title='bbox 544 1746 589 1777; x_wconf 99' lang='eng' dir='ltr'>go</span> <span class='ocrx_word' id='word_1_147' title='bbox 602 1742 679 1776; x_wconf 99' lang='eng' dir='ltr'>stop</span> <span class='ocrx_word' id='word_1_148' title='bbox 691 1746 736 1777; x_wconf 99' lang='eng' dir='ltr'>go</span> <span class='ocrx_word' id='word_1_149' title='bbox 749 1742 825 1776; x_wconf 99' lang='eng' dir='ltr'>stop</span> <span class='ocrx_word' id='word_1_150' title='bbox 837 1746 883 1777; x_wconf 99' lang='eng' dir='ltr'>go</span> <span class='ocrx_word' id='word_1_151' title='bbox 895 1746 939 1777; x_wconf 97' lang='eng' dir='ltr'>go</span> <span class='ocrx_word' id='word_1_152' title='bbox 951 1746 1030 1777; x_wconf 98' lang='eng' dir='ltr'>goes</span> <span class='ocrx_word' id='word_1_153' title='bbox 1043 1746 1134 1773; x_wconf 91' lang='eng' dir='ltr'>nova,</span> <span class='ocrx_word' id='word_1_154' title='bbox 1149 1736 1172 1766; x_wconf 94' lang='eng' dir='ltr'>it</span> <span class='ocrx_word' id='word_1_155' title='bbox 1185 1736 1339 1777; x_wconf 87' lang='eng' dir='ltr'>singular-</span>
</span>
<span class='ocr_line' id='line_1_25' title="bbox 335 1794 1341 1835; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_156' title='bbox 335 1794 400 1824; x_wconf 94' lang='eng' dir='ltr'>izes</span> <span class='ocrx_word' id='word_1_157' title='bbox 407 1794 645 1834; x_wconf 91' lang='eng' dir='ltr'>multiplicities</span> <span class='ocrx_word' id='word_1_158' title='bbox 653 1794 743 1824; x_wconf 92' lang='eng' dir='ltr'>cities</span> <span class='ocrx_word' id='word_1_159' title='bbox 753 1794 842 1824; x_wconf 92' lang='eng' dir='ltr'>cities</span> <span class='ocrx_word' id='word_1_160' title='bbox 852 1794 890 1824; x_wconf 86' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_161' title='bbox 897 1794 1066 1834; x_wconf 93' lang='eng' dir='ltr'>invasively</span> <span class='ocrx_word' id='word_1_162' title='bbox 1074 1794 1341 1835; x_wconf 89' lang='eng' dir='ltr'>autoreplicating</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_3' title="bbox 335 1851 1341 1957">
<p class='ocr_par' dir='ltr' id='par_1_5' title="bbox 335 1851 1341 1957">
<span class='ocr_line' id='line_1_26' title="bbox 335 1851 1336 1897; baseline -0.001 -14; x_size 42; x_descenders 11; x_ascenders 11"><span class='ocrx_word' id='word_1_163' title='bbox 335 1853 614 1894; x_wconf 90' lang='eng' dir='ltr'>autoreplicating</span> <span class='ocrx_word' id='word_1_164' title='bbox 623 1853 868 1893; x_wconf 89' lang='eng' dir='ltr'>plexoweapon</span> <span class='ocrx_word' id='word_1_165' title='bbox 879 1869 901 1873; x_wconf 98' lang='eng'><em>-</em></span> <span class='ocrx_word' id='word_1_166' title='bbox 912 1859 1044 1893; x_wconf 98' lang='eng' dir='ltr'>systems</span> <span class='ocrx_word' id='word_1_167' title='bbox 1057 1851 1109 1896; x_wconf 70' lang='eng'>(0</span> <span class='ocrx_word' id='word_1_168' title='bbox 1123 1852 1134 1896; x_wconf 90' lang='eng'>(</span> <span class='ocrx_word' id='word_1_169' title='bbox 1146 1852 1215 1897; x_wconf 84' lang='eng'>((()</span> <span class='ocrx_word' id='word_1_170' title='bbox 1229 1851 1269 1896; x_wconf 88' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_171' title='bbox 1283 1851 1295 1896; x_wconf 90' lang='eng'>(</span> <span class='ocrx_word' id='word_1_172' title='bbox 1308 1852 1336 1897; x_wconf 87' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_27' title="bbox 336 1908 1341 1957; baseline -0.006 0; x_size 59.8125; x_descenders 15.8125; x_ascenders 15.8125"><span class='ocrx_word' id='word_1_173' title='bbox 336 1909 391 1957; x_wconf 86' lang='eng'>())</span> <span class='ocrx_word' id='word_1_174' title='bbox 406 1911 451 1956; x_wconf 90' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_175' title='bbox 465 1911 477 1955; x_wconf 91' lang='eng'>)</span> <span class='ocrx_word' id='word_1_176' title='bbox 492 1909 521 1954; x_wconf 84' lang='eng'>((</span> <span class='ocrx_word' id='word_1_177' title='bbox 533 1910 546 1954; x_wconf 88' lang='eng'>)</span> <span class='ocrx_word' id='word_1_178' title='bbox 559 1910 572 1954; x_wconf 88' lang='eng'>)</span> <span class='ocrx_word' id='word_1_179' title='bbox 587 1909 599 1954; x_wconf 93' lang='eng'>(</span> <span class='ocrx_word' id='word_1_180' title='bbox 614 1908 693 1954; x_wconf 69' lang='eng' dir='ltr'>D»)</span> <span class='ocrx_word' id='word_1_181' title='bbox 708 1909 720 1954; x_wconf 91' lang='eng'>(</span> <span class='ocrx_word' id='word_1_182' title='bbox 733 1910 746 1954; x_wconf 88' lang='eng'>)</span> <span class='ocrx_word' id='word_1_183' title='bbox 761 1909 773 1954; x_wconf 93' lang='eng'>(</span> <span class='ocrx_word' id='word_1_184' title='bbox 787 1908 833 1953; x_wconf 69' lang='eng' dir='ltr'>D)</span> <span class='ocrx_word' id='word_1_185' title='bbox 856 1909 869 1953; x_wconf 88' lang='eng'>)</span> <span class='ocrx_word' id='word_1_186' title='bbox 885 1910 953 1940; x_wconf 65' lang='eng' dir='ltr'>that</span> <span class='ocrx_word' id='word_1_187' title='bbox 964 1920 1015 1940; x_wconf 66' lang='eng' dir='ltr'>are</span> <span class='ocrx_word' id='word_1_188' title='bbox 1027 1920 1057 1940; x_wconf 69' lang='eng' dir='ltr'>r6</span> <span class='ocrx_word' id='word_1_189' title='bbox 1069 1920 1101 1940; x_wconf 70' lang='eng' dir='ltr'>r6</span> <span class='ocrx_word' id='word_1_190' title='bbox 1113 1920 1145 1940; x_wconf 70' lang='eng' dir='ltr'>r6</span> <span class='ocrx_word' id='word_1_191' title='bbox 1156 1920 1187 1940; x_wconf 70' lang='eng' dir='ltr'>r6</span> <span class='ocrx_word' id='word_1_192' title='bbox 1200 1910 1341 1951; x_wconf 72' lang='eng' dir='ltr'>nothing</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_4' title="bbox 336 1969 1338 2010">
<p class='ocr_par' dir='ltr' id='par_1_6' title="bbox 336 1969 1338 2010">
<span class='ocr_line' id='line_1_28' title="bbox 336 1969 1338 2010; baseline -0.001 -10; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_193' title='bbox 336 1970 471 2010; x_wconf 92' lang='eng' dir='ltr'>beyond</span> <span class='ocrx_word' id='word_1_194' title='bbox 487 1969 569 1999; x_wconf 98' lang='eng' dir='ltr'>their</span> <span class='ocrx_word' id='word_1_195' title='bbox 582 1979 649 1999; x_wconf 90' lang='eng' dir='ltr'>war</span> <span class='ocrx_word' id='word_1_196' title='bbox 660 1969 756 1999; x_wconf 90' lang='eng' dir='ltr'>AGA</span> <span class='ocrx_word' id='word_1_197' title='bbox 763 1969 860 1999; x_wconf 90' lang='eng' dir='ltr'>AGA</span> <span class='ocrx_word' id='word_1_198' title='bbox 870 1969 997 2010; x_wconf 90' lang='eng' dir='ltr'>against</span> <span class='ocrx_word' id='word_1_199' title='bbox 1011 1969 1152 2009; x_wconf 87' lang='eng' dir='ltr'>security.</span> <span class='ocrx_word' id='word_1_200' title='bbox 1166 1969 1240 1999; x_wconf 88' lang='eng' dir='ltr'>This</span> <span class='ocrx_word' id='word_1_201' title='bbox 1252 1969 1278 1999; x_wconf 94' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_202' title='bbox 1294 1979 1338 1999; x_wconf 99' lang='eng' dir='ltr'>no</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_5' title="bbox 813 2092 875 2115">
<p class='ocr_par' dir='ltr' id='par_1_7' title="bbox 813 2092 875 2115">
<span class='ocr_line' id='line_1_29' title="bbox 813 2092 875 2115; baseline 0 0; x_size 31.333334; x_descenders 7.8333335; x_ascenders 7.8333335"><span class='ocrx_word' id='word_1_203' title='bbox 813 2092 875 2115; x_wconf 84' lang='eng'>389</span>
</span>
</p>
</div>
</div>
</body>
</html>

88
hypervirus/8.html
Unescape Escape View File

@ -0,0 +1,88 @@
<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
<head>
<title></title>
<meta http-equiv="Content-Type" content="text/html;charset=utf-8" />
<meta name='ocr-system' content='tesseract 3.04.01' />
<meta name='ocr-capabilities' content='ocr_page ocr_carea ocr_par ocr_line ocrx_word'/>
</head>
<body>
<div class='ocr_page' id='page_1' title='image "hypervirus-08.tif"; bbox 0 0 1749 2481; ppageno 0'>
<div class='ocr_carea' id='block_1_1' title="bbox 704 365 1040 386">
<p class='ocr_par' dir='ltr' id='par_1_1' title="bbox 704 365 1040 386">
<span class='ocr_line' id='line_1_1' title="bbox 704 365 1040 386; baseline 0 0; x_size 27.333334; x_descenders 6.8333335; x_ascenders 6.8333335"><span class='ocrx_word' id='word_1_1' title='bbox 704 365 843 386; x_wconf 85' lang='eng' dir='ltr'><strong>FANGED</strong></span> <span class='ocrx_word' id='word_1_2' title='bbox 861 366 1040 386; x_wconf 85' lang='eng' dir='ltr'><strong>NOUMENA</strong></span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_2' title="bbox 365 474 1380 2032">
<p class='ocr_par' dir='ltr' id='par_1_2' title="bbox 365 474 1380 862">
<span class='ocr_line' id='line_1_2' title="bbox 365 474 1377 515; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_3' title='bbox 365 474 482 515; x_wconf 83' lang='eng' dir='ltr'>longer</span> <span class='ocrx_word' id='word_1_4' title='bbox 491 484 509 504; x_wconf 99' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_5' title='bbox 518 474 672 514; x_wconf 83' lang='eng' dir='ltr'>question</span> <span class='ocrx_word' id='word_1_6' title='bbox 682 484 727 504; x_wconf 99' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_7' title='bbox 737 474 789 504; x_wconf 80' lang='eng' dir='ltr'>off</span> <span class='ocrx_word' id='word_1_8' title='bbox 794 484 841 504; x_wconf 98' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_9' title='bbox 851 474 889 504; x_wconf 86' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_10' title='bbox 896 474 1097 515; x_wconf 83' lang='eng' dir='ltr'>ideological</span> <span class='ocrx_word' id='word_1_11' title='bbox 1107 474 1377 514; x_wconf 85' lang='eng' dir='ltr'>representation,</span>
</span>
<span class='ocr_line' id='line_1_3' title="bbox 365 530 1380 571; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_12' title='bbox 365 540 571 571; x_wconf 95' lang='eng' dir='ltr'>exogeneous</span> <span class='ocrx_word' id='word_1_13' title='bbox 581 530 727 570; x_wconf 91' lang='eng' dir='ltr'>political</span> <span class='ocrx_word' id='word_1_14' title='bbox 737 530 976 567; x_wconf 86' lang='eng' dir='ltr'>mobilization,</span> <span class='ocrx_word' id='word_1_15' title='bbox 988 530 1174 560; x_wconf 92' lang='eng' dir='ltr'>theoretical</span> <span class='ocrx_word' id='word_1_16' title='bbox 1184 530 1330 570; x_wconf 90' lang='eng' dir='ltr'>critique,</span> <span class='ocrx_word' id='word_1_17' title='bbox 1339 535 1380 560; x_wconf 76' lang='eng'>##</span>
</span>
<span class='ocr_line' id='line_1_4' title="bbox 365 594 1379 619; baseline 0 0; x_size 31.318672; x_descenders 6.3186722; x_ascenders 8.6017723"><span class='ocrx_word' id='word_1_18' title='bbox 365 594 560 619; x_wconf 55' lang='eng' dir='ltr'>W#####</span> <span class='ocrx_word' id='word_1_19' title='bbox 581 594 601 619; x_wconf 75' lang='eng'>#</span> <span class='ocrx_word' id='word_1_20' title='bbox 622 594 1231 619; x_wconf 72' lang='eng'>######################</span> <span class='ocrx_word' id='word_1_21' title='bbox 1275 594 1379 619; x_wconf 76' lang='eng'>####</span>
</span>
<span class='ocr_line' id='line_1_5' title="bbox 366 647 1377 688; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_22' title='bbox 366 652 406 678; x_wconf 72' lang='eng'>##</span> <span class='ocrx_word' id='word_1_23' title='bbox 439 652 459 677; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_24' title='bbox 471 652 491 677; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_25' title='bbox 503 652 523 677; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_26' title='bbox 555 652 575 677; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_27' title='bbox 587 652 607 677; x_wconf 76' lang='eng'>#</span> <span class='ocrx_word' id='word_1_28' title='bbox 619 652 681 677; x_wconf 76' lang='eng'>###</span> <span class='ocrx_word' id='word_1_29' title='bbox 738 652 758 677; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_30' title='bbox 781 652 801 677; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_31' title='bbox 848 652 868 677; x_wconf 76' lang='eng'>#</span> <span class='ocrx_word' id='word_1_32' title='bbox 880 651 943 677; x_wconf 54' lang='eng' dir='ltr'>#W</span> <span class='ocrx_word' id='word_1_33' title='bbox 989 652 1009 677; x_wconf 76' lang='eng'>#</span> <span class='ocrx_word' id='word_1_34' title='bbox 1023 657 1061 677; x_wconf 99' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_35' title='bbox 1074 647 1226 688; x_wconf 87' lang='eng' dir='ltr'>strategic</span> <span class='ocrx_word' id='word_1_36' title='bbox 1239 647 1377 677; x_wconf 93' lang='eng' dir='ltr'>orienta-</span>
</span>
<span class='ocr_line' id='line_1_6' title="bbox 368 706 1380 747; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_37' title='bbox 368 706 447 742; x_wconf 99' lang='eng' dir='ltr'>tion,</span> <span class='ocrx_word' id='word_1_38' title='bbox 461 706 520 736; x_wconf 91' lang='eng' dir='ltr'>but</span> <span class='ocrx_word' id='word_1_39' title='bbox 532 706 569 736; x_wconf 88' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_40' title='bbox 577 706 823 736; x_wconf 90' lang='eng' dir='ltr'>decentralized</span> <span class='ocrx_word' id='word_1_41' title='bbox 833 706 975 736; x_wconf 94' lang='eng' dir='ltr'>cultural</span> <span class='ocrx_word' id='word_1_42' title='bbox 988 706 1152 747; x_wconf 88' lang='eng' dir='ltr'>diagrams</span> <span class='ocrx_word' id='word_1_43' title='bbox 1167 706 1380 747; x_wconf 87' lang='eng' dir='ltr'>functioning</span>
</span>
<span class='ocr_line' id='line_1_7' title="bbox 366 764 1378 805; baseline 0 -11; x_size 37.706532; x_descenders 7.7065306; x_ascenders 10"><span class='ocrx_word' id='word_1_44' title='bbox 366 774 400 794; x_wconf 99' lang='eng' dir='ltr'>as</span> <span class='ocrx_word' id='word_1_45' title='bbox 411 764 592 794; x_wconf 92' lang='eng' dir='ltr'>immanent</span> <span class='ocrx_word' id='word_1_46' title='bbox 603 764 708 794; x_wconf 87' lang='eng' dir='ltr'>forces</span> <span class='ocrx_word' id='word_1_47' title='bbox 720 764 759 794; x_wconf 86' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_48' title='bbox 766 764 990 805; x_wconf 87' lang='eng' dir='ltr'>antagonism.</span> <span class='ocrx_word' id='word_1_49' title='bbox 1004 773 1109 794; x_wconf 89' lang='eng' dir='ltr'>K-war</span> <span class='ocrx_word' id='word_1_50' title='bbox 1117 764 1247 794; x_wconf 94' lang='eng' dir='ltr'>derives</span> <span class='ocrx_word' id='word_1_51' title='bbox 1257 764 1296 794; x_wconf 99' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_52' title='bbox 1309 764 1378 794; x_wconf 95' lang='eng' dir='ltr'>sole</span>
</span>
<span class='ocr_line' id='line_1_8' title="bbox 366 822 1211 862; baseline 0 -10; x_size 37.706532; x_descenders 7.7065306; x_ascenders 10"><span class='ocrx_word' id='word_1_53' title='bbox 366 822 545 852; x_wconf 93' lang='eng' dir='ltr'>coherence</span> <span class='ocrx_word' id='word_1_54' title='bbox 559 822 642 852; x_wconf 87' lang='eng' dir='ltr'>from</span> <span class='ocrx_word' id='word_1_55' title='bbox 657 822 712 852; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_56' title='bbox 726 822 819 862; x_wconf 90' lang='eng' dir='ltr'>unity</span> <span class='ocrx_word' id='word_1_57' title='bbox 832 822 871 852; x_wconf 86' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_58' title='bbox 881 822 920 852; x_wconf 99' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_59' title='bbox 937 822 1000 852; x_wconf 87' lang='eng' dir='ltr'>foe.</span> <span class='ocrx_word' id='word_1_60' title='bbox 1017 823 1211 852; x_wconf 87' lang='eng' dir='ltr'><strong>RETURN.</strong></span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_3' title="bbox 367 877 1379 2032">
<span class='ocr_line' id='line_1_9' title="bbox 427 877 1375 923; baseline 0 -13; x_size 40.706532; x_descenders 7.7065306; x_ascenders 13"><span class='ocrx_word' id='word_1_61' title='bbox 427 879 602 918; x_wconf 87' lang='eng' dir='ltr'>Ana/Cata.</span> <span class='ocrx_word' id='word_1_62' title='bbox 614 880 732 910; x_wconf 91' lang='eng' dir='ltr'>Switch</span> <span class='ocrx_word' id='word_1_63' title='bbox 739 878 1009 922; x_wconf 87' lang='eng' dir='ltr'>cur((re)re)rent.</span> <span class='ocrx_word' id='word_1_64' title='bbox 1020 878 1049 923; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_65' title='bbox 1059 878 1071 922; x_wconf 89' lang='eng'>)</span> <span class='ocrx_word' id='word_1_66' title='bbox 1083 877 1110 922; x_wconf 90' lang='eng'>((</span> <span class='ocrx_word' id='word_1_67' title='bbox 1120 877 1164 922; x_wconf 87' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_68' title='bbox 1174 877 1239 922; x_wconf 93' lang='eng' dir='ltr'>O(r</span> <span class='ocrx_word' id='word_1_69' title='bbox 1246 878 1342 923; x_wconf 89' lang='eng' dir='ltr'>an)d(</span> <span class='ocrx_word' id='word_1_70' title='bbox 1352 879 1375 923; x_wconf 89' lang='eng'>)</span>
</span>
<span class='ocr_line' id='line_1_10' title="bbox 369 935 1376 981; baseline 0 -14; x_size 39.706532; x_descenders 7.7065306; x_ascenders 12"><span class='ocrx_word' id='word_1_71' title='bbox 369 935 434 980; x_wconf 90' lang='eng' dir='ltr'>Ko(</span> <span class='ocrx_word' id='word_1_72' title='bbox 452 938 465 966; x_wconf 94' lang='eng' dir='ltr'>I</span> <span class='ocrx_word' id='word_1_73' title='bbox 481 937 592 978; x_wconf 89' lang='eng' dir='ltr'>Ching</span> <span class='ocrx_word' id='word_1_74' title='bbox 607 937 785 978; x_wconf 95' lang='eng' dir='ltr'>hexagram</span> <span class='ocrx_word' id='word_1_75' title='bbox 815 946 866 978; x_wconf 78' lang='eng'>49:</span> <span class='ocrx_word' id='word_1_76' title='bbox 886 937 1089 967; x_wconf 91' lang='eng' dir='ltr'>Revolution</span> <span class='ocrx_word' id='word_1_77' title='bbox 1105 935 1270 980; x_wconf 94' lang='eng' dir='ltr'>(Molting</span> <span class='ocrx_word' id='word_1_78' title='bbox 1284 936 1314 980; x_wconf 86' lang='eng'>((</span> <span class='ocrx_word' id='word_1_79' title='bbox 1331 936 1376 981; x_wconf 87' lang='eng'>)))</span>
</span>
<span class='ocr_line' id='line_1_11' title="bbox 367 993 1376 1039; baseline 0 -13; x_size 40.706532; x_descenders 7.7065306; x_ascenders 13"><span class='ocrx_word' id='word_1_80' title='bbox 367 996 471 1026; x_wconf 93' lang='eng' dir='ltr'>leaves</span> <span class='ocrx_word' id='word_1_81' title='bbox 487 993 499 1038; x_wconf 94' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_82' title='bbox 516 994 528 1038; x_wconf 89' lang='eng'>)</span> <span class='ocrx_word' id='word_1_83' title='bbox 544 996 688 1037; x_wconf 98' lang='eng' dir='ltr'>nothing</span> <span class='ocrx_word' id='word_1_84' title='bbox 701 995 820 1039; x_wconf 89' lang='eng' dir='ltr'>i)ntact</span> <span class='ocrx_word' id='word_1_85' title='bbox 833 996 949 1026; x_wconf 90' lang='eng' dir='ltr'><strong>TACT</strong></span> <span class='ocrx_word' id='word_1_86' title='bbox 961 996 1082 1026; x_wconf 91' lang='eng' dir='ltr'>TACT.</span> <span class='ocrx_word' id='word_1_87' title='bbox 1101 994 1145 1039; x_wconf 87' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_88' title='bbox 1163 994 1192 1038; x_wconf 87' lang='eng'>((</span> <span class='ocrx_word' id='word_1_89' title='bbox 1209 994 1239 1038; x_wconf 87' lang='eng'>((</span> <span class='ocrx_word' id='word_1_90' title='bbox 1255 995 1267 1039; x_wconf 89' lang='eng'>)</span> <span class='ocrx_word' id='word_1_91' title='bbox 1284 994 1314 1038; x_wconf 87' lang='eng'>((</span> <span class='ocrx_word' id='word_1_92' title='bbox 1331 994 1376 1039; x_wconf 88' lang='eng'>)))</span>
</span>
<span class='ocr_line' id='line_1_12' title="bbox 368 1052 1379 1097; baseline -0.001 0; x_size 55.120865; x_descenders 11.120863; x_ascenders 15.13912"><span class='ocrx_word' id='word_1_93' title='bbox 368 1053 397 1097; x_wconf 92' lang='eng'>((</span> <span class='ocrx_word' id='word_1_94' title='bbox 415 1052 427 1097; x_wconf 94' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_95' title='bbox 444 1052 456 1097; x_wconf 94' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_96' title='bbox 475 1053 519 1097; x_wconf 85' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_97' title='bbox 538 1052 566 1096; x_wconf 84' lang='eng'>((</span> <span class='ocrx_word' id='word_1_98' title='bbox 584 1053 596 1097; x_wconf 85' lang='eng'>)</span> <span class='ocrx_word' id='word_1_99' title='bbox 614 1052 642 1096; x_wconf 84' lang='eng'>))</span> <span class='ocrx_word' id='word_1_100' title='bbox 662 1052 674 1097; x_wconf 94' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_101' title='bbox 693 1052 722 1096; x_wconf 86' lang='eng'>))</span> <span class='ocrx_word' id='word_1_102' title='bbox 756 1052 785 1096; x_wconf 87' lang='eng'>((</span> <span class='ocrx_word' id='word_1_103' title='bbox 803 1053 815 1097; x_wconf 88' lang='eng'>)</span> <span class='ocrx_word' id='word_1_104' title='bbox 834 1052 846 1097; x_wconf 95' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_105' title='bbox 866 1052 878 1097; x_wconf 95' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_106' title='bbox 896 1052 925 1096; x_wconf 88' lang='eng'>))</span> <span class='ocrx_word' id='word_1_107' title='bbox 958 1052 1035 1097; x_wconf 85' lang='eng'><strong>()))</strong></span> <span class='ocrx_word' id='word_1_108' title='bbox 1054 1052 1066 1097; x_wconf 95' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_109' title='bbox 1085 1052 1130 1097; x_wconf 88' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_110' title='bbox 1162 1052 1379 1096; x_wconf 68' lang='eng' dir='ltr'>)Cyberserk</span>
</span>
<span class='ocr_line' id='line_1_13' title="bbox 367 1110 1377 1155; baseline 0 -13; x_size 39.706532; x_descenders 7.7065306; x_ascenders 12"><span class='ocrx_word' id='word_1_111' title='bbox 367 1112 701 1153; x_wconf 93' lang='eng' dir='ltr'>repelting-slippage</span> <span class='ocrx_word' id='word_1_112' title='bbox 723 1112 794 1142; x_wconf 98' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_113' title='bbox 814 1112 987 1142; x_wconf 91' lang='eng' dir='ltr'>dark-side</span> <span class='ocrx_word' id='word_1_114' title='bbox 1008 1110 1020 1155; x_wconf 94' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_115' title='bbox 1043 1110 1073 1154; x_wconf 87' lang='eng'>((</span> <span class='ocrx_word' id='word_1_116' title='bbox 1096 1110 1139 1154; x_wconf 89' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_117' title='bbox 1162 1112 1377 1142; x_wconf 91' lang='eng' dir='ltr'>distributive</span>
</span>
<span class='ocr_line' id='line_1_14' title="bbox 369 1168 1376 1213; baseline 0 -13; x_size 39.706532; x_descenders 7.7065306; x_ascenders 12"><span class='ocrx_word' id='word_1_118' title='bbox 369 1170 663 1211; x_wconf 81' lang='eng' dir='ltr'>ROM-scrambling</span> <span class='ocrx_word' id='word_1_119' title='bbox 672 1170 787 1200; x_wconf 90' lang='eng' dir='ltr'><strong>TACT</strong></span> <span class='ocrx_word' id='word_1_120' title='bbox 799 1170 922 1200; x_wconf 87' lang='eng' dir='ltr'>tactics.</span> <span class='ocrx_word' id='word_1_121' title='bbox 938 1168 967 1212; x_wconf 87' lang='eng'>((</span> <span class='ocrx_word' id='word_1_122' title='bbox 983 1168 1009 1212; x_wconf 89' lang='eng'>((</span> <span class='ocrx_word' id='word_1_123' title='bbox 1023 1168 1035 1212; x_wconf 93' lang='eng'>)</span> <span class='ocrx_word' id='word_1_124' title='bbox 1052 1168 1064 1212; x_wconf 89' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_125' title='bbox 1078 1168 1090 1212; x_wconf 93' lang='eng'>)</span> <span class='ocrx_word' id='word_1_126' title='bbox 1106 1168 1118 1212; x_wconf 89' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_127' title='bbox 1132 1168 1158 1212; x_wconf 91' lang='eng'>))</span> <span class='ocrx_word' id='word_1_128' title='bbox 1175 1168 1203 1212; x_wconf 89' lang='eng'>((</span> <span class='ocrx_word' id='word_1_129' title='bbox 1217 1168 1245 1212; x_wconf 92' lang='eng'>))</span> <span class='ocrx_word' id='word_1_130' title='bbox 1261 1168 1273 1213; x_wconf 94' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_131' title='bbox 1287 1169 1316 1213; x_wconf 88' lang='eng'>))</span> <span class='ocrx_word' id='word_1_132' title='bbox 1331 1168 1376 1212; x_wconf 87' lang='eng'>(((</span>
</span>
<span class='ocr_line' id='line_1_15' title="bbox 368 1226 1376 1273; baseline -0.002 0; x_size 55.120865; x_descenders 11.120863; x_ascenders 15.13912"><span class='ocrx_word' id='word_1_133' title='bbox 368 1226 605 1273; x_wconf 85' lang='eng'><strong>)()))((((()</strong></span> <span class='ocrx_word' id='word_1_134' title='bbox 622 1227 1199 1272; x_wconf 85' lang='eng'><strong>((()))(((()())())(()))(((()</strong></span> <span class='ocrx_word' id='word_1_135' title='bbox 1216 1227 1376 1272; x_wconf 86' lang='eng'>(())((()</span>
</span>
<span class='ocr_line' id='line_1_16' title="bbox 368 1285 1376 1330; baseline 0 -1; x_size 55.120865; x_descenders 11.120863; x_ascenders 15.13912"><span class='ocrx_word' id='word_1_136' title='bbox 368 1285 894 1330; x_wconf 84' lang='eng'><strong>((()))(()))))((())))((()</strong></span> <span class='ocrx_word' id='word_1_137' title='bbox 920 1285 948 1329; x_wconf 84' lang='eng'>0</span> <span class='ocrx_word' id='word_1_138' title='bbox 974 1285 1376 1330; x_wconf 87' lang='eng'>()))(()))((())(((</span>
</span>
<span class='ocr_line' id='line_1_17' title="bbox 368 1342 1375 1390; baseline -0.001 -1; x_size 55.120865; x_descenders 11.120863; x_ascenders 15.13912"><span class='ocrx_word' id='word_1_139' title='bbox 368 1345 501 1389; x_wconf 66' lang='eng' dir='ltr'>()Zero</span> <span class='ocrx_word' id='word_1_140' title='bbox 513 1343 694 1387; x_wconf 71' lang='eng' dir='ltr'>Program)</span> <span class='ocrx_word' id='word_1_141' title='bbox 710 1342 756 1386; x_wconf 87' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_142' title='bbox 770 1342 817 1388; x_wconf 88' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_143' title='bbox 832 1343 922 1388; x_wconf 85' lang='eng'><strong>(((()</strong></span> <span class='ocrx_word' id='word_1_144' title='bbox 939 1344 951 1388; x_wconf 93' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_145' title='bbox 966 1343 994 1387; x_wconf 86' lang='eng'>))</span> <span class='ocrx_word' id='word_1_146' title='bbox 1010 1345 1022 1389; x_wconf 95' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_147' title='bbox 1038 1344 1067 1388; x_wconf 86' lang='eng'>))</span> <span class='ocrx_word' id='word_1_148' title='bbox 1082 1345 1094 1389; x_wconf 93' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_149' title='bbox 1110 1345 1122 1389; x_wconf 93' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_150' title='bbox 1137 1344 1182 1389; x_wconf 88' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_151' title='bbox 1198 1344 1261 1388; x_wconf 86' lang='eng'><strong>((((</strong></span> <span class='ocrx_word' id='word_1_152' title='bbox 1275 1346 1287 1390; x_wconf 85' lang='eng'>)</span> <span class='ocrx_word' id='word_1_153' title='bbox 1303 1344 1333 1389; x_wconf 88' lang='eng'>((</span> <span class='ocrx_word' id='word_1_154' title='bbox 1347 1345 1375 1389; x_wconf 91' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_18' title="bbox 369 1401 1376 1447; baseline 0 -1; x_size 55.120865; x_descenders 11.120863; x_ascenders 15.13912"><span class='ocrx_word' id='word_1_155' title='bbox 369 1403 446 1447; x_wconf 87' lang='eng'>(((((</span> <span class='ocrx_word' id='word_1_156' title='bbox 461 1403 473 1447; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_157' title='bbox 488 1403 500 1447; x_wconf 91' lang='eng'>(</span> <span class='ocrx_word' id='word_1_158' title='bbox 514 1402 526 1446; x_wconf 82' lang='eng'>)</span> <span class='ocrx_word' id='word_1_159' title='bbox 541 1402 687 1446; x_wconf 81' lang='eng'>)()(())((</span> <span class='ocrx_word' id='word_1_160' title='bbox 702 1402 741 1446; x_wconf 84' lang='eng'>()</span> <span class='ocrx_word' id='word_1_161' title='bbox 757 1402 770 1446; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_162' title='bbox 785 1402 832 1446; x_wconf 86' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_163' title='bbox 846 1402 859 1446; x_wconf 84' lang='eng'>)</span> <span class='ocrx_word' id='word_1_164' title='bbox 873 1402 904 1446; x_wconf 84' lang='eng'>))</span> <span class='ocrx_word' id='word_1_165' title='bbox 918 1401 950 1446; x_wconf 85' lang='eng'>)(</span> <span class='ocrx_word' id='word_1_166' title='bbox 963 1402 994 1446; x_wconf 85' lang='eng'>))</span> <span class='ocrx_word' id='word_1_167' title='bbox 1008 1402 1055 1446; x_wconf 83' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_168' title='bbox 1072 1402 1085 1446; x_wconf 80' lang='eng'>(</span> <span class='ocrx_word' id='word_1_169' title='bbox 1100 1402 1155 1446; x_wconf 71' lang='eng' dir='ltr'>(O</span> <span class='ocrx_word' id='word_1_170' title='bbox 1193 1402 1221 1446; x_wconf 77' lang='eng'>0</span> <span class='ocrx_word' id='word_1_171' title='bbox 1259 1402 1320 1447; x_wconf 88' lang='eng'><strong>()))</strong></span> <span class='ocrx_word' id='word_1_172' title='bbox 1337 1402 1376 1447; x_wconf 95' lang='eng'>((</span>
</span>
<span class='ocr_line' id='line_1_19' title="bbox 368 1460 1375 1506; baseline -0.002 0; x_size 55.120865; x_descenders 11.120863; x_ascenders 15.13912"><span class='ocrx_word' id='word_1_173' title='bbox 368 1460 1375 1506; x_wconf 85' lang='eng'>)))((())(((())((()))(((()())())(()))(((()(())</span>
</span>
<span class='ocr_line' id='line_1_20' title="bbox 369 1518 1375 1564; baseline 0.001 -1; x_size 55.120865; x_descenders 11.120863; x_ascenders 15.13912"><span class='ocrx_word' id='word_1_174' title='bbox 369 1518 1023 1564; x_wconf 81' lang='eng'><strong>((((()())()(())((())((())))())()</strong></span> <span class='ocrx_word' id='word_1_175' title='bbox 1058 1519 1375 1564; x_wconf 84' lang='eng'><strong>()))(()))((())</strong></span>
</span>
<span class='ocr_line' id='line_1_21' title="bbox 369 1577 1375 1623; baseline -0.001 -1; x_size 55.120865; x_descenders 11.120863; x_ascenders 15.13912"><span class='ocrx_word' id='word_1_176' title='bbox 369 1577 1375 1623; x_wconf 84' lang='eng'><strong>(((())((()))(((()())())(()))(((()(())((((()())</strong></span>
</span>
<span class='ocr_line' id='line_1_22' title="bbox 369 1635 1376 1680; baseline 0 0; x_size 55.120865; x_descenders 11.120863; x_ascenders 15.13912"><span class='ocrx_word' id='word_1_177' title='bbox 369 1635 479 1680; x_wconf 87' lang='eng'><strong>()(())(</strong></span> <span class='ocrx_word' id='word_1_178' title='bbox 494 1635 506 1680; x_wconf 94' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_179' title='bbox 520 1635 532 1680; x_wconf 94' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_180' title='bbox 545 1635 573 1679; x_wconf 87' lang='eng'>))</span> <span class='ocrx_word' id='word_1_181' title='bbox 588 1635 633 1679; x_wconf 88' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_182' title='bbox 647 1635 659 1679; x_wconf 92' lang='eng'>)</span> <span class='ocrx_word' id='word_1_183' title='bbox 675 1635 703 1679; x_wconf 88' lang='eng'>))</span> <span class='ocrx_word' id='word_1_184' title='bbox 719 1635 749 1680; x_wconf 86' lang='eng'>)(</span> <span class='ocrx_word' id='word_1_185' title='bbox 763 1635 792 1679; x_wconf 88' lang='eng'>))</span> <span class='ocrx_word' id='word_1_186' title='bbox 807 1635 836 1679; x_wconf 88' lang='eng'>))</span> <span class='ocrx_word' id='word_1_187' title='bbox 852 1635 897 1679; x_wconf 88' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_188' title='bbox 912 1635 924 1679; x_wconf 92' lang='eng'>)</span> <span class='ocrx_word' id='word_1_189' title='bbox 939 1635 968 1679; x_wconf 88' lang='eng'>))</span> <span class='ocrx_word' id='word_1_190' title='bbox 984 1635 1013 1680; x_wconf 88' lang='eng'>)(</span> <span class='ocrx_word' id='word_1_191' title='bbox 1028 1635 1057 1679; x_wconf 88' lang='eng'>))</span> <span class='ocrx_word' id='word_1_192' title='bbox 1073 1635 1115 1679; x_wconf 86' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_193' title='bbox 1133 1635 1214 1680; x_wconf 76' lang='eng'>((0</span> <span class='ocrx_word' id='word_1_194' title='bbox 1250 1635 1278 1679; x_wconf 83' lang='eng'>0</span> <span class='ocrx_word' id='word_1_195' title='bbox 1313 1635 1376 1680; x_wconf 85' lang='eng'><strong>()))</strong></span>
</span>
<span class='ocr_line' id='line_1_23' title="bbox 369 1693 1375 1739; baseline 0 -1; x_size 55.120865; x_descenders 11.120863; x_ascenders 15.13912"><span class='ocrx_word' id='word_1_196' title='bbox 369 1693 1375 1739; x_wconf 86' lang='eng'><strong>(()))((())(((())((()))(((()())())(()))(((()</strong></span>
</span>
<span class='ocr_line' id='line_1_24' title="bbox 369 1752 1375 1797; baseline 0.001 -1; x_size 55.120865; x_descenders 11.120863; x_ascenders 15.13912"><span class='ocrx_word' id='word_1_197' title='bbox 369 1753 397 1797; x_wconf 93' lang='eng'>((</span> <span class='ocrx_word' id='word_1_198' title='bbox 411 1753 440 1797; x_wconf 87' lang='eng'>))</span> <span class='ocrx_word' id='word_1_199' title='bbox 456 1752 533 1796; x_wconf 87' lang='eng'>(((((</span> <span class='ocrx_word' id='word_1_200' title='bbox 547 1752 559 1796; x_wconf 90' lang='eng'>)</span> <span class='ocrx_word' id='word_1_201' title='bbox 575 1752 587 1797; x_wconf 95' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_202' title='bbox 601 1753 613 1797; x_wconf 88' lang='eng'>)</span> <span class='ocrx_word' id='word_1_203' title='bbox 628 1752 640 1796; x_wconf 85' lang='eng'>)</span> <span class='ocrx_word' id='word_1_204' title='bbox 658 1752 686 1796; x_wconf 84' lang='eng'>0</span> <span class='ocrx_word' id='word_1_205' title='bbox 703 1752 782 1797; x_wconf 86' lang='eng'><strong>(())(</strong></span> <span class='ocrx_word' id='word_1_206' title='bbox 798 1752 810 1797; x_wconf 95' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_207' title='bbox 826 1752 838 1797; x_wconf 95' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_208' title='bbox 854 1752 883 1796; x_wconf 88' lang='eng'>))</span> <span class='ocrx_word' id='word_1_209' title='bbox 899 1752 945 1797; x_wconf 84' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_210' title='bbox 960 1753 972 1797; x_wconf 85' lang='eng'>)</span> <span class='ocrx_word' id='word_1_211' title='bbox 989 1752 1018 1796; x_wconf 83' lang='eng'>))</span> <span class='ocrx_word' id='word_1_212' title='bbox 1034 1752 1064 1797; x_wconf 84' lang='eng'>)(</span> <span class='ocrx_word' id='word_1_213' title='bbox 1078 1752 1106 1796; x_wconf 86' lang='eng'>))</span> <span class='ocrx_word' id='word_1_214' title='bbox 1123 1752 1152 1796; x_wconf 86' lang='eng'>))</span> <span class='ocrx_word' id='word_1_215' title='bbox 1168 1752 1214 1797; x_wconf 84' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_216' title='bbox 1229 1753 1241 1797; x_wconf 85' lang='eng'>)</span> <span class='ocrx_word' id='word_1_217' title='bbox 1257 1752 1286 1797; x_wconf 86' lang='eng'>))</span> <span class='ocrx_word' id='word_1_218' title='bbox 1301 1752 1331 1797; x_wconf 84' lang='eng'>)(</span> <span class='ocrx_word' id='word_1_219' title='bbox 1346 1752 1375 1797; x_wconf 86' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_25' title="bbox 368 1810 1376 1856; baseline 0 0; x_size 55.120865; x_descenders 11.120863; x_ascenders 15.13912"><span class='ocrx_word' id='word_1_220' title='bbox 368 1810 512 1856; x_wconf 84' lang='eng'><strong>)))((()</strong></span> <span class='ocrx_word' id='word_1_221' title='bbox 552 1810 579 1855; x_wconf 84' lang='eng'>0</span> <span class='ocrx_word' id='word_1_222' title='bbox 619 1810 1376 1856; x_wconf 85' lang='eng'>()))(()))((())(((())((()))(((()(</span>
</span>
<span class='ocr_line' id='line_1_26' title="bbox 369 1868 1376 1915; baseline -0.001 0; x_size 55.120865; x_descenders 11.120863; x_ascenders 15.13912"><span class='ocrx_word' id='word_1_223' title='bbox 369 1870 396 1915; x_wconf 87' lang='eng'>))</span> <span class='ocrx_word' id='word_1_224' title='bbox 413 1870 467 1915; x_wconf 73' lang='eng'><strong>0)</strong></span> <span class='ocrx_word' id='word_1_225' title='bbox 483 1870 495 1914; x_wconf 88' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_226' title='bbox 510 1869 522 1913; x_wconf 87' lang='eng'>(</span> <span class='ocrx_word' id='word_1_227' title='bbox 536 1869 579 1914; x_wconf 85' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_228' title='bbox 596 1869 658 1914; x_wconf 86' lang='eng'><strong>((((</strong></span> <span class='ocrx_word' id='word_1_229' title='bbox 673 1870 685 1914; x_wconf 88' lang='eng'>)</span> <span class='ocrx_word' id='word_1_230' title='bbox 701 1869 731 1913; x_wconf 89' lang='eng'>((</span> <span class='ocrx_word' id='word_1_231' title='bbox 745 1869 775 1914; x_wconf 87' lang='eng'>))</span> <span class='ocrx_word' id='word_1_232' title='bbox 790 1868 869 1914; x_wconf 86' lang='eng'>(((((</span> <span class='ocrx_word' id='word_1_233' title='bbox 885 1870 897 1914; x_wconf 88' lang='eng'>)</span> <span class='ocrx_word' id='word_1_234' title='bbox 913 1869 925 1914; x_wconf 95' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_235' title='bbox 940 1870 952 1914; x_wconf 88' lang='eng'>)</span> <span class='ocrx_word' id='word_1_236' title='bbox 968 1869 1099 1914; x_wconf 84' lang='eng'><strong>)()(())(</strong></span> <span class='ocrx_word' id='word_1_237' title='bbox 1115 1869 1127 1913; x_wconf 87' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_238' title='bbox 1143 1870 1155 1914; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_239' title='bbox 1169 1869 1198 1914; x_wconf 86' lang='eng'>))</span> <span class='ocrx_word' id='word_1_240' title='bbox 1214 1868 1260 1913; x_wconf 84' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_241' title='bbox 1274 1870 1286 1914; x_wconf 85' lang='eng'>)</span> <span class='ocrx_word' id='word_1_242' title='bbox 1302 1869 1331 1915; x_wconf 86' lang='eng'>))</span> <span class='ocrx_word' id='word_1_243' title='bbox 1347 1869 1376 1914; x_wconf 85' lang='eng'>)(</span>
</span>
<span class='ocr_line' id='line_1_27' title="bbox 370 1927 1376 1974; baseline 0 -1; x_size 55.120865; x_descenders 11.120863; x_ascenders 15.13912"><span class='ocrx_word' id='word_1_244' title='bbox 370 1928 439 1973; x_wconf 85' lang='eng'>))0</span> <span class='ocrx_word' id='word_1_245' title='bbox 466 1927 536 1974; x_wconf 83' lang='eng'><strong>()))</strong></span> <span class='ocrx_word' id='word_1_246' title='bbox 561 1928 1376 1974; x_wconf 76' lang='eng'><strong>(0))((())(((())((()))(((()())())((</strong></span>
</span>
<span class='ocr_line' id='line_1_28' title="bbox 370 1986 1218 2032; baseline 0 -1; x_size 55.120865; x_descenders 11.120863; x_ascenders 15.13912"><span class='ocrx_word' id='word_1_247' title='bbox 370 1987 414 2032; x_wconf 88' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_248' title='bbox 429 1987 491 2031; x_wconf 87' lang='eng'><strong>((((</strong></span> <span class='ocrx_word' id='word_1_249' title='bbox 505 1988 517 2032; x_wconf 88' lang='eng'>)</span> <span class='ocrx_word' id='word_1_250' title='bbox 532 1987 560 2031; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_251' title='bbox 573 1987 602 2031; x_wconf 85' lang='eng'>))</span> <span class='ocrx_word' id='word_1_252' title='bbox 619 1987 698 2031; x_wconf 87' lang='eng'>(((((</span> <span class='ocrx_word' id='word_1_253' title='bbox 713 1987 725 2031; x_wconf 90' lang='eng'>)</span> <span class='ocrx_word' id='word_1_254' title='bbox 742 1987 754 2032; x_wconf 95' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_255' title='bbox 769 1988 781 2032; x_wconf 88' lang='eng'>)</span> <span class='ocrx_word' id='word_1_256' title='bbox 797 1987 928 2032; x_wconf 87' lang='eng'><strong>)()(())(</strong></span> <span class='ocrx_word' id='word_1_257' title='bbox 944 1987 956 2032; x_wconf 95' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_258' title='bbox 972 1987 984 2032; x_wconf 95' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_259' title='bbox 1000 1987 1029 2032; x_wconf 85' lang='eng'>))</span> <span class='ocrx_word' id='word_1_260' title='bbox 1045 1987 1090 2032; x_wconf 88' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_261' title='bbox 1108 1986 1120 2031; x_wconf 91' lang='eng'>(</span> <span class='ocrx_word' id='word_1_262' title='bbox 1136 1986 1148 2031; x_wconf 91' lang='eng'>(</span> <span class='ocrx_word' id='word_1_263' title='bbox 1162 1986 1174 2031; x_wconf 92' lang='eng'>)</span> <span class='ocrx_word' id='word_1_264' title='bbox 1188 1986 1218 2031; x_wconf 87' lang='eng'>))</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_3' title="bbox 838 2113 900 2136">
<p class='ocr_par' dir='ltr' id='par_1_4' title="bbox 838 2113 900 2136">
<span class='ocr_line' id='line_1_29' title="bbox 838 2113 900 2136; baseline 0 0; x_size 31; x_descenders 7.75; x_ascenders 7.75"><span class='ocrx_word' id='word_1_265' title='bbox 838 2113 900 2136; x_wconf 87' lang='eng'>390</span>
</span>
</p>
</div>
</div>
</body>
</html>

266
hypervirus/hocr_drag/scan - Copia.html
Unescape Escape View File

@ -0,0 +1,266 @@
<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
<head>
<title></title>
<meta http-equiv="Content-Type" content="text/html;charset=utf-8" />
<meta name='ocr-system' content='tesseract 3.04.01' />
<meta name='ocr-capabilities' content='ocr_page ocr_carea ocr_par ocr_line ocrx_word'/>
<link rel="stylesheet" href="//code.jquery.com/ui/1.12.1/themes/base/jquery-ui.css">
<link rel="stylesheet" href="/resources/demos/style.css">
<script src="https://code.jquery.com/jquery-1.12.4.js"></script>
<script src="https://code.jquery.com/ui/1.12.1/jquery-ui.js"></script>
</head>
<body>
<div class='ocr_page' id='page_1' title='image "scan.png"; bbox 0 0 1754 1240; ppageno 0'>
<div class='ocr_carea' id='block_1_1' title="bbox 164 8 794 233">
<p class='ocr_par' dir='ltr' id='par_1_1' title="bbox 164 8 794 233">
<span class='ocr_line' id='line_1_1' title="bbox 170 8 794 36; baseline 0.022 -14; x_size 18.8125; x_descenders 4.8125005; x_ascenders 4.8125"><span class='ocrx_word' id='word_1_1' title='bbox 170 8 235 23; x_wconf 80' lang='eng' dir='ltr'>NURAl</span> <span class='ocrx_word' id='word_1_2' title='bbox 240 10 245 23; x_wconf 78' lang='eng'><strong>)</strong></span> <span class='ocrx_word' id='word_1_3' title='bbox 251 15 298 25; x_wconf 64' lang='eng' dir='ltr'>nu-t‘lh</span> <span class='ocrx_word' id='word_1_4' title='bbox 304 11 342 26; x_wconf 76' lang='eng' dir='ltr'>liirtc</span> <span class='ocrx_word' id='word_1_5' title='bbox 349 12 385 27; x_wconf 79' lang='eng' dir='ltr'>wrrli</span> <span class='ocrx_word' id='word_1_6' title='bbox 391 12 434 28; x_wconf 73' lang='eng' dir='ltr'>lime.</span> <span class='ocrx_word' id='word_1_7' title='bbox 440 15 484 29; x_wconf 60' lang='eng' dir='ltr'>(him</span> <span class='ocrx_word' id='word_1_8' title='bbox 490 15 515 30; x_wconf 73' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_9' title='bbox 520 20 563 31; x_wconf 66' lang='eng' dir='ltr'>outer</span> <span class='ocrx_word' id='word_1_10' title='bbox 569 22 616 35; x_wconf 69' lang='eng' dir='ltr'>prom</span> <span class='ocrx_word' id='word_1_11' title='bbox 621 23 624 32; x_wconf 88' lang='eng' dir='ltr'>i</span> <span class='ocrx_word' id='word_1_12' title='bbox 629 24 652 33; x_wconf 81' lang='eng' dir='ltr'>Illll</span> <span class='ocrx_word' id='word_1_13' title='bbox 659 24 695 34; x_wconf 78' lang='eng' dir='ltr'>mut-</span> <span class='ocrx_word' id='word_1_14' title='bbox 701 19 747 35; x_wconf 65' lang='eng' dir='ltr'>ol&#39;rllc</span> <span class='ocrx_word' id='word_1_15' title='bbox 753 21 794 36; x_wconf 53' lang='eng' dir='ltr'>ll|il(lt</span>
</span>
<span class='ocr_line' id='line_1_2' title="bbox 219 40 794 65; baseline 0.023 -13; x_size 21.5; x_descenders 5.5; x_ascenders 5.5"><span class='ocrx_word' id='word_1_16' title='bbox 219 43 225 52; x_wconf 70' lang='eng'>:</span> <span class='ocrx_word' id='word_1_17' title='bbox 231 40 349 58; x_wconf 68' lang='eng' dir='ltr'>tompromrsctl,</span> <span class='ocrx_word' id='word_1_18' title='bbox 356 41 381 56; x_wconf 77' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_19' title='bbox 387 42 464 58; x_wconf 82' lang='eng' dir='ltr'>NORAD</span> <span class='ocrx_word' id='word_1_20' title='bbox 470 45 552 60; x_wconf 77' lang='eng' dir='ltr'>command</span> <span class='ocrx_word' id='word_1_21' title='bbox 560 51 571 60; x_wconf 91' lang='eng' dir='ltr'>|S</span> <span class='ocrx_word' id='word_1_22' title='bbox 577 46 610 61; x_wconf 65' lang='eng' dir='ltr'>able</span> <span class='ocrx_word' id='word_1_23' title='bbox 617 52 632 61; x_wconf 79' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_24' title='bbox 638 48 712 63; x_wconf 76' lang='eng' dir='ltr'>scramble</span> <span class='ocrx_word' id='word_1_25' title='bbox 718 49 794 65; x_wconf 67' lang='eng' dir='ltr'>defensive</span>
</span>
<span class='ocr_line' id='line_1_3' title="bbox 167 68 793 94; baseline 0.022 -14; x_size 25.333334; x_descenders 4; x_ascenders 7.333334"><span class='ocrx_word' id='word_1_26' title='bbox 167 71 188 80; x_wconf 74' lang='eng' dir='ltr'>air</span> <span class='ocrx_word' id='word_1_27' title='bbox 195 71 245 85; x_wconf 80' lang='eng' dir='ltr'>power</span> <span class='ocrx_word' id='word_1_28' title='bbox 252 68 318 88; x_wconf 63' lang='eng' dir='ltr'>through</span> <span class='ocrx_word' id='word_1_29' title='bbox 324 75 332 84; x_wconf 71' lang='eng' dir='ltr'><strong>a</strong></span> <span class='ocrx_word' id='word_1_30' title='bbox 339 70 394 89; x_wconf 62' lang='eng' dir='ltr'>rigidly</span> <span class='ocrx_word' id='word_1_31' title='bbox 401 71 460 87; x_wconf 82' lang='eng' dir='ltr'>defined</span> <span class='ocrx_word' id='word_1_32' title='bbox 467 77 524 91; x_wconf 86' lang='eng' dir='ltr'>system</span> <span class='ocrx_word' id='word_1_33' title='bbox 530 73 548 88; x_wconf 68' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_34' title='bbox 552 76 633 90; x_wconf 84' lang='eng' dir='ltr'>command</span> <span class='ocrx_word' id='word_1_35' title='bbox 640 77 669 91; x_wconf 83' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_36' title='bbox 676 78 734 93; x_wconf 91' lang='eng' dir='ltr'>control</span> <span class='ocrx_word' id='word_1_37' title='bbox 742 79 774 94; x_wconf 88' lang='eng' dir='ltr'>that</span> <span class='ocrx_word' id='word_1_38' title='bbox 782 80 793 94; x_wconf 84' lang='eng' dir='ltr'>is</span>
</span>
<span class='ocr_line' id='line_1_4' title="bbox 166 95 792 123; baseline 0.022 -14; x_size 18.8125; x_descenders 4.8125005; x_ascenders 4.8125"><span class='ocrx_word' id='word_1_39' title='bbox 166 95 233 111; x_wconf 77' lang='eng' dir='ltr'>directed</span> <span class='ocrx_word' id='word_1_40' title='bbox 238 98 307 112; x_wconf 87' lang='eng' dir='ltr'>outward</span> <span class='ocrx_word' id='word_1_41' title='bbox 313 97 351 113; x_wconf 71' lang='eng' dir='ltr'>from</span> <span class='ocrx_word' id='word_1_42' title='bbox 356 104 364 113; x_wconf 88' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_43' title='bbox 369 100 418 119; x_wconf 78' lang='eng' dir='ltr'>single</span> <span class='ocrx_word' id='word_1_44' title='bbox 423 106 474 116; x_wconf 79' lang='eng' dir='ltr'>source</span> <span class='ocrx_word' id='word_1_45' title='bbox 479 102 630 122; x_wconf 79' lang='eng' dir='ltr'>(USSPACECOM),</span> <span class='ocrx_word' id='word_1_46' title='bbox 636 110 652 120; x_wconf 83' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_47' title='bbox 657 105 751 122; x_wconf 70' lang='eng' dir='ltr'>subservient</span> <span class='ocrx_word' id='word_1_48' title='bbox 756 108 792 123; x_wconf 83' lang='eng' dir='ltr'>end-</span>
</span>
<span class='ocr_line' id='line_1_5' title="bbox 166 125 792 152; baseline 0.022 -14; x_size 20; x_descenders 5; x_ascenders 5"><span class='ocrx_word' id='word_1_49' title='bbox 166 125 209 143; x_wconf 86' lang='eng' dir='ltr'>point</span> <span class='ocrx_word' id='word_1_50' title='bbox 216 126 317 142; x_wconf 83' lang='eng' dir='ltr'>installations</span> <span class='ocrx_word' id='word_1_51' title='bbox 323 128 356 143; x_wconf 83' lang='eng' dir='ltr'>that</span> <span class='ocrx_word' id='word_1_52' title='bbox 362 128 397 148; x_wconf 86' lang='eng' dir='ltr'>help</span> <span class='ocrx_word' id='word_1_53' title='bbox 403 130 445 145; x_wconf 78' lang='eng' dir='ltr'>resist</span> <span class='ocrx_word' id='word_1_54' title='bbox 451 131 506 146; x_wconf 77' lang='eng' dir='ltr'>attack.</span> <span class='ocrx_word' id='word_1_55' title='bbox 513 132 545 147; x_wconf 75' lang='eng' dir='ltr'>The</span> <span class='ocrx_word' id='word_1_56' title='bbox 551 133 611 152; x_wconf 75' lang='eng' dir='ltr'>specific</span> <span class='ocrx_word' id='word_1_57' title='bbox 617 134 682 150; x_wconf 92' lang='eng' dir='ltr'>location</span> <span class='ocrx_word' id='word_1_58' title='bbox 688 135 744 151; x_wconf 78' lang='eng' dir='ltr'>ofeach</span> <span class='ocrx_word' id='word_1_59' title='bbox 751 137 792 152; x_wconf 84' lang='eng' dir='ltr'>radar</span>
</span>
<span class='ocr_line' id='line_1_6' title="bbox 166 154 791 185; baseline 0.022 -18; x_size 18.8125; x_descenders 4.8125005; x_ascenders 4.8125"><span class='ocrx_word' id='word_1_60' title='bbox 166 154 258 169; x_wconf 69' lang='eng' dir='ltr'>installation</span> <span class='ocrx_word' id='word_1_61' title='bbox 267 156 278 170; x_wconf 88' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_62' title='bbox 286 157 346 174; x_wconf 86' lang='eng' dir='ltr'>crucial,</span> <span class='ocrx_word' id='word_1_63' title='bbox 354 163 368 172; x_wconf 86' lang='eng' dir='ltr'>as</span> <span class='ocrx_word' id='word_1_64' title='bbox 376 158 388 173; x_wconf 77' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_65' title='bbox 396 158 421 173; x_wconf 97' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_66' title='bbox 428 160 465 178; x_wconf 72' lang='eng' dir='ltr'>path</span> <span class='ocrx_word' id='word_1_67' title='bbox 473 160 491 174; x_wconf 72' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_68' title='bbox 496 161 521 175; x_wconf 89' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_69' title='bbox 528 161 572 176; x_wconf 80' lang='eng' dir='ltr'>chain</span> <span class='ocrx_word' id='word_1_70' title='bbox 580 162 688 179; x_wconf 76' lang='eng' dir='ltr'>ofcommand.</span> <span class='ocrx_word' id='word_1_71' title='bbox 697 165 758 185; x_wconf 74' lang='eng' dir='ltr'>During</span> <span class='ocrx_word' id='word_1_72' title='bbox 766 167 791 182; x_wconf 89' lang='eng' dir='ltr'>the</span>
</span>
<span class='ocr_line' id='line_1_7' title="bbox 164 182 789 211; baseline 0.022 -14; x_size 18.8125; x_descenders 4.8125005; x_ascenders 4.8125"><span class='ocrx_word' id='word_1_73' title='bbox 164 182 203 197; x_wconf 82' lang='eng' dir='ltr'>Cold</span> <span class='ocrx_word' id='word_1_74' title='bbox 210 184 248 201; x_wconf 79' lang='eng' dir='ltr'>War,</span> <span class='ocrx_word' id='word_1_75' title='bbox 254 185 331 200; x_wconf 83' lang='eng' dir='ltr'>NORAD</span> <span class='ocrx_word' id='word_1_76' title='bbox 337 192 366 201; x_wconf 77' lang='eng' dir='ltr'>was</span> <span class='ocrx_word' id='word_1_77' title='bbox 373 187 398 202; x_wconf 92' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_78' title='bbox 404 187 477 208; x_wconf 72' lang='eng' dir='ltr'>lynchpin</span> <span class='ocrx_word' id='word_1_79' title='bbox 483 189 565 205; x_wconf 68' lang='eng' dir='ltr'>ofnut’lear</span> <span class='ocrx_word' id='word_1_80' title='bbox 570 191 630 207; x_wconf 77' lang='eng' dir='ltr'>defense</span> <span class='ocrx_word' id='word_1_81' title='bbox 636 193 651 207; x_wconf 84' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_82' title='bbox 658 194 709 209; x_wconf 88' lang='eng' dir='ltr'>North</span> <span class='ocrx_word' id='word_1_83' title='bbox 715 195 789 211; x_wconf 54' lang='eng' dir='ltr'>America.</span>
</span>
<span class='ocr_line' id='line_1_8' title="bbox 164 212 478 233; baseline 0.022 -7; x_size 21.5; x_descenders 5.5; x_ascenders 5.5"><span class='ocrx_word' id='word_1_84' title='bbox 164 212 177 226; x_wconf 93' lang='eng' dir='ltr'>It</span> <span class='ocrx_word' id='word_1_85' title='bbox 184 212 195 226; x_wconf 87' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_86' title='bbox 201 218 209 227; x_wconf 79' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_87' title='bbox 216 213 299 228; x_wconf 79' lang='eng' dir='ltr'>“solution&quot;</span> <span class='ocrx_word' id='word_1_88' title='bbox 306 219 321 229; x_wconf 81' lang='eng'>[0</span> <span class='ocrx_word' id='word_1_89' title='bbox 328 215 353 230; x_wconf 89' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_90' title='bbox 359 216 419 231; x_wconf 78' lang='eng' dir='ltr'>nuclear</span> <span class='ocrx_word' id='word_1_91' title='bbox 425 217 478 233; x_wconf 83' lang='eng' dir='ltr'>threat.</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_2' title="bbox 199 38 223 52">
<p class='ocr_par' dir='ltr' id='par_1_2' title="bbox 199 38 223 52">
<span class='ocr_line' id='line_1_9' title="bbox 199 38 223 52; baseline 0 1188; x_size 20; x_descenders 5; x_ascenders 5"><span class='ocrx_word' id='word_1_92' title='bbox 199 38 223 52; x_wconf 95' lang='eng' dir='ltr'> </span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_3' title="bbox 169 42 199 52">
<p class='ocr_par' dir='ltr' id='par_1_3' title="bbox 169 42 199 52">
<span class='ocr_line' id='line_1_10' title="bbox 169 42 199 52; baseline 0.033 -1; x_size 20; x_descenders 5; x_ascenders 5"><span class='ocrx_word' id='word_1_93' title='bbox 169 42 199 52; x_wconf 77' lang='eng' dir='ltr'>mils</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_4' title="bbox 152 241 789 730">
<p class='ocr_par' dir='ltr' id='par_1_4' title="bbox 160 241 789 376">
<span class='ocr_line' id='line_1_11' title="bbox 188 241 789 273; baseline 0.023 -18; x_size 18.769911; x_descenders 4.7699113; x_ascenders 4.7699118"><span class='ocrx_word' id='word_1_94' title='bbox 188 241 220 256; x_wconf 90' lang='eng' dir='ltr'>The</span> <span class='ocrx_word' id='word_1_95' title='bbox 228 242 295 258; x_wconf 74' lang='eng' dir='ltr'>Internet</span> <span class='ocrx_word' id='word_1_96' title='bbox 303 249 359 263; x_wconf 85' lang='eng' dir='ltr'>system</span> <span class='ocrx_word' id='word_1_97' title='bbox 367 245 412 260; x_wconf 83' lang='eng' dir='ltr'>Could</span> <span class='ocrx_word' id='word_1_98' title='bbox 421 251 447 261; x_wconf 89' lang='eng' dir='ltr'>not</span> <span class='ocrx_word' id='word_1_99' title='bbox 456 247 474 262; x_wconf 88' lang='eng' dir='ltr'>be</span> <span class='ocrx_word' id='word_1_100' title='bbox 482 253 524 263; x_wconf 83' lang='eng' dir='ltr'>more</span> <span class='ocrx_word' id='word_1_101' title='bbox 532 248 607 265; x_wconf 54' lang='eng' dir='ltr'>different.</span> <span class='ocrx_word' id='word_1_102' title='bbox 617 251 630 265; x_wconf 88' lang='eng' dir='ltr'>It</span> <span class='ocrx_word' id='word_1_103' title='bbox 638 250 697 267; x_wconf 70' lang='eng' dir='ltr'>follows</span> <span class='ocrx_word' id='word_1_104' title='bbox 705 258 713 267; x_wconf 91' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_105' title='bbox 721 258 789 273; x_wconf 74' lang='eng' dir='ltr'>Contrary</span>
</span>
<span class='ocr_line' id='line_1_12' title="bbox 162 271 788 301; baseline 0.022 -17; x_size 26.2349; x_descenders 5; x_ascenders 7.2348995"><span class='ocrx_word' id='word_1_106' title='bbox 162 271 279 289; x_wconf 70' lang='eng' dir='ltr'>organizational</span> <span class='ocrx_word' id='word_1_107' title='bbox 289 272 347 292; x_wconf 75' lang='eng' dir='ltr'>design.</span> <span class='ocrx_word' id='word_1_108' title='bbox 356 274 389 289; x_wconf 85' lang='eng' dir='ltr'>The</span> <span class='ocrx_word' id='word_1_109' title='bbox 397 275 464 291; x_wconf 85' lang='eng' dir='ltr'>Internet</span> <span class='ocrx_word' id='word_1_110' title='bbox 473 277 485 291; x_wconf 90' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_111' title='bbox 494 277 539 292; x_wconf 85' lang='eng' dir='ltr'>based</span> <span class='ocrx_word' id='word_1_112' title='bbox 549 283 575 293; x_wconf 88' lang='eng' dir='ltr'>not</span> <span class='ocrx_word' id='word_1_113' title='bbox 583 284 603 293; x_wconf 89' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_114' title='bbox 612 280 724 301; x_wconf 80' lang='eng' dir='ltr'>directionality</span> <span class='ocrx_word' id='word_1_115' title='bbox 734 288 761 297; x_wconf 89' lang='eng' dir='ltr'>nor</span> <span class='ocrx_word' id='word_1_116' title='bbox 769 289 788 298; x_wconf 85' lang='eng' dir='ltr'>on</span>
</span>
<span class='ocr_line' id='line_1_13' title="bbox 162 300 787 330; baseline 0.022 -17; x_size 25.2349; x_descenders 4; x_ascenders 7.2348995"><span class='ocrx_word' id='word_1_117' title='bbox 162 300 249 318; x_wconf 74' lang='eng' dir='ltr'>toughness,</span> <span class='ocrx_word' id='word_1_118' title='bbox 260 300 288 316; x_wconf 82' lang='eng' dir='ltr'>but</span> <span class='ocrx_word' id='word_1_119' title='bbox 297 307 316 316; x_wconf 89' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_120' title='bbox 327 302 406 323; x_wconf 82' lang='eng' dir='ltr'>flexibility</span> <span class='ocrx_word' id='word_1_121' title='bbox 416 305 445 319; x_wconf 78' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_122' title='bbox 455 305 558 326; x_wconf 84' lang='eng' dir='ltr'>adaptability.</span> <span class='ocrx_word' id='word_1_123' title='bbox 568 308 632 323; x_wconf 89' lang='eng' dir='ltr'>Normal</span> <span class='ocrx_word' id='word_1_124' title='bbox 642 310 710 330; x_wconf 88' lang='eng' dir='ltr'>military</span> <span class='ocrx_word' id='word_1_125' title='bbox 719 313 787 330; x_wconf 82' lang='eng' dir='ltr'>protocol</span>
</span>
<span class='ocr_line' id='line_1_14' title="bbox 161 329 787 358; baseline 0.022 -16; x_size 18; x_descenders 3; x_ascenders 5"><span class='ocrx_word' id='word_1_126' title='bbox 161 333 208 343; x_wconf 82' lang='eng' dir='ltr'>serves</span> <span class='ocrx_word' id='word_1_127' title='bbox 215 333 231 344; x_wconf 85' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_128' title='bbox 236 329 332 349; x_wconf 85' lang='eng' dir='ltr'>hierarchlze,</span> <span class='ocrx_word' id='word_1_129' title='bbox 338 336 354 347; x_wconf 88' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_130' title='bbox 359 333 441 351; x_wconf 78' lang='eng' dir='ltr'>prioritize,</span> <span class='ocrx_word' id='word_1_131' title='bbox 447 335 493 350; x_wconf 87' lang='eng' dir='ltr'>while</span> <span class='ocrx_word' id='word_1_132' title='bbox 499 336 524 350; x_wconf 91' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_133' title='bbox 531 341 580 351; x_wconf 84' lang='eng' dir='ltr'>newer</span> <span class='ocrx_word' id='word_1_134' title='bbox 586 338 653 353; x_wconf 86' lang='eng' dir='ltr'>network</span> <span class='ocrx_word' id='word_1_135' title='bbox 658 340 735 358; x_wconf 78' lang='eng' dir='ltr'>protocols</span> <span class='ocrx_word' id='word_1_136' title='bbox 741 341 758 356; x_wconf 69' lang='eng'>0{</span> <span class='ocrx_word' id='word_1_137' title='bbox 762 342 787 356; x_wconf 88' lang='eng' dir='ltr'>the</span>
</span>
<span class='ocr_line' id='line_1_15' title="bbox 160 357 376 376; baseline 0.023 -5; x_size 20.684563; x_descenders 5.6845636; x_ascenders 4"><span class='ocrx_word' id='word_1_138' title='bbox 160 357 227 373; x_wconf 77' lang='eng' dir='ltr'>Internet</span> <span class='ocrx_word' id='word_1_139' title='bbox 233 364 274 374; x_wconf 89' lang='eng' dir='ltr'>serve</span> <span class='ocrx_word' id='word_1_140' title='bbox 280 364 296 374; x_wconf 84' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_141' title='bbox 301 360 376 376; x_wconf 59' lang='eng' dir='ltr'>distribute.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_5' title="bbox 157 387 785 529">
<span class='ocr_line' id='line_1_16' title="bbox 185 387 785 419; baseline 0.022 -18; x_size 26.2349; x_descenders 5; x_ascenders 7.2348995"><span class='ocrx_word' id='word_1_142' title='bbox 185 387 202 401; x_wconf 91' lang='eng' dir='ltr'>In</span> <span class='ocrx_word' id='word_1_143' title='bbox 208 387 238 402; x_wconf 92' lang='eng' dir='ltr'>this</span> <span class='ocrx_word' id='word_1_144' title='bbox 244 388 306 408; x_wconf 85' lang='eng' dir='ltr'>chapter</span> <span class='ocrx_word' id='word_1_145' title='bbox 312 390 317 404; x_wconf 89' lang='eng' dir='ltr'>I</span> <span class='ocrx_word' id='word_1_146' title='bbox 323 390 391 406; x_wconf 82' lang='eng' dir='ltr'>describe</span> <span class='ocrx_word' id='word_1_147' title='bbox 396 392 454 411; x_wconf 83' lang='eng' dir='ltr'>exactly</span> <span class='ocrx_word' id='word_1_148' title='bbox 460 393 500 408; x_wconf 88' lang='eng' dir='ltr'>what</span> <span class='ocrx_word' id='word_1_149' title='bbox 506 394 606 410; x_wconf 84' lang='eng' dir='ltr'>distribution</span> <span class='ocrx_word' id='word_1_150' title='bbox 613 402 669 415; x_wconf 85' lang='eng' dir='ltr'>means,</span> <span class='ocrx_word' id='word_1_151' title='bbox 675 398 704 413; x_wconf 91' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_152' title='bbox 711 398 745 413; x_wconf 90' lang='eng' dir='ltr'>how</span> <span class='ocrx_word' id='word_1_153' title='bbox 751 405 785 419; x_wconf 89' lang='eng' dir='ltr'>pro.</span>
</span>
<span class='ocr_line' id='line_1_17' title="bbox 159 416 785 447; baseline 0.022 -17; x_size 19; x_descenders 4; x_ascenders 5"><span class='ocrx_word' id='word_1_154' title='bbox 159 416 199 430; x_wconf 88' lang='eng' dir='ltr'>tocol</span> <span class='ocrx_word' id='word_1_155' title='bbox 208 416 256 432; x_wconf 85' lang='eng' dir='ltr'>works</span> <span class='ocrx_word' id='word_1_156' title='bbox 265 418 281 432; x_wconf 93' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_157' title='bbox 289 418 319 433; x_wconf 87' lang='eng' dir='ltr'>this</span> <span class='ocrx_word' id='word_1_158' title='bbox 328 424 361 434; x_wconf 90' lang='eng' dir='ltr'>new</span> <span class='ocrx_word' id='word_1_159' title='bbox 370 421 424 435; x_wconf 89' lang='eng' dir='ltr'>terrain</span> <span class='ocrx_word' id='word_1_160' title='bbox 432 421 450 436; x_wconf 81' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_161' title='bbox 456 422 482 437; x_wconf 87' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_162' title='bbox 490 422 582 439; x_wconf 73' lang='eng' dir='ltr'>disrributed</span> <span class='ocrx_word' id='word_1_163' title='bbox 591 426 672 441; x_wconf 53' lang='eng' dir='ltr'>network}</span> <span class='ocrx_word' id='word_1_164' title='bbox 680 427 686 441; x_wconf 91' lang='eng' dir='ltr'><strong>I</strong></span> <span class='ocrx_word' id='word_1_165' title='bbox 694 432 760 447; x_wconf 85' lang='eng' dir='ltr'>attempt</span> <span class='ocrx_word' id='word_1_166' title='bbox 769 433 785 444; x_wconf 83' lang='eng' dir='ltr'>to</span>
</span>
<span class='ocr_line' id='line_1_18' title="bbox 158 445 783 476; baseline 0.022 -17; x_size 19; x_descenders 4; x_ascenders 5"><span class='ocrx_word' id='word_1_167' title='bbox 158 445 200 460; x_wconf 85' lang='eng' dir='ltr'>show</span> <span class='ocrx_word' id='word_1_168' title='bbox 207 446 239 460; x_wconf 87' lang='eng' dir='ltr'>that</span> <span class='ocrx_word' id='word_1_169' title='bbox 245 448 313 465; x_wconf 74' lang='eng' dir='ltr'>protocol</span> <span class='ocrx_word' id='word_1_170' title='bbox 320 449 332 463; x_wconf 82' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_171' title='bbox 339 454 365 463; x_wconf 85' lang='eng' dir='ltr'>not</span> <span class='ocrx_word' id='word_1_172' title='bbox 372 449 391 468; x_wconf 88' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_173' title='bbox 398 454 450 465; x_wconf 79' lang='eng' dir='ltr'>nature</span> <span class='ocrx_word' id='word_1_174' title='bbox 456 451 540 467; x_wconf 82' lang='eng' dir='ltr'>horizontal</span> <span class='ocrx_word' id='word_1_175' title='bbox 547 458 563 468; x_wconf 88' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_176' title='bbox 569 455 635 472; x_wconf 87' lang='eng' dir='ltr'>vertical,</span> <span class='ocrx_word' id='word_1_177' title='bbox 642 455 670 470; x_wconf 84' lang='eng' dir='ltr'>but</span> <span class='ocrx_word' id='word_1_178' title='bbox 677 456 709 471; x_wconf 83' lang='eng' dir='ltr'>that</span> <span class='ocrx_word' id='word_1_179' title='bbox 715 459 783 476; x_wconf 70' lang='eng' dir='ltr'>protocol</span>
</span>
<span class='ocr_line' id='line_1_19' title="bbox 158 474 783 506; baseline 0.022 -18; x_size 20; x_descenders 5; x_ascenders 4"><span class='ocrx_word' id='word_1_180' title='bbox 158 474 170 488; x_wconf 88' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_181' title='bbox 176 479 195 489; x_wconf 77' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_182' title='bbox 202 475 290 494; x_wconf 77' lang='eng' dir='ltr'>algorithm,</span> <span class='ocrx_word' id='word_1_183' title='bbox 296 482 306 491; x_wconf 70' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_184' title='bbox 310 479 426 498; x_wconf 64' lang='eng' dir='ltr'>[traicriprimfar</span> <span class='ocrx_word' id='word_1_185' title='bbox 430 483 496 496; x_wconf 56' lang='eng' dir='ltr'>mus-rm:</span> <span class='ocrx_word' id='word_1_186' title='bbox 502 482 552 497; x_wconf 82' lang='eng' dir='ltr'>whose</span> <span class='ocrx_word' id='word_1_187' title='bbox 559 482 597 497; x_wconf 80' lang='eng' dir='ltr'>form</span> <span class='ocrx_word' id='word_1_188' title='bbox 605 483 622 498; x_wconf 80' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_189' title='bbox 626 489 717 504; x_wconf 76' lang='eng' dir='ltr'>appearance</span> <span class='ocrx_word' id='word_1_190' title='bbox 725 492 758 506; x_wconf 87' lang='eng' dir='ltr'>may</span> <span class='ocrx_word' id='word_1_191' title='bbox 766 487 783 502; x_wconf 82' lang='eng' dir='ltr'>be</span>
</span>
<span class='ocr_line' id='line_1_20' title="bbox 157 504 520 529; baseline 0.022 -12; x_size 21.642857; x_descenders 5.5; x_ascenders 5.5"><span class='ocrx_word' id='word_1_192' title='bbox 157 508 185 522; x_wconf 88' lang='eng' dir='ltr'>any</span> <span class='ocrx_word' id='word_1_193' title='bbox 192 504 256 519; x_wconf 85' lang='eng' dir='ltr'>number</span> <span class='ocrx_word' id='word_1_194' title='bbox 261 505 279 520; x_wconf 75' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_195' title='bbox 282 505 353 521; x_wconf 75' lang='eng' dir='ltr'>different</span> <span class='ocrx_word' id='word_1_196' title='bbox 359 507 435 527; x_wconf 74' lang='eng' dir='ltr'>diagrams</span> <span class='ocrx_word' id='word_1_197' title='bbox 441 514 457 524; x_wconf 83' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_198' title='bbox 463 510 520 529; x_wconf 77' lang='eng' dir='ltr'>shapes.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_6' title="bbox 152 532 781 730">
<span class='ocr_line' id='line_1_21' title="bbox 181 532 781 563; baseline 0.022 -16; x_size 19; x_descenders 4; x_ascenders 5"><span class='ocrx_word' id='word_1_199' title='bbox 181 532 213 547; x_wconf 85' lang='eng' dir='ltr'>The</span> <span class='ocrx_word' id='word_1_200' title='bbox 218 534 288 553; x_wconf 73' lang='eng' dir='ltr'>simplest</span> <span class='ocrx_word' id='word_1_201' title='bbox 293 536 361 551; x_wconf 79' lang='eng' dir='ltr'>network</span> <span class='ocrx_word' id='word_1_202' title='bbox 366 536 434 556; x_wconf 79' lang='eng' dir='ltr'>diagram</span> <span class='ocrx_word' id='word_1_203' title='bbox 440 539 452 553; x_wconf 92' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_204' title='bbox 457 539 483 554; x_wconf 89' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_205' title='bbox 488 540 577 556; x_wconf 68' lang='eng' dir='ltr'>centralized</span> <span class='ocrx_word' id='word_1_206' title='bbox 584 542 651 557; x_wconf 84' lang='eng' dir='ltr'>network</span> <span class='ocrx_word' id='word_1_207' title='bbox 656 544 686 560; x_wconf 74' lang='eng' dir='ltr'>(see</span> <span class='ocrx_word' id='word_1_208' title='bbox 692 543 739 563; x_wconf 78' lang='eng' dir='ltr'>figure</span> <span class='ocrx_word' id='word_1_209' title='bbox 746 546 750 559; x_wconf 86' lang='eng'>1</span> <span class='ocrx_word' id='word_1_210' title='bbox 756 546 781 563; x_wconf 56' lang='eng'>.1).</span>
</span>
<span class='ocr_line' id='line_1_22' title="bbox 155 561 781 592; baseline 0.024 -17; x_size 18.769911; x_descenders 4.7699113; x_ascenders 4.7699118"><span class='ocrx_word' id='word_1_211' title='bbox 155 561 250 577; x_wconf 77' lang='eng' dir='ltr'>Centralized</span> <span class='ocrx_word' id='word_1_212' title='bbox 257 564 332 579; x_wconf 82' lang='eng' dir='ltr'>networks</span> <span class='ocrx_word' id='word_1_213' title='bbox 337 570 361 580; x_wconf 83' lang='eng' dir='ltr'>are</span> <span class='ocrx_word' id='word_1_214' title='bbox 367 566 467 582; x_wconf 77' lang='eng' dir='ltr'>hierarchical.</span> <span class='ocrx_word' id='word_1_215' title='bbox 474 568 516 588; x_wconf 85' lang='eng' dir='ltr'>They</span> <span class='ocrx_word' id='word_1_216' title='bbox 521 574 581 588; x_wconf 82' lang='eng' dir='ltr'>operate</span> <span class='ocrx_word' id='word_1_217' title='bbox 587 571 624 586; x_wconf 87' lang='eng' dir='ltr'>with</span> <span class='ocrx_word' id='word_1_218' title='bbox 630 577 638 586; x_wconf 88' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_219' title='bbox 643 573 693 592; x_wconf 71' lang='eng' dir='ltr'>single</span> <span class='ocrx_word' id='word_1_220' title='bbox 698 574 781 589; x_wconf 67' lang='eng' dir='ltr'>authotira»</span>
</span>
<span class='ocr_line' id='line_1_23' title="bbox 155 591 780 619; baseline 0.022 -14; x_size 18.769911; x_descenders 4.7699113; x_ascenders 4.7699118"><span class='ocrx_word' id='word_1_221' title='bbox 155 591 185 605; x_wconf 86' lang='eng' dir='ltr'>tive</span> <span class='ocrx_word' id='word_1_222' title='bbox 192 591 228 606; x_wconf 91' lang='eng' dir='ltr'>hub.</span> <span class='ocrx_word' id='word_1_223' title='bbox 235 592 274 607; x_wconf 81' lang='eng' dir='ltr'>Each</span> <span class='ocrx_word' id='word_1_224' title='bbox 281 593 327 608; x_wconf 82' lang='eng' dir='ltr'>radial</span> <span class='ocrx_word' id='word_1_225' title='bbox 334 594 378 612; x_wconf 82' lang='eng' dir='ltr'>node,</span> <span class='ocrx_word' id='word_1_226' title='bbox 385 601 401 610; x_wconf 84' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_227' title='bbox 408 595 463 611; x_wconf 83' lang='eng' dir='ltr'>branch</span> <span class='ocrx_word' id='word_1_228' title='bbox 469 597 487 612; x_wconf 63' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_229' title='bbox 491 598 517 612; x_wconf 90' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_230' title='bbox 523 598 603 619; x_wconf 58' lang='eng' dir='ltr'>hierarchy,</span> <span class='ocrx_word' id='word_1_231' title='bbox 610 601 622 615; x_wconf 90' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_232' title='bbox 628 601 726 617; x_wconf 80' lang='eng' dir='ltr'>subordinate</span> <span class='ocrx_word' id='word_1_233' title='bbox 733 607 749 618; x_wconf 83' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_234' title='bbox 755 604 780 619; x_wconf 86' lang='eng' dir='ltr'>the</span>
</span>
<span class='ocr_line' id='line_1_24' title="bbox 154 620 780 650; baseline 0.024 -17; x_size 25.2349; x_descenders 4; x_ascenders 7.2348995"><span class='ocrx_word' id='word_1_235' title='bbox 154 620 209 635; x_wconf 76' lang='eng' dir='ltr'>central</span> <span class='ocrx_word' id='word_1_236' title='bbox 215 620 251 636; x_wconf 92' lang='eng' dir='ltr'>hub.</span> <span class='ocrx_word' id='word_1_237' title='bbox 257 622 282 636; x_wconf 84' lang='eng' dir='ltr'>All</span> <span class='ocrx_word' id='word_1_238' title='bbox 288 623 350 642; x_wconf 80' lang='eng' dir='ltr'>activity</span> <span class='ocrx_word' id='word_1_239' title='bbox 356 624 408 639; x_wconf 79' lang='eng' dir='ltr'>travels</span> <span class='ocrx_word' id='word_1_240' title='bbox 414 624 452 640; x_wconf 78' lang='eng' dir='ltr'>from</span> <span class='ocrx_word' id='word_1_241' title='bbox 457 631 508 641; x_wconf 88' lang='eng' dir='ltr'>center</span> <span class='ocrx_word' id='word_1_242' title='bbox 513 632 529 642; x_wconf 86' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_243' title='bbox 533 629 615 648; x_wconf 88' lang='eng' dir='ltr'>periphery.</span> <span class='ocrx_word' id='word_1_244' title='bbox 620 630 647 645; x_wconf 85' lang='eng' dir='ltr'>No</span> <span class='ocrx_word' id='word_1_245' title='bbox 651 631 735 650; x_wconf 78' lang='eng' dir='ltr'>peripheral</span> <span class='ocrx_word' id='word_1_246' title='bbox 741 633 780 648; x_wconf 86' lang='eng' dir='ltr'>node</span>
</span>
<span class='ocr_line' id='line_1_25' title="bbox 154 649 779 678; baseline 0.022 -15; x_size 26.2349; x_descenders 5; x_ascenders 7.2348995"><span class='ocrx_word' id='word_1_247' title='bbox 154 649 166 663; x_wconf 92' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_248' title='bbox 173 650 255 665; x_wconf 71' lang='eng' dir='ltr'>connected</span> <span class='ocrx_word' id='word_1_249' title='bbox 263 655 279 665; x_wconf 90' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_250' title='bbox 286 657 314 671; x_wconf 88' lang='eng' dir='ltr'>any</span> <span class='ocrx_word' id='word_1_251' title='bbox 321 653 365 667; x_wconf 84' lang='eng' dir='ltr'>other</span> <span class='ocrx_word' id='word_1_252' title='bbox 372 653 415 668; x_wconf 89' lang='eng' dir='ltr'>node.</span> <span class='ocrx_word' id='word_1_253' title='bbox 423 655 518 671; x_wconf 71' lang='eng' dir='ltr'>Centralized</span> <span class='ocrx_word' id='word_1_254' title='bbox 526 657 601 673; x_wconf 72' lang='eng' dir='ltr'>networks</span> <span class='ocrx_word' id='word_1_255' title='bbox 608 664 642 678; x_wconf 93' lang='eng' dir='ltr'>may</span> <span class='ocrx_word' id='word_1_256' title='bbox 650 660 687 675; x_wconf 81' lang='eng' dir='ltr'>have</span> <span class='ocrx_word' id='word_1_257' title='bbox 694 666 735 676; x_wconf 80' lang='eng' dir='ltr'>more</span> <span class='ocrx_word' id='word_1_258' title='bbox 743 662 779 677; x_wconf 82' lang='eng' dir='ltr'>than</span>
</span>
<span class='ocr_line' id='line_1_26' title="bbox 153 677 778 710; baseline 0.022 -18; x_size 21.642857; x_descenders 5.5; x_ascenders 5.5"><span class='ocrx_word' id='word_1_259' title='bbox 153 683 181 693; x_wconf 88' lang='eng' dir='ltr'>one</span> <span class='ocrx_word' id='word_1_260' title='bbox 187 677 243 694; x_wconf 80' lang='eng' dir='ltr'>branch</span> <span class='ocrx_word' id='word_1_261' title='bbox 249 680 332 700; x_wconf 73' lang='eng' dir='ltr'>exrending</span> <span class='ocrx_word' id='word_1_262' title='bbox 338 686 365 696; x_wconf 89' lang='eng' dir='ltr'>out</span> <span class='ocrx_word' id='word_1_263' title='bbox 371 682 409 697; x_wconf 82' lang='eng' dir='ltr'>from</span> <span class='ocrx_word' id='word_1_264' title='bbox 417 684 442 698; x_wconf 87' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_265' title='bbox 448 689 502 703; x_wconf 75' lang='eng' dir='ltr'>center,</span> <span class='ocrx_word' id='word_1_266' title='bbox 509 685 537 700; x_wconf 84' lang='eng' dir='ltr'>but</span> <span class='ocrx_word' id='word_1_267' title='bbox 542 691 557 701; x_wconf 83' lang='eng' dir='ltr'>at</span> <span class='ocrx_word' id='word_1_268' title='bbox 563 687 598 702; x_wconf 84' lang='eng' dir='ltr'>each</span> <span class='ocrx_word' id='word_1_269' title='bbox 605 688 642 703; x_wconf 84' lang='eng' dir='ltr'>level</span> <span class='ocrx_word' id='word_1_270' title='bbox 649 688 666 703; x_wconf 68' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_271' title='bbox 670 689 695 704; x_wconf 87' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_272' title='bbox 702 690 778 710; x_wconf 74' lang='eng' dir='ltr'>hierarchy</span>
</span>
<span class='ocr_line' id='line_1_27' title="bbox 152 708 525 730; baseline 0.021 -9; x_size 19; x_descenders 4; x_ascenders 5"><span class='ocrx_word' id='word_1_273' title='bbox 152 712 203 725; x_wconf 80' lang='eng' dir='ltr'>power</span> <span class='ocrx_word' id='word_1_274' title='bbox 208 708 220 722; x_wconf 90' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_275' title='bbox 227 709 291 724; x_wconf 83' lang='eng' dir='ltr'>wielded</span> <span class='ocrx_word' id='word_1_276' title='bbox 298 709 317 729; x_wconf 88' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_277' title='bbox 323 711 349 725; x_wconf 87' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_278' title='bbox 355 715 382 730; x_wconf 83' lang='eng' dir='ltr'>top</span> <span class='ocrx_word' id='word_1_279' title='bbox 387 717 422 727; x_wconf 89' lang='eng' dir='ltr'>over</span> <span class='ocrx_word' id='word_1_280' title='bbox 428 713 454 728; x_wconf 84' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_281' title='bbox 460 713 525 729; x_wconf 87' lang='eng' dir='ltr'>bottom.</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_5' title="bbox 144 822 774 1082">
<p class='ocr_par' dir='ltr' id='par_1_7' title="bbox 147 822 774 916">
<span class='ocr_line' id='line_1_28' title="bbox 150 822 774 850; baseline 0.022 -17; x_size 24.25; x_descenders 5.5; x_ascenders 6.25"><span class='ocrx_word' id='word_1_282' title='bbox 150 822 161 833; x_wconf 89' lang='eng'>2.</span> <span class='ocrx_word' id='word_1_283' title='bbox 167 822 192 834; x_wconf 84' lang='eng' dir='ltr'>The</span> <span class='ocrx_word' id='word_1_284' title='bbox 197 822 250 835; x_wconf 79' lang='eng' dir='ltr'>division</span> <span class='ocrx_word' id='word_1_285' title='bbox 255 823 328 837; x_wconf 67' lang='eng' dir='ltr'>oi’networlt</span> <span class='ocrx_word' id='word_1_286' title='bbox 333 825 382 841; x_wconf 69' lang='eng' dir='ltr'>designs</span> <span class='ocrx_word' id='word_1_287' title='bbox 387 831 414 839; x_wconf 70' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_288' title='bbox 418 828 496 843; x_wconf 68' lang='eng' dir='ltr'>centralized,</span> <span class='ocrx_word' id='word_1_289' title='bbox 501 829 594 845; x_wconf 73' lang='eng' dir='ltr'>decentralized,</span> <span class='ocrx_word' id='word_1_290' title='bbox 599 832 622 844; x_wconf 77' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_291' title='bbox 627 832 702 846; x_wconf 66' lang='eng' dir='ltr'>distributed</span> <span class='ocrx_word' id='word_1_292' title='bbox 708 838 757 850; x_wconf 72' lang='eng' dir='ltr'>appears</span> <span class='ocrx_word' id='word_1_293' title='bbox 762 840 774 847; x_wconf 89' lang='eng' dir='ltr'>in</span>
</span>
<span class='ocr_line' id='line_1_29' title="bbox 149 849 774 874; baseline 0.022 -14; x_size 14.226666; x_descenders 3.2266665; x_ascenders 3.6666667"><span class='ocrx_word' id='word_1_294' title='bbox 149 849 177 861; x_wconf 73' lang='eng' dir='ltr'>Paul</span> <span class='ocrx_word' id='word_1_295' title='bbox 182 849 230 862; x_wconf 61' lang='eng' dir='ltr'>Baron&#39;s</span> <span class='ocrx_word' id='word_1_296' title='bbox 234 851 251 862; x_wconf 73' lang='eng' dir='ltr'>0n</span> <span class='ocrx_word' id='word_1_297' title='bbox 255 851 326 864; x_wconf 63' lang='eng' dir='ltr'>Durrrbuml</span> <span class='ocrx_word' id='word_1_298' title='bbox 328 853 338 864; x_wconf 89' lang='eng' dir='ltr'><em>C</em></span> <span class='ocrx_word' id='word_1_299' title='bbox 339 857 431 866; x_wconf 64' lang='eng' dir='ltr'>Mrtrmmmlmmx</span> <span class='ocrx_word' id='word_1_300' title='bbox 437 855 441 866; x_wconf 84' lang='eng' dir='ltr'>l</span> <span class='ocrx_word' id='word_1_301' title='bbox 443 864 445 866; x_wconf 87' lang='eng'>.</span> <span class='ocrx_word' id='word_1_302' title='bbox 451 856 456 867; x_wconf 94' lang='eng' dir='ltr'>I</span> <span class='ocrx_word' id='word_1_303' title='bbox 457 856 524 868; x_wconf 67' lang='eng' dir='ltr'>n/mdrit’tnm</span> <span class='ocrx_word' id='word_1_304' title='bbox 528 860 538 869; x_wconf 77' lang='eng' dir='ltr'>In</span> <span class='ocrx_word' id='word_1_305' title='bbox 542 858 613 870; x_wconf 63' lang='eng' dir='ltr'>Drrlrrfiuled</span> <span class='ocrx_word' id='word_1_306' title='bbox 615 859 625 871; x_wconf 85' lang='eng' dir='ltr'><strong><em>C</em></strong></span> <span class='ocrx_word' id='word_1_307' title='bbox 625 863 676 872; x_wconf 76' lang='eng' dir='ltr'>ummuml</span> <span class='ocrx_word' id='word_1_308' title='bbox 678 863 714 873; x_wconf 75' lang='eng' dir='ltr'>atmm</span> <span class='ocrx_word' id='word_1_309' title='bbox 717 862 774 874; x_wconf 57' lang='eng' dir='ltr'>Newark;</span>
</span>
<span class='ocr_line' id='line_1_30' title="bbox 148 876 773 904; baseline 0.024 -17; x_size 24.25; x_descenders 5.5; x_ascenders 6.25"><span class='ocrx_word' id='word_1_310' title='bbox 148 876 189 889; x_wconf 77' lang='eng' dir='ltr'>(sanra</span> <span class='ocrx_word' id='word_1_311' title='bbox 193 877 247 891; x_wconf 72' lang='eng' dir='ltr'>Monica.</span> <span class='ocrx_word' id='word_1_312' title='bbox 252 878 277 890; x_wconf 85' lang='eng' dir='ltr'>CA:</span> <span class='ocrx_word' id='word_1_313' title='bbox 283 879 337 894; x_wconf 74' lang='eng' dir='ltr'>RAND,</span> <span class='ocrx_word' id='word_1_314' title='bbox 344 880 385 895; x_wconf 78' lang='eng'>1964),</span> <span class='ocrx_word' id='word_1_315' title='bbox 390 885 402 896; x_wconf 79' lang='eng' dir='ltr'>p.</span> <span class='ocrx_word' id='word_1_316' title='bbox 409 882 416 893; x_wconf 89' lang='eng'>2</span> <span class='ocrx_word' id='word_1_317' title='bbox 425 882 473 895; x_wconf 65' lang='eng' dir='ltr'>Barnn‘s</span> <span class='ocrx_word' id='word_1_318' title='bbox 478 883 539 899; x_wconf 66' lang='eng' dir='ltr'>diagrams</span> <span class='ocrx_word' id='word_1_319' title='bbox 544 884 574 897; x_wconf 81' lang='eng' dir='ltr'>have</span> <span class='ocrx_word' id='word_1_320' title='bbox 579 885 608 897; x_wconf 84' lang='eng' dir='ltr'>been</span> <span class='ocrx_word' id='word_1_321' title='bbox 614 887 657 902; x_wconf 78' lang='eng' dir='ltr'>copied</span> <span class='ocrx_word' id='word_1_322' title='bbox 663 887 678 903; x_wconf 86' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_323' title='bbox 683 892 719 904; x_wconf 83' lang='eng' dir='ltr'>many</span> <span class='ocrx_word' id='word_1_324' title='bbox 724 889 773 902; x_wconf 80' lang='eng' dir='ltr'>authors</span>
</span>
<span class='ocr_line' id='line_1_31' title="bbox 147 904 218 916; baseline 0.028 -2; x_size 14.226666; x_descenders 3.2266665; x_ascenders 3.6666667"><span class='ocrx_word' id='word_1_325' title='bbox 147 907 180 915; x_wconf 78' lang='eng' dir='ltr'>since</span> <span class='ocrx_word' id='word_1_326' title='bbox 185 904 218 916; x_wconf 73' lang='eng' dir='ltr'>then.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_8' title="bbox 144 930 772 1082">
<span class='ocr_line' id='line_1_32' title="bbox 172 930 772 959; baseline 0.022 -17; x_size 24.25; x_descenders 5.5; x_ascenders 6.25"><span class='ocrx_word' id='word_1_327' title='bbox 172 930 238 947; x_wconf 70' lang='eng' dir='ltr'>Following</span> <span class='ocrx_word' id='word_1_328' title='bbox 242 932 297 944; x_wconf 78' lang='eng' dir='ltr'>willirrn</span> <span class='ocrx_word' id='word_1_329' title='bbox 302 933 372 949; x_wconf 73' lang='eng' dir='ltr'>Evan,}olln</span> <span class='ocrx_word' id='word_1_330' title='bbox 376 935 457 950; x_wconf 72' lang='eng' dir='ltr'>Arqlullharld</span> <span class='ocrx_word' id='word_1_331' title='bbox 462 937 501 949; x_wconf 72' lang='eng' dir='ltr'>David</span> <span class='ocrx_word' id='word_1_332' title='bbox 505 938 562 950; x_wconf 59' lang='eng' dir='ltr'>Roiirtldt</span> <span class='ocrx_word' id='word_1_333' title='bbox 566 943 615 955; x_wconf 68' lang='eng' dir='ltr'>suggest</span> <span class='ocrx_word' id='word_1_334' title='bbox 619 945 625 952; x_wconf 77' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_335' title='bbox 629 941 719 957; x_wconf 67' lang='eng' dir='ltr'>topologyeven</span> <span class='ocrx_word' id='word_1_336' title='bbox 723 943 772 959; x_wconf 77' lang='eng' dir='ltr'>simpler</span>
</span>
<span class='ocr_line' id='line_1_33' title="bbox 147 957 771 986; baseline 0.022 -18; x_size 24.25; x_descenders 5.5; x_ascenders 6.25"><span class='ocrx_word' id='word_1_337' title='bbox 147 957 176 969; x_wconf 83' lang='eng' dir='ltr'>than</span> <span class='ocrx_word' id='word_1_338' title='bbox 181 957 201 969; x_wconf 79' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_339' title='bbox 206 959 279 971; x_wconf 70' lang='eng' dir='ltr'>Centralized</span> <span class='ocrx_word' id='word_1_340' title='bbox 284 960 343 973; x_wconf 70' lang='eng' dir='ltr'>network.</span> <span class='ocrx_word' id='word_1_341' title='bbox 349 961 378 973; x_wconf 76' lang='eng' dir='ltr'>This</span> <span class='ocrx_word' id='word_1_342' title='bbox 384 966 393 974; x_wconf 91' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_343' title='bbox 398 962 419 974; x_wconf 64' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_344' title='bbox 423 963 459 975; x_wconf 74' lang='eng' dir='ltr'>thain</span> <span class='ocrx_word' id='word_1_345' title='bbox 464 968 477 976; x_wconf 84' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_346' title='bbox 482 964 507 976; x_wconf 83' lang='eng' dir='ltr'>line</span> <span class='ocrx_word' id='word_1_347' title='bbox 512 965 570 977; x_wconf 71' lang='eng' dir='ltr'>ncrwrirk-</span> <span class='ocrx_word' id='word_1_348' title='bbox 576 966 594 978; x_wconf 77' lang='eng' dir='ltr'>rot</span> <span class='ocrx_word' id='word_1_349' title='bbox 598 968 658 983; x_wconf 78' lang='eng' dir='ltr'>example,</span> <span class='ocrx_word' id='word_1_350' title='bbox 663 969 682 980; x_wconf 54' lang='eng' dir='ltr'>“in</span> <span class='ocrx_word' id='word_1_351' title='bbox 687 973 694 980; x_wconf 78' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_352' title='bbox 698 970 771 986; x_wconf 72' lang='eng' dir='ltr'>smuggling</span>
</span>
<span class='ocr_line' id='line_1_34' title="bbox 145 984 771 1010; baseline 0.024 -15; x_size 24.25; x_descenders 5.5; x_ascenders 6.25"><span class='ocrx_word' id='word_1_353' title='bbox 145 984 181 996; x_wconf 69' lang='eng' dir='ltr'>than</span> <span class='ocrx_word' id='word_1_354' title='bbox 187 985 226 997; x_wconf 77' lang='eng' dir='ltr'>where</span> <span class='ocrx_word' id='word_1_355' title='bbox 231 986 279 1001; x_wconf 78' lang='eng' dir='ltr'>people,</span> <span class='ocrx_word' id='word_1_356' title='bbox 284 987 328 1002; x_wconf 73' lang='eng' dir='ltr'>goods,</span> <span class='ocrx_word' id='word_1_357' title='bbox 333 992 347 1000; x_wconf 86' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_358' title='bbox 352 988 431 1001; x_wconf 64' lang='eng' dir='ltr'>Information</span> <span class='ocrx_word' id='word_1_359' title='bbox 437 994 473 1003; x_wconf 79' lang='eng' dir='ltr'>move</span> <span class='ocrx_word' id='word_1_360' title='bbox 478 991 515 1007; x_wconf 71' lang='eng' dir='ltr'>along</span> <span class='ocrx_word' id='word_1_361' title='bbox 520 996 526 1004; x_wconf 84' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_362' title='bbox 532 992 556 1005; x_wconf 83' lang='eng' dir='ltr'>line</span> <span class='ocrx_word' id='word_1_363' title='bbox 562 993 632 1009; x_wconf 69' lang='eng' dir='ltr'>otscparate</span> <span class='ocrx_word' id='word_1_364' title='bbox 637 999 696 1010; x_wconf 68' lang='eng' dir='ltr'>tontatts,</span> <span class='ocrx_word' id='word_1_365' title='bbox 702 997 725 1008; x_wconf 76' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_366' title='bbox 731 997 771 1010; x_wconf 75' lang='eng' dir='ltr'>where</span>
</span>
<span class='ocr_line' id='line_1_35' title="bbox 144 1011 769 1039; baseline 0.022 -17; x_size 24.25; x_descenders 5.5; x_ascenders 6.25"><span class='ocrx_word' id='word_1_367' title='bbox 144 1011 218 1024; x_wconf 45' lang='eng' dir='ltr'>end-torend</span> <span class='ocrx_word' id='word_1_368' title='bbox 225 1017 330 1026; x_wconf 77' lang='eng' dir='ltr'>tnrnniunicarinn</span> <span class='ocrx_word' id='word_1_369' title='bbox 338 1019 371 1027; x_wconf 86' lang='eng' dir='ltr'>must</span> <span class='ocrx_word' id='word_1_370' title='bbox 378 1017 414 1028; x_wconf 74' lang='eng' dir='ltr'>travel</span> <span class='ocrx_word' id='word_1_371' title='bbox 422 1017 475 1033; x_wconf 65' lang='eng' dir='ltr'>through</span> <span class='ocrx_word' id='word_1_372' title='bbox 482 1018 503 1030; x_wconf 75' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_373' title='bbox 510 1020 595 1032; x_wconf 65' lang='eng' dir='ltr'>intermediate</span> <span class='ocrx_word' id='word_1_374' title='bbox 602 1021 638 1034; x_wconf 85' lang='eng' dir='ltr'>nodes</span> <span class='ocrx_word' id='word_1_375' title='bbox 645 1022 649 1025; x_wconf 68' lang='eng'><em>&quot;</em></span> <span class='ocrx_word' id='word_1_376' title='bbox 656 1022 677 1034; x_wconf 77' lang='eng' dir='ltr'>See</span> <span class='ocrx_word' id='word_1_377' title='bbox 684 1023 740 1039; x_wconf 69' lang='eng' dir='ltr'>Arquilllt</span> <span class='ocrx_word' id='word_1_378' title='bbox 746 1025 769 1037; x_wconf 82' lang='eng' dir='ltr'>and</span>
</span>
<span class='ocr_line' id='line_1_36' title="bbox 144 1038 768 1065; baseline 0.024 -16; x_size 24.25; x_descenders 5.5; x_ascenders 6.25"><span class='ocrx_word' id='word_1_379' title='bbox 144 1038 207 1053; x_wconf 73' lang='eng' dir='ltr'>Ronfeldr,</span> <span class='ocrx_word' id='word_1_380' title='bbox 212 1040 270 1052; x_wconf 60' lang='eng' dir='ltr'>Now/er</span> <span class='ocrx_word' id='word_1_381' title='bbox 275 1041 300 1053; x_wconf 64' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_382' title='bbox 303 1042 359 1054; x_wconf 54' lang='eng' dir='ltr'>Nation.-</span> <span class='ocrx_word' id='word_1_383' title='bbox 365 1042 388 1055; x_wconf 69' lang='eng' dir='ltr'>m</span> <span class='ocrx_word' id='word_1_384' title='bbox 392 1044 433 1056; x_wconf 67' lang='eng' dir='ltr'>harm</span> <span class='ocrx_word' id='word_1_385' title='bbox 438 1044 451 1060; x_wconf 82' lang='eng' dir='ltr'>r/</span> <span class='ocrx_word' id='word_1_386' title='bbox 454 1045 492 1058; x_wconf 67' lang='eng' dir='ltr'>Terror,</span> <span class='ocrx_word' id='word_1_387' title='bbox 498 1046 538 1059; x_wconf 62' lang='eng' dir='ltr'>Crime,</span> <span class='ocrx_word' id='word_1_388' title='bbox 544 1047 569 1059; x_wconf 57' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_389' title='bbox 572 1047 633 1064; x_wconf 67' lang='eng' dir='ltr'>MI/Ilam)‘</span> <span class='ocrx_word' id='word_1_390' title='bbox 638 1049 679 1062; x_wconf 73' lang='eng' dir='ltr'>(Santa</span> <span class='ocrx_word' id='word_1_391' title='bbox 684 1050 738 1065; x_wconf 81' lang='eng' dir='ltr'>Monita,</span> <span class='ocrx_word' id='word_1_392' title='bbox 743 1051 768 1063; x_wconf 57' lang='eng' dir='ltr'>cr-</span>
</span>
<span class='ocr_line' id='line_1_37' title="bbox 144 1065 280 1082; baseline 0.022 -6; x_size 14.226666; x_descenders 3.2266665; x_ascenders 3.6666667"><span class='ocrx_word' id='word_1_393' title='bbox 144 1065 197 1079; x_wconf 80' lang='eng' dir='ltr'><strong>RAND.</strong></span> <span class='ocrx_word' id='word_1_394' title='bbox 203 1066 246 1081; x_wconf 80' lang='eng'>2001),</span> <span class='ocrx_word' id='word_1_395' title='bbox 251 1071 259 1082; x_wconf 77' lang='eng' dir='ltr'>p</span> <span class='ocrx_word' id='word_1_396' title='bbox 269 1068 280 1079; x_wconf 87' lang='eng'>7.</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_6' title="bbox 426 1151 482 1165">
<p class='ocr_par' dir='ltr' id='par_1_9' title="bbox 426 1151 482 1165">
<span class='ocr_line' id='line_1_38' title="bbox 426 1151 482 1165; baseline 0.018 -3; x_size 24; x_descenders 6; x_ascenders 6"><span class='ocrx_word' id='word_1_397' title='bbox 426 1151 472 1165; x_wconf 76' lang='eng' dir='ltr'>Chapter</span> <span class='ocrx_word' id='word_1_398' title='bbox 477 1153 482 1163; x_wconf 71' lang='eng'>1</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_7' title="bbox 0 1229 536 1240">
<p class='ocr_par' dir='ltr' id='par_1_10' title="bbox 0 1229 536 1240">
<span class='ocr_line' id='line_1_39' title="bbox 0 1229 536 1240; baseline 0 0; x_size 20; x_descenders 5; x_ascenders 5"><span class='ocrx_word' id='word_1_399' title='bbox 0 1229 536 1240; x_wconf 95' lang='eng' dir='ltr'> </span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_8' title="bbox 874 0 988 1240">
<p class='ocr_par' dir='ltr' id='par_1_11' title="bbox 874 0 988 1240">
<span class='ocr_line' id='line_1_40' title="bbox 874 0 988 1240; baseline 0 0; x_size 621; x_descenders -310.5; x_ascenders 310.5"><span class='ocrx_word' id='word_1_400' title='bbox 874 0 988 1240; x_wconf 95' lang='eng' dir='ltr'> </span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_9' title="bbox 1243 19 1480 38">
<p class='ocr_par' dir='ltr' id='par_1_12' title="bbox 1243 19 1480 38">
<span class='ocr_line' id='line_1_41' title="bbox 1243 19 1480 38; baseline -0.013 2; x_size 26.296295; x_descenders 5.2962961; x_ascenders 8"><span class='ocrx_word' id='word_1_401' title='bbox 1243 19 1253 32; x_wconf 69' lang='eng' dir='ltr'>B</span> <span class='ocrx_word' id='word_1_402' title='bbox 1422 25 1446 38; x_wconf 79' lang='eng' dir='ltr'>A:</span> <span class='ocrx_word' id='word_1_403' title='bbox 1453 24 1480 37; x_wconf 84' lang='eng' dir='ltr'>hub</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_10' title="bbox 1142 45 1491 272">
<p class='ocr_par' dir='ltr' id='par_1_13' title="bbox 1142 45 1491 272">
<span class='ocr_line' id='line_1_42' title="bbox 1422 45 1491 58; baseline 0 0; x_size 18.454546; x_descenders 5.4545455; x_ascenders 3"><span class='ocrx_word' id='word_1_404' title='bbox 1422 45 1433 58; x_wconf 90' lang='eng' dir='ltr'><strong>B</strong></span> <span class='ocrx_word' id='word_1_405' title='bbox 1438 51 1448 56; x_wconf 91' lang='eng'><strong>=</strong></span> <span class='ocrx_word' id='word_1_406' title='bbox 1454 45 1491 58; x_wconf 82' lang='eng' dir='ltr'>node</span>
</span>
<span class='ocr_line' id='line_1_43' title="bbox 1142 63 1355 78; baseline -0.009 0; x_size 17.588234; x_descenders 4.5882349; x_ascenders 4.5882354"><span class='ocrx_word' id='word_1_407' title='bbox 1142 65 1152 78; x_wconf 83' lang='eng' dir='ltr'>B</span> <span class='ocrx_word' id='word_1_408' title='bbox 1345 63 1355 76; x_wconf 87' lang='eng' dir='ltr'>B</span>
</span>
<span class='ocr_line' id='line_1_44' title="bbox 1143 179 1355 192; baseline 0 0; x_size 17.588234; x_descenders 4.5882349; x_ascenders 4.5882354"><span class='ocrx_word' id='word_1_409' title='bbox 1143 179 1153 192; x_wconf 88' lang='eng' dir='ltr'>B</span> <span class='ocrx_word' id='word_1_410' title='bbox 1345 179 1355 192; x_wconf 86' lang='eng' dir='ltr'>B</span>
</span>
<span class='ocr_line' id='line_1_45' title="bbox 1245 226 1255 238; baseline 0 0; x_size 23; x_descenders 6; x_ascenders 6"><span class='ocrx_word' id='word_1_411' title='bbox 1245 226 1255 238; x_wconf 80' lang='eng' dir='ltr'>E</span>
</span>
<span class='ocr_line' id='line_1_46' title="bbox 1290 260 1349 272; baseline 0 -2; x_size 23; x_descenders 6; x_ascenders 6"><span class='ocrx_word' id='word_1_412' title='bbox 1290 260 1326 272; x_wconf 73' lang='eng' dir='ltr'>Figure</span> <span class='ocrx_word' id='word_1_413' title='bbox 1332 260 1349 270; x_wconf 80' lang='eng'>1.1</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_11' title="bbox 1255 277 1383 288">
<p class='ocr_par' dir='ltr' id='par_1_14' title="bbox 1255 277 1383 288">
<span class='ocr_line' id='line_1_47' title="bbox 1255 277 1383 288; baseline -0.016 0; x_size 20; x_descenders 5; x_ascenders 5"><span class='ocrx_word' id='word_1_414' title='bbox 1255 278 1263 288; x_wconf 65' lang='eng' dir='ltr'><strong>A</strong></span> <span class='ocrx_word' id='word_1_415' title='bbox 1268 277 1332 288; x_wconf 70' lang='eng' dir='ltr'>centralized</span> <span class='ocrx_word' id='word_1_416' title='bbox 1337 277 1383 287; x_wconf 69' lang='eng' dir='ltr'>network</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_12' title="bbox 1008 332 1639 908">
<p class='ocr_par' dir='ltr' id='par_1_15' title="bbox 1008 332 1633 482">
<span class='ocr_line' id='line_1_48' title="bbox 1032 332 1631 365; baseline -0.008 -13; x_size 26.333334; x_descenders 5; x_ascenders 7.333334"><span class='ocrx_word' id='word_1_417' title='bbox 1032 337 1064 352; x_wconf 78' lang='eng' dir='ltr'>The</span> <span class='ocrx_word' id='word_1_418' title='bbox 1073 337 1154 352; x_wconf 74' lang='eng' dir='ltr'>American</span> <span class='ocrx_word' id='word_1_419' title='bbox 1164 336 1225 355; x_wconf 78' lang='eng' dir='ltr'>judicial</span> <span class='ocrx_word' id='word_1_420' title='bbox 1235 341 1296 355; x_wconf 79' lang='eng' dir='ltr'>system,</span> <span class='ocrx_word' id='word_1_421' title='bbox 1306 335 1328 350; x_wconf 78' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_422' title='bbox 1337 335 1410 354; x_wconf 80' lang='eng' dir='ltr'>example,</span> <span class='ocrx_word' id='word_1_423' title='bbox 1421 335 1432 349; x_wconf 92' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_424' title='bbox 1442 340 1450 349; x_wconf 84' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_425' title='bbox 1459 333 1549 349; x_wconf 74' lang='eng' dir='ltr'>centralized</span> <span class='ocrx_word' id='word_1_426' title='bbox 1559 332 1631 365; x_wconf 82' lang='eng' dir='ltr'>network.</span>
</span>
<span class='ocr_line' id='line_1_49' title="bbox 1008 362 1632 385; baseline -0.006 -4; x_size 26.333334; x_descenders 5; x_ascenders 7.333334"><span class='ocrx_word' id='word_1_427' title='bbox 1008 366 1060 382; x_wconf 80' lang='eng' dir='ltr'>While</span> <span class='ocrx_word' id='word_1_428' title='bbox 1066 367 1107 381; x_wconf 81' lang='eng' dir='ltr'>there</span> <span class='ocrx_word' id='word_1_429' title='bbox 1113 371 1136 381; x_wconf 91' lang='eng' dir='ltr'>are</span> <span class='ocrx_word' id='word_1_430' title='bbox 1142 371 1187 385; x_wconf 86' lang='eng' dir='ltr'>many</span> <span class='ocrx_word' id='word_1_431' title='bbox 1193 365 1238 380; x_wconf 88' lang='eng' dir='ltr'>levels</span> <span class='ocrx_word' id='word_1_432' title='bbox 1244 369 1260 380; x_wconf 84' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_433' title='bbox 1266 365 1291 380; x_wconf 89' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_434' title='bbox 1297 369 1339 379; x_wconf 85' lang='eng' dir='ltr'>court</span> <span class='ocrx_word' id='word_1_435' title='bbox 1345 369 1406 383; x_wconf 58' lang='eng' dir='ltr'>system,</span> <span class='ocrx_word' id='word_1_436' title='bbox 1412 364 1448 379; x_wconf 87' lang='eng' dir='ltr'>each</span> <span class='ocrx_word' id='word_1_437' title='bbox 1454 363 1491 378; x_wconf 91' lang='eng' dir='ltr'>with</span> <span class='ocrx_word' id='word_1_438' title='bbox 1498 364 1517 378; x_wconf 90' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_439' title='bbox 1523 368 1557 378; x_wconf 90' lang='eng' dir='ltr'>own</span> <span class='ocrx_word' id='word_1_440' title='bbox 1563 362 1632 382; x_wconf 73' lang='eng' dir='ltr'>qulSdlC-</span>
</span>
<span class='ocr_line' id='line_1_50' title="bbox 1008 391 1632 413; baseline -0.01 -2; x_size 21.5; x_descenders 5.5; x_ascenders 5.5"><span class='ocrx_word' id='word_1_441' title='bbox 1008 396 1046 413; x_wconf 88' lang='eng' dir='ltr'>tion,</span> <span class='ocrx_word' id='word_1_442' title='bbox 1051 395 1086 410; x_wconf 82' lang='eng' dir='ltr'>each</span> <span class='ocrx_word' id='word_1_443' title='bbox 1091 395 1158 410; x_wconf 78' lang='eng' dir='ltr'>decision</span> <span class='ocrx_word' id='word_1_444' title='bbox 1163 394 1181 409; x_wconf 83' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_445' title='bbox 1183 395 1219 409; x_wconf 81' lang='eng' dir='ltr'>each</span> <span class='ocrx_word' id='word_1_446' title='bbox 1224 399 1267 409; x_wconf 80' lang='eng' dir='ltr'>court</span> <span class='ocrx_word' id='word_1_447' title='bbox 1272 399 1299 409; x_wconf 79' lang='eng' dir='ltr'>can</span> <span class='ocrx_word' id='word_1_448' title='bbox 1303 394 1357 412; x_wconf 87' lang='eng' dir='ltr'>always</span> <span class='ocrx_word' id='word_1_449' title='bbox 1363 393 1381 408; x_wconf 89' lang='eng' dir='ltr'>be</span> <span class='ocrx_word' id='word_1_450' title='bbox 1385 392 1459 408; x_wconf 76' lang='eng' dir='ltr'>escalated</span> <span class='ocrx_word' id='word_1_451' title='bbox 1464 392 1537 411; x_wconf 80' lang='eng' dir='ltr'>(through</span> <span class='ocrx_word' id='word_1_452' title='bbox 1542 392 1567 406; x_wconf 89' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_453' title='bbox 1572 391 1632 411; x_wconf 81' lang='eng' dir='ltr'>appeals</span>
</span>
<span class='ocr_line' id='line_1_51' title="bbox 1008 421 1633 445; baseline -0.008 -5; x_size 26.333334; x_descenders 5; x_ascenders 7.333334"><span class='ocrx_word' id='word_1_454' title='bbox 1008 425 1073 445; x_wconf 77' lang='eng' dir='ltr'>process)</span> <span class='ocrx_word' id='word_1_455' title='bbox 1078 429 1094 439; x_wconf 96' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_456' title='bbox 1099 430 1107 439; x_wconf 88' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_457' title='bbox 1112 424 1166 443; x_wconf 74' lang='eng' dir='ltr'>higher</span> <span class='ocrx_word' id='word_1_458' title='bbox 1171 424 1208 439; x_wconf 82' lang='eng' dir='ltr'>level</span> <span class='ocrx_word' id='word_1_459' title='bbox 1214 424 1230 438; x_wconf 92' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_460' title='bbox 1236 423 1261 438; x_wconf 83' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_461' title='bbox 1267 423 1345 442; x_wconf 83' lang='eng' dir='ltr'>hierarchy.</span> <span class='ocrx_word' id='word_1_462' title='bbox 1352 422 1446 441; x_wconf 80' lang='eng' dir='ltr'>Ultimately,</span> <span class='ocrx_word' id='word_1_463' title='bbox 1452 422 1524 439; x_wconf 82' lang='eng' dir='ltr'>however,</span> <span class='ocrx_word' id='word_1_464' title='bbox 1530 421 1556 436; x_wconf 89' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_465' title='bbox 1560 421 1633 440; x_wconf 78' lang='eng' dir='ltr'>Supreme</span>
</span>
<span class='ocr_line' id='line_1_52' title="bbox 1008 452 1570 482; baseline -0.009 -13; x_size 25.333334; x_descenders 4; x_ascenders 7.333334"><span class='ocrx_word' id='word_1_466' title='bbox 1008 454 1055 469; x_wconf 80' lang='eng' dir='ltr'>Court</span> <span class='ocrx_word' id='word_1_467' title='bbox 1062 454 1087 468; x_wconf 86' lang='eng' dir='ltr'>has</span> <span class='ocrx_word' id='word_1_468' title='bbox 1094 453 1128 468; x_wconf 75' lang='eng' dir='ltr'>final</span> <span class='ocrx_word' id='word_1_469' title='bbox 1135 459 1159 472; x_wconf 83' lang='eng' dir='ltr'>say</span> <span class='ocrx_word' id='word_1_470' title='bbox 1165 458 1200 468; x_wconf 87' lang='eng' dir='ltr'>over</span> <span class='ocrx_word' id='word_1_471' title='bbox 1205 453 1225 467; x_wconf 91' lang='eng' dir='ltr'>all</span> <span class='ocrx_word' id='word_1_472' title='bbox 1231 457 1293 467; x_wconf 82' lang='eng' dir='ltr'>matters</span> <span class='ocrx_word' id='word_1_473' title='bbox 1299 452 1351 467; x_wconf 77' lang='eng' dir='ltr'>orlaw.</span> <span class='ocrx_word' id='word_1_474' title='bbox 1536 480 1538 482; x_wconf 99' lang='eng'>.</span> <span class='ocrx_word' id='word_1_475' title='bbox 1568 480 1570 482; x_wconf 99' lang='eng'>.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_16' title="bbox 1008 479 1635 673">
<span class='ocr_line' id='line_1_53' title="bbox 1033 479 1634 502; baseline -0.008 -4; x_size 25.333334; x_descenders 4; x_ascenders 7.333334"><span class='ocrx_word' id='word_1_476' title='bbox 1033 483 1065 498; x_wconf 87' lang='eng' dir='ltr'>The</span> <span class='ocrx_word' id='word_1_477' title='bbox 1073 483 1171 502; x_wconf 83' lang='eng' dir='ltr'>panopticon,</span> <span class='ocrx_word' id='word_1_478' title='bbox 1179 481 1257 497; x_wconf 73' lang='eng' dir='ltr'>described</span> <span class='ocrx_word' id='word_1_479' title='bbox 1266 482 1281 496; x_wconf 94' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_480' title='bbox 1289 481 1373 496; x_wconf 74' lang='eng' dir='ltr'>Foucault&#39;s</span> <span class='ocrx_word' id='word_1_481' title='bbox 1381 480 1458 499; x_wconf 63' lang='eng' dir='ltr'>Discipline</span> <span class='ocrx_word' id='word_1_482' title='bbox 1464 480 1495 495; x_wconf 64' lang='eng' dir='ltr'>ml</span> <span class='ocrx_word' id='word_1_483' title='bbox 1501 479 1557 497; x_wconf 64' lang='eng' dir='ltr'>Putin/r,</span> <span class='ocrx_word' id='word_1_484' title='bbox 1567 484 1579 494; x_wconf 86' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_485' title='bbox 1587 479 1618 494; x_wconf 89' lang='eng' dir='ltr'>also</span> <span class='ocrx_word' id='word_1_486' title='bbox 1626 484 1634 493; x_wconf 88' lang='eng' dir='ltr'>a</span>
</span>
<span class='ocr_line' id='line_1_54' title="bbox 1008 508 1633 540; baseline -0.008 -13; x_size 26.333334; x_descenders 5; x_ascenders 7.333334"><span class='ocrx_word' id='word_1_487' title='bbox 1008 512 1098 527; x_wconf 82' lang='eng' dir='ltr'>centralized</span> <span class='ocrx_word' id='word_1_488' title='bbox 1107 511 1179 526; x_wconf 81' lang='eng' dir='ltr'>network.</span> <span class='ocrx_word' id='word_1_489' title='bbox 1189 512 1205 526; x_wconf 90' lang='eng' dir='ltr'>In</span> <span class='ocrx_word' id='word_1_490' title='bbox 1214 511 1239 526; x_wconf 88' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_491' title='bbox 1247 511 1345 530; x_wconf 81' lang='eng' dir='ltr'>panopticon,</span> <span class='ocrx_word' id='word_1_492' title='bbox 1354 509 1444 529; x_wconf 88' lang='eng' dir='ltr'>repurposed</span> <span class='ocrx_word' id='word_1_493' title='bbox 1453 509 1472 528; x_wconf 87' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_494' title='bbox 1481 508 1552 524; x_wconf 73' lang='eng' dir='ltr'>Foucault</span> <span class='ocrx_word' id='word_1_495' title='bbox 1561 508 1599 523; x_wconf 70' lang='eng' dir='ltr'>from</span> <span class='ocrx_word' id='word_1_496' title='bbox 1608 508 1633 540; x_wconf 82' lang='eng' dir='ltr'>the</span>
</span>
<span class='ocr_line' id='line_1_55' title="bbox 1008 537 1633 560; baseline -0.008 -4; x_size 25.333334; x_descenders 4; x_ascenders 7.333334"><span class='ocrx_word' id='word_1_497' title='bbox 1008 542 1078 560; x_wconf 78' lang='eng' dir='ltr'>Writings</span> <span class='ocrx_word' id='word_1_498' title='bbox 1083 540 1101 556; x_wconf 70' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_499' title='bbox 1102 542 1162 560; x_wconf 74' lang='eng' dir='ltr'>Jeremy</span> <span class='ocrx_word' id='word_1_500' title='bbox 1168 540 1249 557; x_wconf 75' lang='eng' dir='ltr'>Bentham,</span> <span class='ocrx_word' id='word_1_501' title='bbox 1254 545 1262 554; x_wconf 85' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_502' title='bbox 1267 539 1315 559; x_wconf 76' lang='eng' dir='ltr'>guard</span> <span class='ocrx_word' id='word_1_503' title='bbox 1321 540 1333 554; x_wconf 89' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_504' title='bbox 1338 539 1403 554; x_wconf 86' lang='eng' dir='ltr'>situated</span> <span class='ocrx_word' id='word_1_505' title='bbox 1409 543 1424 553; x_wconf 94' lang='eng' dir='ltr'>at</span> <span class='ocrx_word' id='word_1_506' title='bbox 1430 539 1455 553; x_wconf 91' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_507' title='bbox 1461 543 1511 553; x_wconf 80' lang='eng' dir='ltr'>center</span> <span class='ocrx_word' id='word_1_508' title='bbox 1516 537 1533 553; x_wconf 72' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_509' title='bbox 1537 543 1581 556; x_wconf 87' lang='eng' dir='ltr'>many</span> <span class='ocrx_word' id='word_1_510' title='bbox 1588 537 1633 552; x_wconf 85' lang='eng' dir='ltr'>radial</span>
</span>
<span class='ocr_line' id='line_1_56' title="bbox 1008 566 1633 598; baseline -0.006 -13; x_size 25.333334; x_descenders 4; x_ascenders 7.333334"><span class='ocrx_word' id='word_1_511' title='bbox 1008 571 1048 586; x_wconf 92' lang='eng' dir='ltr'>cells.</span> <span class='ocrx_word' id='word_1_512' title='bbox 1056 570 1095 585; x_wconf 85' lang='eng' dir='ltr'>Each</span> <span class='ocrx_word' id='word_1_513' title='bbox 1101 570 1129 585; x_wconf 88' lang='eng' dir='ltr'>cell</span> <span class='ocrx_word' id='word_1_514' title='bbox 1136 570 1204 585; x_wconf 83' lang='eng' dir='ltr'>contains</span> <span class='ocrx_word' id='word_1_515' title='bbox 1210 575 1218 584; x_wconf 96' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_516' title='bbox 1225 570 1295 588; x_wconf 77' lang='eng' dir='ltr'>prisoner.</span> <span class='ocrx_word' id='word_1_517' title='bbox 1302 569 1339 583; x_wconf 84' lang='eng' dir='ltr'>This</span> <span class='ocrx_word' id='word_1_518' title='bbox 1345 568 1399 587; x_wconf 79' lang='eng' dir='ltr'>special</span> <span class='ocrx_word' id='word_1_519' title='bbox 1407 567 1505 586; x_wconf 84' lang='eng' dir='ltr'>relationship</span> <span class='ocrx_word' id='word_1_520' title='bbox 1512 566 1580 598; x_wconf 80' lang='eng' dir='ltr'>between</span> <span class='ocrx_word' id='word_1_521' title='bbox 1586 566 1633 598; x_wconf 80' lang='eng' dir='ltr'>guard</span>
</span>
<span class='ocr_line' id='line_1_57' title="bbox 1008 596 1634 627; baseline -0.006 -13; x_size 26.333334; x_descenders 5; x_ascenders 7.333334"><span class='ocrx_word' id='word_1_522' title='bbox 1008 600 1038 614; x_wconf 89' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_523' title='bbox 1043 600 1111 619; x_wconf 81' lang='eng' dir='ltr'>prisoner</span> <span class='ocrx_word' id='word_1_524' title='bbox 1116 599 1164 613; x_wconf 77' lang='eng' dir='ltr'>“links</span> <span class='ocrx_word' id='word_1_525' title='bbox 1169 599 1194 613; x_wconf 91' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_526' title='bbox 1199 603 1249 613; x_wconf 82' lang='eng' dir='ltr'>centre</span> <span class='ocrx_word' id='word_1_527' title='bbox 1254 598 1283 613; x_wconf 87' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_528' title='bbox 1288 598 1379 617; x_wconf 79' lang='eng' dir='ltr'>periphery.&quot;</span> <span class='ocrx_word' id='word_1_529' title='bbox 1385 598 1401 611; x_wconf 88' lang='eng' dir='ltr'>In</span> <span class='ocrx_word' id='word_1_530' title='bbox 1407 598 1424 614; x_wconf 87' lang='eng' dir='ltr'>it,</span> <span class='ocrx_word' id='word_1_531' title='bbox 1429 597 1488 616; x_wconf 69' lang='eng' dir='ltr'>“power</span> <span class='ocrx_word' id='word_1_532' title='bbox 1493 602 1505 611; x_wconf 91' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_533' title='bbox 1510 596 1584 627; x_wconf 72' lang='eng' dir='ltr'>exercised</span> <span class='ocrx_word' id='word_1_534' title='bbox 1588 596 1634 610; x_wconf 91' lang='eng' dir='ltr'>with-</span>
</span>
<span class='ocr_line' id='line_1_58' title="bbox 1009 625 1635 647; baseline -0.008 -3; x_size 26.333334; x_descenders 5; x_ascenders 7.333334"><span class='ocrx_word' id='word_1_535' title='bbox 1009 633 1036 644; x_wconf 89' lang='eng' dir='ltr'>out</span> <span class='ocrx_word' id='word_1_536' title='bbox 1043 629 1115 646; x_wconf 74' lang='eng' dir='ltr'>division,</span> <span class='ocrx_word' id='word_1_537' title='bbox 1122 628 1203 647; x_wconf 70' lang='eng' dir='ltr'>according</span> <span class='ocrx_word' id='word_1_538' title='bbox 1211 632 1227 642; x_wconf 88' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_539' title='bbox 1234 633 1242 642; x_wconf 88' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_540' title='bbox 1249 628 1340 642; x_wconf 83' lang='eng' dir='ltr'>continuous</span> <span class='ocrx_word' id='word_1_541' title='bbox 1348 626 1444 641; x_wconf 81' lang='eng' dir='ltr'>hierarchical</span> <span class='ocrx_word' id='word_1_542' title='bbox 1452 625 1508 645; x_wconf 72' lang='eng' dir='ltr'>figure&quot;</span> <span class='ocrx_word' id='word_1_543' title='bbox 1515 630 1601 644; x_wconf 71' lang='eng' dir='ltr'>occupying</span> <span class='ocrx_word' id='word_1_544' title='bbox 1609 625 1635 639; x_wconf 91' lang='eng' dir='ltr'>the</span>
</span>
<span class='ocr_line' id='line_1_59' title="bbox 1009 657 1115 673; baseline -0.009 0; x_size 18.8125; x_descenders 4.8125005; x_ascenders 4.8125"><span class='ocrx_word' id='word_1_545' title='bbox 1009 658 1065 673; x_wconf 77' lang='eng' dir='ltr'>central</span> <span class='ocrx_word' id='word_1_546' title='bbox 1072 657 1115 672; x_wconf 78' lang='eng' dir='ltr'>hub.‘</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_17' title="bbox 1009 682 1636 802">
<span class='ocr_line' id='line_1_60' title="bbox 1034 682 1635 704; baseline -0.008 -2; x_size 18.8125; x_descenders 4.8125005; x_ascenders 4.8125"><span class='ocrx_word' id='word_1_547' title='bbox 1034 687 1048 702; x_wconf 76' lang='eng' dir='ltr'><strong>A</strong></span> <span class='ocrx_word' id='word_1_548' title='bbox 1053 686 1157 702; x_wconf 63' lang='eng' dir='ltr'>decentralized</span> <span class='ocrx_word' id='word_1_549' title='bbox 1163 685 1229 701; x_wconf 81' lang='eng' dir='ltr'>network</span> <span class='ocrx_word' id='word_1_550' title='bbox 1236 686 1247 700; x_wconf 89' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_551' title='bbox 1252 691 1261 700; x_wconf 95' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_552' title='bbox 1266 685 1383 704; x_wconf 77' lang='eng' dir='ltr'>multiplication</span> <span class='ocrx_word' id='word_1_553' title='bbox 1389 684 1406 699; x_wconf 78' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_554' title='bbox 1409 685 1434 699; x_wconf 87' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_555' title='bbox 1440 683 1528 699; x_wconf 75' lang='eng' dir='ltr'>centralized</span> <span class='ocrx_word' id='word_1_556' title='bbox 1534 682 1601 698; x_wconf 84' lang='eng' dir='ltr'>network</span> <span class='ocrx_word' id='word_1_557' title='bbox 1606 683 1635 700; x_wconf 86' lang='eng' dir='ltr'>(see</span>
</span>
<span class='ocr_line' id='line_1_61' title="bbox 1010 712 1636 744; baseline -0.008 -13; x_size 18.8125; x_descenders 4.8125005; x_ascenders 4.8125"><span class='ocrx_word' id='word_1_558' title='bbox 1010 716 1058 735; x_wconf 75' lang='eng' dir='ltr'>figure</span> <span class='ocrx_word' id='word_1_559' title='bbox 1064 717 1068 730; x_wconf 86' lang='eng' dir='ltr'>I</span> <span class='ocrx_word' id='word_1_560' title='bbox 1073 717 1098 733; x_wconf 56' lang='eng'>.2).</span> <span class='ocrx_word' id='word_1_561' title='bbox 1103 716 1120 730; x_wconf 91' lang='eng' dir='ltr'>In</span> <span class='ocrx_word' id='word_1_562' title='bbox 1124 721 1132 730; x_wconf 90' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_563' title='bbox 1136 715 1243 730; x_wconf 82' lang='eng' dir='ltr'>decentralized</span> <span class='ocrx_word' id='word_1_564' title='bbox 1248 714 1319 732; x_wconf 80' lang='eng' dir='ltr'>network,</span> <span class='ocrx_word' id='word_1_565' title='bbox 1324 714 1380 729; x_wconf 81' lang='eng' dir='ltr'>insread</span> <span class='ocrx_word' id='word_1_566' title='bbox 1385 713 1432 728; x_wconf 77' lang='eng' dir='ltr'>ofone</span> <span class='ocrx_word' id='word_1_567' title='bbox 1436 713 1467 728; x_wconf 85' lang='eng' dir='ltr'>hub</span> <span class='ocrx_word' id='word_1_568' title='bbox 1472 713 1512 728; x_wconf 89' lang='eng' dir='ltr'>there</span> <span class='ocrx_word' id='word_1_569' title='bbox 1516 718 1539 727; x_wconf 91' lang='eng' dir='ltr'>are</span> <span class='ocrx_word' id='word_1_570' title='bbox 1544 717 1588 744; x_wconf 80' lang='eng' dir='ltr'>many</span> <span class='ocrx_word' id='word_1_571' title='bbox 1593 712 1636 729; x_wconf 86' lang='eng' dir='ltr'>hubs,</span>
</span>
<span class='ocr_line' id='line_1_62' title="bbox 1009 741 1635 763; baseline -0.008 -3; x_size 18.8125; x_descenders 4.8125005; x_ascenders 4.8125"><span class='ocrx_word' id='word_1_572' title='bbox 1009 746 1044 760; x_wconf 82' lang='eng' dir='ltr'>each</span> <span class='ocrx_word' id='word_1_573' title='bbox 1052 745 1089 760; x_wconf 89' lang='eng' dir='ltr'>with</span> <span class='ocrx_word' id='word_1_574' title='bbox 1098 745 1116 759; x_wconf 87' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_575' title='bbox 1123 750 1157 759; x_wconf 88' lang='eng' dir='ltr'>own</span> <span class='ocrx_word' id='word_1_576' title='bbox 1165 750 1204 763; x_wconf 81' lang='eng' dir='ltr'>array</span> <span class='ocrx_word' id='word_1_577' title='bbox 1211 743 1229 759; x_wconf 62' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_578' title='bbox 1233 743 1318 763; x_wconf 81' lang='eng' dir='ltr'>dependent</span> <span class='ocrx_word' id='word_1_579' title='bbox 1327 743 1376 758; x_wconf 79' lang='eng' dir='ltr'>nodes.</span> <span class='ocrx_word' id='word_1_580' title='bbox 1384 742 1436 757; x_wconf 76' lang='eng' dir='ltr'>While</span> <span class='ocrx_word' id='word_1_581' title='bbox 1444 742 1497 757; x_wconf 75' lang='eng' dir='ltr'>several</span> <span class='ocrx_word' id='word_1_582' title='bbox 1505 741 1543 756; x_wconf 86' lang='eng' dir='ltr'>hubs</span> <span class='ocrx_word' id='word_1_583' title='bbox 1550 746 1593 758; x_wconf 74' lang='eng' dir='ltr'>exist.</span> <span class='ocrx_word' id='word_1_584' title='bbox 1600 741 1635 756; x_wconf 75' lang='eng' dir='ltr'>each</span>
</span>
<span class='ocr_line' id='line_1_63' title="bbox 1010 770 1635 802; baseline -0.008 -13; x_size 18.8125; x_descenders 4.8125005; x_ascenders 4.8125"><span class='ocrx_word' id='word_1_585' title='bbox 1010 775 1048 789; x_wconf 90' lang='eng' dir='ltr'>with</span> <span class='ocrx_word' id='word_1_586' title='bbox 1054 775 1073 789; x_wconf 88' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_587' title='bbox 1078 779 1112 789; x_wconf 86' lang='eng' dir='ltr'>own</span> <span class='ocrx_word' id='word_1_588' title='bbox 1117 774 1185 791; x_wconf 86' lang='eng' dir='ltr'>domain,</span> <span class='ocrx_word' id='word_1_589' title='bbox 1191 779 1210 788; x_wconf 91' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_590' title='bbox 1215 773 1264 792; x_wconf 76' lang='eng' dir='ltr'>single</span> <span class='ocrx_word' id='word_1_591' title='bbox 1270 773 1321 787; x_wconf 86' lang='eng' dir='ltr'>zenith</span> <span class='ocrx_word' id='word_1_592' title='bbox 1326 773 1370 792; x_wconf 82' lang='eng' dir='ltr'>point</span> <span class='ocrx_word' id='word_1_593' title='bbox 1375 772 1446 787; x_wconf 82' lang='eng' dir='ltr'>exercises</span> <span class='ocrx_word' id='word_1_594' title='bbox 1452 771 1510 786; x_wconf 82' lang='eng' dir='ltr'>control</span> <span class='ocrx_word' id='word_1_595' title='bbox 1515 776 1550 802; x_wconf 73' lang='eng' dir='ltr'>over</span> <span class='ocrx_word' id='word_1_596' title='bbox 1555 771 1574 785; x_wconf 92' lang='eng' dir='ltr'>all</span> <span class='ocrx_word' id='word_1_597' title='bbox 1580 770 1635 785; x_wconf 56' lang='eng' dir='ltr'>others.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_18' title="bbox 1010 799 1635 849">
<span class='ocr_line' id='line_1_64' title="bbox 1035 799 1635 822; baseline -0.007 -4; x_size 21.5; x_descenders 5.5; x_ascenders 5.5"><span class='ocrx_word' id='word_1_598' title='bbox 1035 804 1083 818; x_wconf 91' lang='eng' dir='ltr'>There</span> <span class='ocrx_word' id='word_1_599' title='bbox 1089 809 1113 818; x_wconf 88' lang='eng' dir='ltr'>are</span> <span class='ocrx_word' id='word_1_600' title='bbox 1120 808 1163 822; x_wconf 86' lang='eng' dir='ltr'>many</span> <span class='ocrx_word' id='word_1_601' title='bbox 1170 802 1279 817; x_wconf 78' lang='eng' dir='ltr'>decentralized</span> <span class='ocrx_word' id='word_1_602' title='bbox 1287 801 1362 817; x_wconf 85' lang='eng' dir='ltr'>networks</span> <span class='ocrx_word' id='word_1_603' title='bbox 1368 802 1384 816; x_wconf 94' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_604' title='bbox 1390 801 1416 816; x_wconf 88' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_605' title='bbox 1422 800 1470 815; x_wconf 81' lang='eng' dir='ltr'>world</span> <span class='ocrx_word' id='word_1_606' title='bbox 1477 800 1563 819; x_wconf 82' lang='eng' dir='ltr'>today—in</span> <span class='ocrx_word' id='word_1_607' title='bbox 1569 799 1604 817; x_wconf 77' lang='eng' dir='ltr'>fact,</span> <span class='ocrx_word' id='word_1_608' title='bbox 1610 799 1635 814; x_wconf 90' lang='eng' dir='ltr'>de-</span>
</span>
<span class='ocr_line' id='line_1_65' title="bbox 1010 829 1542 849; baseline -0.008 -2; x_size 21.5; x_descenders 5.5; x_ascenders 5.5"><span class='ocrx_word' id='word_1_609' title='bbox 1010 832 1100 847; x_wconf 88' lang='eng' dir='ltr'>centralized</span> <span class='ocrx_word' id='word_1_610' title='bbox 1107 831 1182 847; x_wconf 85' lang='eng' dir='ltr'>networks</span> <span class='ocrx_word' id='word_1_611' title='bbox 1187 837 1211 846; x_wconf 66' lang='eng' dir='ltr'>are</span> <span class='ocrx_word' id='word_1_612' title='bbox 1216 831 1238 846; x_wconf 63' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_613' title='bbox 1243 835 1275 846; x_wconf 63' lang='eng' dir='ltr'>Matt</span> <span class='ocrx_word' id='word_1_614' title='bbox 1280 836 1337 845; x_wconf 69' lang='eng' dir='ltr'>i&#39;nrmmm</span> <span class='ocrx_word' id='word_1_615' title='bbox 1342 830 1407 849; x_wconf 67' lang='eng' dir='ltr'>diagram</span> <span class='ocrx_word' id='word_1_616' title='bbox 1412 829 1453 849; x_wconf 71' lang='eng' dir='ltr'>n/the</span> <span class='ocrx_word' id='word_1_617' title='bbox 1458 829 1510 844; x_wconf 64' lang='eng' dir='ltr'>mm</span> <span class='ocrx_word' id='word_1_618' title='bbox 1516 834 1542 844; x_wconf 74' lang='eng' dir='ltr'>em.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_19' title="bbox 1010 857 1639 908">
<span class='ocr_line' id='line_1_66' title="bbox 1035 857 1636 880; baseline -0.007 -4; x_size 19; x_descenders 4; x_ascenders 5"><span class='ocrx_word' id='word_1_619' title='bbox 1035 862 1070 876; x_wconf 90' lang='eng' dir='ltr'>One</span> <span class='ocrx_word' id='word_1_620' title='bbox 1076 861 1145 880; x_wconf 82' lang='eng' dir='ltr'>example</span> <span class='ocrx_word' id='word_1_621' title='bbox 1151 862 1163 876; x_wconf 81' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_622' title='bbox 1169 861 1195 875; x_wconf 90' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_623' title='bbox 1200 861 1253 875; x_wconf 87' lang='eng' dir='ltr'>airline</span> <span class='ocrx_word' id='word_1_624' title='bbox 1259 864 1320 879; x_wconf 85' lang='eng' dir='ltr'>system.</span> <span class='ocrx_word' id='word_1_625' title='bbox 1327 860 1344 874; x_wconf 91' lang='eng' dir='ltr'>In</span> <span class='ocrx_word' id='word_1_626' title='bbox 1351 860 1368 877; x_wconf 86' lang='eng' dir='ltr'>it,</span> <span class='ocrx_word' id='word_1_627' title='bbox 1374 864 1403 874; x_wconf 85' lang='eng' dir='ltr'>one</span> <span class='ocrx_word' id='word_1_628' title='bbox 1409 863 1450 874; x_wconf 88' lang='eng' dir='ltr'>must</span> <span class='ocrx_word' id='word_1_629' title='bbox 1456 859 1510 877; x_wconf 83' lang='eng' dir='ltr'>always</span> <span class='ocrx_word' id='word_1_630' title='bbox 1517 858 1562 873; x_wconf 83' lang='eng' dir='ltr'>travel</span> <span class='ocrx_word' id='word_1_631' title='bbox 1569 857 1636 876; x_wconf 76' lang='eng' dir='ltr'>through</span>
</span>
<span class='ocr_line' id='line_1_67' title="bbox 1010 886 1639 908; baseline -0.008 -2; x_size 18.8125; x_descenders 4.8125005; x_ascenders 4.8125"><span class='ocrx_word' id='word_1_632' title='bbox 1010 891 1067 906; x_wconf 78' lang='eng' dir='ltr'>Certain</span> <span class='ocrx_word' id='word_1_633' title='bbox 1073 890 1163 905; x_wconf 88' lang='eng' dir='ltr'>centralized</span> <span class='ocrx_word' id='word_1_634' title='bbox 1170 889 1202 905; x_wconf 86' lang='eng' dir='ltr'>hub</span> <span class='ocrx_word' id='word_1_635' title='bbox 1208 889 1351 908; x_wconf 38' lang='eng' dir='ltr'>citiesigenemlly</span> <span class='ocrx_word' id='word_1_636' title='bbox 1358 889 1374 903; x_wconf 88' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_637' title='bbox 1381 889 1406 903; x_wconf 89' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_638' title='bbox 1413 888 1485 903; x_wconf 90' lang='eng' dir='ltr'>Midwest</span> <span class='ocrx_word' id='word_1_639' title='bbox 1491 893 1508 902; x_wconf 91' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_640' title='bbox 1513 887 1569 902; x_wconf 75' lang='eng' dir='ltr'>central</span> <span class='ocrx_word' id='word_1_641' title='bbox 1576 892 1615 901; x_wconf 87' lang='eng' dir='ltr'>areas</span> <span class='ocrx_word' id='word_1_642' title='bbox 1622 886 1639 901; x_wconf 76' lang='eng' dir='ltr'>of</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_13' title="bbox 1011 916 1637 937">
<p class='ocr_par' dir='ltr' id='par_1_20' title="bbox 1011 916 1637 937">
<span class='ocr_line' id='line_1_68' title="bbox 1011 916 1637 937; baseline -0.008 -2; x_size 27.25; x_descenders 5.5; x_ascenders 7.25"><span class='ocrx_word' id='word_1_643' title='bbox 1011 921 1037 935; x_wconf 82' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_644' title='bbox 1043 920 1102 935; x_wconf 81' lang='eng' dir='ltr'>United</span> <span class='ocrx_word' id='word_1_645' title='bbox 1108 920 1160 934; x_wconf 54' lang='eng' dir='ltr'>states.</span> <span class='ocrx_word' id='word_1_646' title='bbox 1168 920 1220 934; x_wconf 82' lang='eng' dir='ltr'>Direct</span> <span class='ocrx_word' id='word_1_647' title='bbox 1227 923 1293 937; x_wconf 81' lang='eng' dir='ltr'>nonstop</span> <span class='ocrx_word' id='word_1_648' title='bbox 1299 919 1354 933; x_wconf 77' lang='eng' dir='ltr'>service</span> <span class='ocrx_word' id='word_1_649' title='bbox 1361 918 1373 932; x_wconf 91' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_650' title='bbox 1380 918 1415 936; x_wconf 85' lang='eng' dir='ltr'>only</span> <span class='ocrx_word' id='word_1_651' title='bbox 1422 917 1488 936; x_wconf 81' lang='eng' dir='ltr'>possible</span> <span class='ocrx_word' id='word_1_652' title='bbox 1495 916 1540 931; x_wconf 76' lang='eng' dir='ltr'>ifone</span> <span class='ocrx_word' id='word_1_653' title='bbox 1547 916 1614 935; x_wconf 83' lang='eng' dir='ltr'>happens</span> <span class='ocrx_word' id='word_1_654' title='bbox 1621 920 1637 930; x_wconf 90' lang='eng' dir='ltr'>to</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_14' title="bbox 1013 1031 1638 1049">
<p class='ocr_par' dir='ltr' id='par_1_21' title="bbox 1013 1031 1638 1049">
<span class='ocr_line' id='line_1_69' title="bbox 1013 1031 1638 1049; baseline -0.008 -2; x_size 20; x_descenders 5; x_ascenders 5"><span class='ocrx_word' id='word_1_655' title='bbox 1013 1036 1019 1047; x_wconf 62' lang='eng'>7»</span> <span class='ocrx_word' id='word_1_656' title='bbox 1030 1035 1076 1047; x_wconf 70' lang='eng' dir='ltr'>Michel</span> <span class='ocrx_word' id='word_1_657' title='bbox 1083 1034 1145 1048; x_wconf 72' lang='eng' dir='ltr'>FoliLiult,</span> <span class='ocrx_word' id='word_1_658' title='bbox 1151 1034 1213 1049; x_wconf 68' lang='eng' dir='ltr'>Drrrrplmt</span> <span class='ocrx_word' id='word_1_659' title='bbox 1218 1033 1243 1045; x_wconf 64' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_660' title='bbox 1247 1033 1293 1047; x_wconf 63' lang='eng' dir='ltr'>Pariah,</span> <span class='ocrx_word' id='word_1_661' title='bbox 1300 1037 1336 1045; x_wconf 76' lang='eng' dir='ltr'>trans.</span> <span class='ocrx_word' id='word_1_662' title='bbox 1344 1033 1375 1044; x_wconf 79' lang='eng' dir='ltr'>Alan</span> <span class='ocrx_word' id='word_1_663' title='bbox 1381 1032 1439 1044; x_wconf 74' lang='eng' dir='ltr'>Sheridan</span> <span class='ocrx_word' id='word_1_664' title='bbox 1445 1032 1482 1045; x_wconf 80' lang='eng' dir='ltr'>(New</span> <span class='ocrx_word' id='word_1_665' title='bbox 1488 1031 1524 1043; x_wconf 79' lang='eng' dir='ltr'>York.</span> <span class='ocrx_word' id='word_1_666' title='bbox 1531 1032 1587 1046; x_wconf 71' lang='eng' dir='ltr'>Vintage,</span> <span class='ocrx_word' id='word_1_667' title='bbox 1595 1031 1638 1045; x_wconf 64' lang='eng'>1997),</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_15' title="bbox 1011 1063 1058 1078">
<p class='ocr_par' dir='ltr' id='par_1_22' title="bbox 1011 1063 1058 1078">
<span class='ocr_line' id='line_1_70' title="bbox 1011 1063 1058 1078; baseline 0 -4; x_size 22.75; x_descenders 5.5; x_ascenders 5.75"><span class='ocrx_word' id='word_1_668' title='bbox 1011 1066 1023 1078; x_wconf 92' lang='eng' dir='ltr'>p.</span> <span class='ocrx_word' id='word_1_669' title='bbox 1031 1063 1058 1075; x_wconf 75' lang='eng'>197.</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_16' title="bbox 1280 1158 1371 1171">
<p class='ocr_par' dir='ltr' id='par_1_23' title="bbox 1280 1158 1371 1171">
<span class='ocr_line' id='line_1_71' title="bbox 1280 1158 1371 1171; baseline -0.011 -2; x_size 20; x_descenders 5; x_ascenders 5"><span class='ocrx_word' id='word_1_670' title='bbox 1280 1158 1328 1171; x_wconf 81' lang='eng' dir='ltr'>Physical</span> <span class='ocrx_word' id='word_1_671' title='bbox 1335 1158 1371 1168; x_wconf 72' lang='eng' dir='ltr'>Media</span>
</span>
</p>
</div>
</div>
<script type="text/javascript">
$( function() {
$( ".draggable" ).draggable();
} );
//store all class 'ocr_line' in 'lines'
var lines = document.querySelectorAll(".ocr_line");
//loop through each element in 'lines'
for (var i = 0; i < lines.length; i++){
var line = lines[i];
var words = line.querySelectorAll(".ocrx_word");
for (var e = 0; e < words.length; e++){
var span = words[e];
span.classList.add("draggable");
}
}
</script>
</body>
</html>

BIN
hypervirus/hypervirus-01.tif
View File

Binary file not shown.

BIN
hypervirus/hypervirus-02.tif
View File

Binary file not shown.

BIN
hypervirus/hypervirus-03.tif
View File

Binary file not shown.

BIN
hypervirus/hypervirus-04.tif
View File

Binary file not shown.

BIN
hypervirus/hypervirus-05.tif
View File

Binary file not shown.

BIN
hypervirus/hypervirus-06.tif
View File

Binary file not shown.

BIN
hypervirus/hypervirus-07.tif
View File

Binary file not shown.

BIN
hypervirus/hypervirus-08.tif
View File

Binary file not shown.

BIN
hypervirus/hypervirus2-01.tif
View File

Binary file not shown.

609
hypervirus/index.html
Unescape Escape View File

@ -0,0 +1,609 @@
<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
<head>
<title></title>
<meta http-equiv="Content-Type" content="text/html;charset=utf-8" />
<meta name='ocr-system' content='tesseract 3.04.01' />
<meta name='ocr-capabilities' content='ocr_page ocr_carea ocr_par ocr_line ocrx_word'/>
<link rel="stylesheet" href="//code.jquery.com/ui/1.12.1/themes/base/jquery-ui.css">
<link rel="stylesheet" href="/resources/demos/style.css">
<script src="https://code.jquery.com/jquery-1.12.4.js"></script>
<script src="https://code.jquery.com/ui/1.12.1/jquery-ui.js"></script>
<style type="text/css">
body { background-color: black;
color: lime;}
.ocrx_word{position: absolute;}
</style>
</head>
<body>
<div class='ocr_page' id='page_1' title='image "hypervirus2-01.tif"; bbox 0 0 1749 12409; ppageno 0'>
<div class='ocr_carea' id='block_1_1' title="bbox 78 91 352 146">
<p class='ocr_par' dir='ltr' id='par_1_1' title="bbox 78 91 352 146">
<span class='ocr_line' id='line_1_1' title="bbox 78 91 352 146; baseline 0 -12; x_size 55; x_descenders 12; x_ascenders 13"><span class='ocrx_word' id='word_1_1' title='bbox 78 91 352 146; x_wconf 84' lang='eng' dir='ltr' style="font-size: 30px;"><b>Hypervirus</b></span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_2' title="bbox 348 247 1379 9101">
<p class='ocr_par' dir='ltr' id='par_1_2' title="bbox 349 247 1358 465">
<span class='ocr_line' id='line_1_2' title="bbox 350 247 1358 288; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_2' title='bbox 350 247 529 277; x_wconf 84' lang='eng' dir='ltr'>Whatever</span> <span class='ocrx_word' id='word_1_3' title='bbox 547 247 832 288; x_wconf 97' lang='eng' dir='ltr'>ultramodernity</span> <span class='ocrx_word' id='word_1_4' title='bbox 850 247 963 287; x_wconf 85' lang='eng' dir='ltr'>places</span> <span class='ocrx_word' id='word_1_5' title='bbox 983 247 1090 277; x_wconf 98' lang='eng' dir='ltr'>under</span> <span class='ocrx_word' id='word_1_6' title='bbox 1108 247 1163 277; x_wconf 85' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_7' title='bbox 1182 247 1358 277; x_wconf 87' lang='eng' dir='ltr'>dominion</span>
</span>
<span class='ocr_line' id='line_1_3' title="bbox 350 306 1358 347; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_8' title='bbox 350 306 389 336; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_9' title='bbox 401 306 494 347; x_wconf 85' lang='eng' dir='ltr'>signs</span> <span class='ocrx_word' id='word_1_10' title='bbox 509 306 782 347; x_wconf 97' lang='eng' dir='ltr'>postmodernity</span> <span class='ocrx_word' id='word_1_11' title='bbox 799 306 949 336; x_wconf 85' lang='eng' dir='ltr'>subverts</span> <span class='ocrx_word' id='word_1_12' title='bbox 966 306 1042 336; x_wconf 92' lang='eng' dir='ltr'>with</span> <span class='ocrx_word' id='word_1_13' title='bbox 1059 306 1156 336; x_wconf 89' lang='eng' dir='ltr'>virus.</span> <span class='ocrx_word' id='word_1_14' title='bbox 1171 307 1218 336; x_wconf 93' lang='eng' dir='ltr'>As</span> <span class='ocrx_word' id='word_1_15' title='bbox 1234 306 1358 336; x_wconf 90' lang='eng' dir='ltr'>culture</span>
</span>
<span class='ocr_line' id='line_1_4' title="bbox 350 363 1358 407; baseline 0 -13; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_16' title='bbox 350 364 504 405; x_wconf 84' lang='eng' dir='ltr'>migrates</span> <span class='ocrx_word' id='word_1_17' title='bbox 518 364 590 394; x_wconf 98' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_18' title='bbox 603 364 908 404; x_wconf 88' lang='eng' dir='ltr'>partial-machines</span> <span class='ocrx_word' id='word_1_19' title='bbox 923 363 1068 407; x_wconf 93' lang='eng' dir='ltr'>(lacking</span> <span class='ocrx_word' id='word_1_20' title='bbox 1082 374 1121 394; x_wconf 95' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_21' title='bbox 1136 370 1358 394; x_wconf 88' lang='eng' dir='ltr'>autonomous</span>
</span>
<span class='ocr_line' id='line_1_5' title="bbox 349 421 1357 465; baseline 0 -12; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_22' title='bbox 349 423 575 463; x_wconf 91' lang='eng' dir='ltr'>reproductive</span> <span class='ocrx_word' id='word_1_23' title='bbox 586 421 719 465; x_wconf 89' lang='eng' dir='ltr'>system)</span> <span class='ocrx_word' id='word_1_24' title='bbox 731 423 897 453; x_wconf 90' lang='eng' dir='ltr'>semiotics</span> <span class='ocrx_word' id='word_1_25' title='bbox 905 423 1052 453; x_wconf 94' lang='eng' dir='ltr'>subsides</span> <span class='ocrx_word' id='word_1_26' title='bbox 1060 423 1129 453; x_wconf 98' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_27' title='bbox 1139 423 1357 453; x_wconf 93' lang='eng' dir='ltr'>virotechnics.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_3' title="bbox 348 489 1358 813">
<span class='ocr_line' id='line_1_6' title="bbox 414 489 1356 511; baseline 0.001 -1; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_28' title='bbox 414 489 1356 511; x_wconf 96' lang='eng'>0010101011011100101101010101001100100010001010</span>
</span>
<span class='ocr_line' id='line_1_7' title="bbox 350 547 1357 569; baseline 0.001 -1; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_29' title='bbox 350 547 1357 569; x_wconf 96' lang='eng'>1011101000010101100101001010001100100111001000100</span>
</span>
<span class='ocr_line' id='line_1_8' title="bbox 350 606 1355 628; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_30' title='bbox 350 606 1355 628; x_wconf 94' lang='eng'>000000010011111100010010010101010100001000010101</span>
</span>
<span class='ocr_line' id='line_1_9' title="bbox 350 665 1354 687; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_31' title='bbox 350 665 1354 687; x_wconf 96' lang='eng'>00111111001001000100011010010001010010101111000101</span>
</span>
<span class='ocr_line' id='line_1_10' title="bbox 350 715 1358 756; baseline 0 -11; x_size 40; x_descenders 11; x_ascenders 9"><span class='ocrx_word' id='word_1_32' title='bbox 350 723 735 745; x_wconf 96' lang='eng'>001000010001110100</span> <span class='ocrx_word' id='word_1_33' title='bbox 748 716 807 745; x_wconf 94' lang='eng' dir='ltr'>Yes</span> <span class='ocrx_word' id='word_1_34' title='bbox 822 716 878 745; x_wconf 95' lang='eng' dir='ltr'>No</span> <span class='ocrx_word' id='word_1_35' title='bbox 891 716 950 745; x_wconf 94' lang='eng' dir='ltr'>Yes</span> <span class='ocrx_word' id='word_1_36' title='bbox 965 716 1018 745; x_wconf 96' lang='eng' dir='ltr'>No</span> <span class='ocrx_word' id='word_1_37' title='bbox 1031 716 1090 745; x_wconf 94' lang='eng' dir='ltr'>Yes</span> <span class='ocrx_word' id='word_1_38' title='bbox 1103 716 1162 745; x_wconf 98' lang='eng' dir='ltr'>Yes</span> <span class='ocrx_word' id='word_1_39' title='bbox 1175 716 1230 745; x_wconf 95' lang='eng' dir='ltr'>No</span> <span class='ocrx_word' id='word_1_40' title='bbox 1244 715 1358 756; x_wconf 85' lang='eng' dir='ltr'>longer</span>
</span>
<span class='ocr_line' id='line_1_11' title="bbox 348 773 1145 813; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_41' title='bbox 348 773 437 803; x_wconf 93' lang='eng' dir='ltr'>what</span> <span class='ocrx_word' id='word_1_42' title='bbox 451 773 531 803; x_wconf 98' lang='eng' dir='ltr'>does</span> <span class='ocrx_word' id='word_1_43' title='bbox 545 773 569 803; x_wconf 98' lang='eng' dir='ltr'>it</span> <span class='ocrx_word' id='word_1_44' title='bbox 582 773 700 803; x_wconf 82' lang='eng' dir='ltr'>mean?</span> <span class='ocrx_word' id='word_1_45' title='bbox 714 773 776 803; x_wconf 98' lang='eng' dir='ltr'>but</span> <span class='ocrx_word' id='word_1_46' title='bbox 789 773 866 803; x_wconf 96' lang='eng' dir='ltr'>how</span> <span class='ocrx_word' id='word_1_47' title='bbox 878 773 959 803; x_wconf 98' lang='eng' dir='ltr'>does</span> <span class='ocrx_word' id='word_1_48' title='bbox 973 773 997 803; x_wconf 98' lang='eng' dir='ltr'>it</span> <span class='ocrx_word' id='word_1_49' title='bbox 1010 773 1145 813; x_wconf 80' lang='eng' dir='ltr'>spread?</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_4' title="bbox 349 832 1356 978">
<span class='ocr_line' id='line_1_12' title="bbox 413 832 1356 873; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_50' title='bbox 413 832 548 873; x_wconf 84' lang='eng' dir='ltr'>Having</span> <span class='ocrx_word' id='word_1_51' title='bbox 557 842 603 862; x_wconf 98' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_52' title='bbox 612 842 738 872; x_wconf 97' lang='eng' dir='ltr'>proper</span> <span class='ocrx_word' id='word_1_53' title='bbox 747 832 935 868; x_wconf 79' lang='eng' dir='ltr'>substance,</span> <span class='ocrx_word' id='word_1_54' title='bbox 944 842 983 862; x_wconf 97' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_55' title='bbox 992 842 1082 862; x_wconf 98' lang='eng' dir='ltr'>sense</span> <span class='ocrx_word' id='word_1_56' title='bbox 1092 832 1225 873; x_wconf 88' lang='eng' dir='ltr'>beyond</span> <span class='ocrx_word' id='word_1_57' title='bbox 1234 832 1273 862; x_wconf 98' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_58' title='bbox 1279 842 1314 862; x_wconf 97' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_59' title='bbox 1322 842 1356 862; x_wconf 98' lang='eng' dir='ltr'>re</span>
</span>
<span class='ocr_line' id='line_1_13' title="bbox 349 890 1355 931; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_60' title='bbox 349 900 382 920; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_61' title='bbox 393 890 598 930; x_wconf 79' lang='eng' dir='ltr'>replication,</span> <span class='ocrx_word' id='word_1_62' title='bbox 608 900 665 931; x_wconf 89' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_63' title='bbox 676 900 723 920; x_wconf 98' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_64' title='bbox 734 900 779 920; x_wconf 98' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_65' title='bbox 790 900 891 931; x_wconf 98' lang='eng' dir='ltr'>usage</span> <span class='ocrx_word' id='word_1_66' title='bbox 902 890 941 920; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_67' title='bbox 945 890 1033 920; x_wconf 96' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_68' title='bbox 1043 890 1068 920; x_wconf 98' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_69' title='bbox 1076 900 1154 920; x_wconf 98' lang='eng' dir='ltr'>ever</span> <span class='ocrx_word' id='word_1_70' title='bbox 1162 890 1355 930; x_wconf 92' lang='eng' dir='ltr'>metaphori-</span>
</span>
<span class='ocr_line' id='line_1_14' title="bbox 350 946 1065 978; baseline 0 0; x_size 42.988487; x_descenders 10.988487; x_ascenders 12"><span class='ocrx_word' id='word_1_71' title='bbox 350 948 408 978; x_wconf 91' lang='eng' dir='ltr'>cal.</span> <span class='ocrx_word' id='word_1_72' title='bbox 423 949 490 978; x_wconf 92' lang='eng' dir='ltr'>The</span> <span class='ocrx_word' id='word_1_73' title='bbox 502 948 596 978; x_wconf 97' lang='eng' dir='ltr'>word</span> <span class='ocrx_word' id='word_1_74' title='bbox 610 946 719 978; x_wconf 73' lang='eng' dir='ltr'>‘virus’</span> <span class='ocrx_word' id='word_1_75' title='bbox 734 948 761 978; x_wconf 99' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_76' title='bbox 774 958 866 978; x_wconf 97' lang='eng' dir='ltr'>more</span> <span class='ocrx_word' id='word_1_77' title='bbox 879 958 912 978; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_78' title='bbox 925 958 957 978; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_79' title='bbox 969 948 1065 978; x_wconf 89' lang='eng' dir='ltr'>virus.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_5' title="bbox 348 1006 1355 1281">
<span class='ocr_line' id='line_1_15' title="bbox 414 1006 1355 1036; baseline 0 0; x_size 40.988487; x_descenders 10.988487; x_ascenders 10"><span class='ocrx_word' id='word_1_80' title='bbox 414 1006 631 1036; x_wconf 92' lang='eng' dir='ltr'>Postmodern</span> <span class='ocrx_word' id='word_1_81' title='bbox 641 1006 769 1036; x_wconf 99' lang='eng' dir='ltr'>culture</span> <span class='ocrx_word' id='word_1_82' title='bbox 778 1016 813 1036; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_83' title='bbox 820 1016 855 1036; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_84' title='bbox 864 1006 1074 1036; x_wconf 89' lang='eng' dir='ltr'>chatters-out</span> <span class='ocrx_word' id='word_1_85' title='bbox 1082 1006 1168 1036; x_wconf 89' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_86' title='bbox 1177 1006 1262 1036; x_wconf 94' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_87' title='bbox 1269 1006 1355 1036; x_wconf 94' lang='eng' dir='ltr'>virus</span>
</span>
<span class='ocr_line' id='line_1_16' title="bbox 348 1064 1353 1094; baseline 0 0; x_size 42.087334; x_descenders 12.087336; x_ascenders 8"><span class='ocrx_word' id='word_1_88' title='bbox 348 1064 437 1094; x_wconf 91' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_89' title='bbox 453 1064 543 1094; x_wconf 91' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_90' title='bbox 560 1064 650 1094; x_wconf 92' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_91' title='bbox 668 1064 758 1094; x_wconf 92' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_92' title='bbox 776 1064 866 1094; x_wconf 92' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_93' title='bbox 883 1064 971 1094; x_wconf 92' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_94' title='bbox 987 1064 1075 1094; x_wconf 92' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_95' title='bbox 1092 1072 1353 1094; x_wconf 92' lang='eng'>0110001001001</span>
</span>
<span class='ocr_line' id='line_1_17' title="bbox 349 1120 1354 1165; baseline 0 -13; x_size 44.087334; x_descenders 12.087336; x_ascenders 10"><span class='ocrx_word' id='word_1_96' title='bbox 349 1130 985 1153; x_wconf 97' lang='eng'>011010010010110010010010010010</span> <span class='ocrx_word' id='word_1_97' title='bbox 1005 1120 1113 1152; x_wconf 87' lang='eng' dir='ltr'>‘virus’</span> <span class='ocrx_word' id='word_1_98' title='bbox 1134 1121 1354 1165; x_wconf 88' lang='eng' dir='ltr'>(viroductile,</span>
</span>
<span class='ocr_line' id='line_1_18' title="bbox 348 1180 1355 1221; baseline 0 -11; x_size 36; x_descenders 6; x_ascenders 10"><span class='ocrx_word' id='word_1_99' title='bbox 348 1180 526 1221; x_wconf 97' lang='eng' dir='ltr'>virogenic,</span> <span class='ocrx_word' id='word_1_100' title='bbox 544 1180 900 1220; x_wconf 98' lang='eng' dir='ltr'>immunosuppressor</span> <span class='ocrx_word' id='word_1_101' title='bbox 913 1180 983 1210; x_wconf 98' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_102' title='bbox 998 1180 1062 1210; x_wconf 98' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_103' title='bbox 1079 1190 1125 1216; x_wconf 99' lang='eng' dir='ltr'>or,</span> <span class='ocrx_word' id='word_1_104' title='bbox 1143 1186 1248 1216; x_wconf 92' lang='eng' dir='ltr'>meta-,</span> <span class='ocrx_word' id='word_1_105' title='bbox 1264 1190 1300 1210; x_wconf 91' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_106' title='bbox 1316 1190 1355 1210; x_wconf 97' lang='eng' dir='ltr'>or</span>
</span>
<span class='ocr_line' id='line_1_19' title="bbox 349 1237 725 1281; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_107' title='bbox 349 1239 417 1269; x_wconf 98' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_108' title='bbox 429 1249 467 1269; x_wconf 98' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_109' title='bbox 479 1237 611 1281; x_wconf 89' lang='eng' dir='ltr'>hyper-)</span> <span class='ocrx_word' id='word_1_110' title='bbox 625 1239 725 1269; x_wconf 92' lang='eng' dir='ltr'>virus.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_6' title="bbox 353 1304 1364 1403">
<span class='ocr_line' id='line_1_20' title="bbox 353 1304 1364 1345; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 9"><span class='ocrx_word' id='word_1_111' title='bbox 353 1313 943 1334; x_wconf 89' lang='eng'>10110010010011101100001001001.</span> <span class='ocrx_word' id='word_1_112' title='bbox 955 1304 1146 1345; x_wconf 93' lang='eng' dir='ltr'>hypervirus</span> <span class='ocrx_word' id='word_1_113' title='bbox 1156 1310 1224 1334; x_wconf 94' lang='eng' dir='ltr'>eats</span> <span class='ocrx_word' id='word_1_114' title='bbox 1236 1304 1287 1334; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_115' title='bbox 1298 1304 1364 1334; x_wconf 92' lang='eng' dir='ltr'>end</span>
</span>
<span class='ocr_line' id='line_1_21' title="bbox 353 1362 524 1403; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_116' title='bbox 353 1362 391 1392; x_wconf 98' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_117' title='bbox 402 1362 524 1403; x_wconf 94' lang='eng' dir='ltr'>history</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_7' title="bbox 353 1429 1365 1857">
<span class='ocr_line' id='line_1_22' title="bbox 415 1429 1365 1450; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_118' title='bbox 415 1429 1365 1450; x_wconf 78' lang='eng'>00100100100010]1110100001001101010101010101000</span>
</span>
<span class='ocr_line' id='line_1_23' title="bbox 353 1487 1363 1508; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_119' title='bbox 353 1487 1363 1508; x_wconf 89' lang='eng'>10011010100100101001001010010110100100101111010001</span>
</span>
<span class='ocr_line' id='line_1_24' title="bbox 353 1545 1365 1566; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_120' title='bbox 353 1545 1365 1566; x_wconf 89' lang='eng'>0101010101010100101010010101101010010000001000101</span>
</span>
<span class='ocr_line' id='line_1_25' title="bbox 354 1603 1365 1624; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_121' title='bbox 354 1603 1365 1624; x_wconf 89' lang='eng'>1101010010010101001010010010101010010001001001001</span>
</span>
<span class='ocr_line' id='line_1_26' title="bbox 353 1661 1364 1682; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_122' title='bbox 353 1661 1364 1682; x_wconf 89' lang='eng'>00100100101001001010110101001001001010110101010101</span>
</span>
<span class='ocr_line' id='line_1_27' title="bbox 353 1719 1365 1740; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_123' title='bbox 353 1719 1365 1740; x_wconf 78' lang='eng'>0101111010000100]1010101010101000100110110101010100</span>
</span>
<span class='ocr_line' id='line_1_28' title="bbox 355 1776 1364 1798; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_124' title='bbox 355 1776 1364 1798; x_wconf 86' lang='eng'>11001000100010101011101000010101100101001010001100</span>
</span>
<span class='ocr_line' id='line_1_29' title="bbox 354 1836 1363 1857; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_125' title='bbox 354 1836 1363 1857; x_wconf 89' lang='eng'>1001110010001000000000000100111111100010010010101</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_8' title="bbox 354 1883 1365 2276">
<span class='ocr_line' id='line_1_30' title="bbox 416 1883 1365 1927; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 11"><span class='ocrx_word' id='word_1_126' title='bbox 416 1894 700 1915; x_wconf 90' lang='eng'>0101000010000</span> <span class='ocrx_word' id='word_1_127' title='bbox 723 1883 905 1927; x_wconf 87' lang='eng' dir='ltr'>K-(coding</span> <span class='ocrx_word' id='word_1_128' title='bbox 923 1885 976 1915; x_wconf 90' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_129' title='bbox 994 1883 1253 1927; x_wconf 93' lang='eng' dir='ltr'>cyber)p0sitive</span> <span class='ocrx_word' id='word_1_130' title='bbox 1272 1895 1365 1925; x_wconf 94' lang='eng' dir='ltr'>proc-</span>
</span>
<span class='ocr_line' id='line_1_31' title="bbox 354 1942 1365 1983; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_131' title='bbox 354 1952 438 1972; x_wconf 95' lang='eng' dir='ltr'>esses</span> <span class='ocrx_word' id='word_1_132' title='bbox 454 1942 700 1983; x_wconf 91' lang='eng' dir='ltr'>auto-intensify</span> <span class='ocrx_word' id='word_1_133' title='bbox 714 1942 759 1983; x_wconf 98' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_134' title='bbox 772 1942 959 1983; x_wconf 91' lang='eng' dir='ltr'>occurring.</span> <span class='ocrx_word' id='word_1_135' title='bbox 974 1943 1004 1972; x_wconf 93' lang='eng' dir='ltr'><strong>A</strong></span> <span class='ocrx_word' id='word_1_136' title='bbox 1017 1942 1157 1972; x_wconf 96' lang='eng' dir='ltr'>cultural</span> <span class='ocrx_word' id='word_1_137' title='bbox 1172 1942 1324 1982; x_wconf 89' lang='eng' dir='ltr'>example</span> <span class='ocrx_word' id='word_1_138' title='bbox 1339 1942 1365 1972; x_wconf 99' lang='eng' dir='ltr'>is</span>
</span>
<span class='ocr_line' id='line_1_32' title="bbox 355 2001 1365 2042; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_139' title='bbox 355 2001 451 2042; x_wconf 89' lang='eng' dir='ltr'>hype:</span> <span class='ocrx_word' id='word_1_140' title='bbox 464 2001 621 2042; x_wconf 91' lang='eng' dir='ltr'>products</span> <span class='ocrx_word' id='word_1_141' title='bbox 635 2001 704 2031; x_wconf 96' lang='eng' dir='ltr'>that</span> <span class='ocrx_word' id='word_1_142' title='bbox 714 2002 771 2031; x_wconf 89' lang='eng' dir='ltr'>AT</span> <span class='ocrx_word' id='word_1_143' title='bbox 780 2002 837 2031; x_wconf 89' lang='eng' dir='ltr'>AT</span> <span class='ocrx_word' id='word_1_144' title='bbox 849 2001 942 2031; x_wconf 95' lang='eng' dir='ltr'>trade</span> <span class='ocrx_word' id='word_1_145' title='bbox 953 2011 999 2031; x_wconf 98' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_146' title='bbox 1012 2001 1100 2031; x_wconf 92' lang='eng' dir='ltr'>what</span> <span class='ocrx_word' id='word_1_147' title='bbox 1112 2001 1188 2042; x_wconf 97' lang='eng' dir='ltr'>they</span> <span class='ocrx_word' id='word_1_148' title='bbox 1199 2001 1263 2031; x_wconf 98' lang='eng' dir='ltr'>will</span> <span class='ocrx_word' id='word_1_149' title='bbox 1277 2001 1319 2031; x_wconf 98' lang='eng' dir='ltr'>be</span> <span class='ocrx_word' id='word_1_150' title='bbox 1331 2001 1365 2031; x_wconf 98' lang='eng' dir='ltr'>in</span>
</span>
<span class='ocr_line' id='line_1_33' title="bbox 355 2059 1365 2096; baseline 0 -7; x_size 37; x_descenders 7; x_ascenders 10"><span class='ocrx_word' id='word_1_151' title='bbox 355 2059 408 2089; x_wconf 98' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_152' title='bbox 421 2059 538 2096; x_wconf 87' lang='eng' dir='ltr'>future,</span> <span class='ocrx_word' id='word_1_153' title='bbox 550 2059 600 2089; x_wconf 94' lang='eng' dir='ltr'>vir</span> <span class='ocrx_word' id='word_1_154' title='bbox 608 2059 729 2089; x_wconf 93' lang='eng' dir='ltr'>virtual</span> <span class='ocrx_word' id='word_1_155' title='bbox 741 2059 875 2089; x_wconf 90' lang='eng' dir='ltr'>fashion</span> <span class='ocrx_word' id='word_1_156' title='bbox 888 2069 933 2089; x_wconf 98' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_157' title='bbox 945 2059 1002 2096; x_wconf 84' lang='eng' dir='ltr'>off,</span> <span class='ocrx_word' id='word_1_158' title='bbox 1016 2059 1190 2089; x_wconf 92' lang='eng' dir='ltr'>imminent</span> <span class='ocrx_word' id='word_1_159' title='bbox 1204 2059 1365 2090; x_wconf 91' lang='eng' dir='ltr'>technical</span>
</span>
<span class='ocr_line' id='line_1_34' title="bbox 355 2117 1364 2158; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_160' title='bbox 355 2117 535 2154; x_wconf 89' lang='eng' dir='ltr'>standards,</span> <span class='ocrx_word' id='word_1_161' title='bbox 545 2117 776 2158; x_wconf 92' lang='eng' dir='ltr'>self-fulfilling</span> <span class='ocrx_word' id='word_1_162' title='bbox 784 2117 982 2157; x_wconf 94' lang='eng' dir='ltr'>prophecies</span> <span class='ocrx_word' id='word_1_163' title='bbox 993 2117 1060 2147; x_wconf 95' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_164' title='bbox 1069 2117 1136 2147; x_wconf 93' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_165' title='bbox 1145 2127 1183 2147; x_wconf 98' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_166' title='bbox 1192 2117 1257 2147; x_wconf 95' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_167' title='bbox 1268 2117 1364 2147; x_wconf 92' lang='eng' dir='ltr'>artifi-</span>
</span>
<span class='ocr_line' id='line_1_35' title="bbox 354 2176 1365 2217; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_168' title='bbox 354 2176 413 2207; x_wconf 91' lang='eng' dir='ltr'>cial</span> <span class='ocrx_word' id='word_1_169' title='bbox 422 2176 582 2206; x_wconf 88' lang='eng' dir='ltr'>destinies.</span> <span class='ocrx_word' id='word_1_170' title='bbox 592 2176 818 2217; x_wconf 93' lang='eng' dir='ltr'>Anticipating</span> <span class='ocrx_word' id='word_1_171' title='bbox 826 2186 844 2206; x_wconf 99' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_172' title='bbox 856 2176 949 2206; x_wconf 95' lang='eng' dir='ltr'>trend</span> <span class='ocrx_word' id='word_1_173' title='bbox 958 2176 1024 2206; x_wconf 95' lang='eng' dir='ltr'>end</span> <span class='ocrx_word' id='word_1_174' title='bbox 1034 2176 1099 2206; x_wconf 93' lang='eng' dir='ltr'>end</span> <span class='ocrx_word' id='word_1_175' title='bbox 1107 2176 1173 2206; x_wconf 95' lang='eng' dir='ltr'>end</span> <span class='ocrx_word' id='word_1_176' title='bbox 1179 2176 1270 2206; x_wconf 99' lang='eng' dir='ltr'>ACC</span> <span class='ocrx_word' id='word_1_177' title='bbox 1277 2176 1365 2206; x_wconf 99' lang='eng' dir='ltr'>ACC</span>
</span>
<span class='ocr_line' id='line_1_36' title="bbox 355 2232 1328 2276; baseline 0 -12; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_178' title='bbox 355 2234 544 2265; x_wconf 91' lang='eng' dir='ltr'>accelerates</span> <span class='ocrx_word' id='word_1_179' title='bbox 556 2234 579 2264; x_wconf 91' lang='eng' dir='ltr'>it</span> <span class='ocrx_word' id='word_1_180' title='bbox 595 2233 718 2276; x_wconf 85' lang='eng' dir='ltr'>(which</span> <span class='ocrx_word' id='word_1_181' title='bbox 732 2234 756 2264; x_wconf 98' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_182' title='bbox 770 2234 804 2264; x_wconf 98' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_183' title='bbox 818 2234 910 2264; x_wconf 82' lang='eng' dir='ltr'>itself</span> <span class='ocrx_word' id='word_1_184' title='bbox 918 2244 936 2264; x_wconf 99' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_185' title='bbox 951 2244 983 2264; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_186' title='bbox 997 2244 1030 2264; x_wconf 98' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_187' title='bbox 1044 2234 1204 2264; x_wconf 89' lang='eng' dir='ltr'>recursive</span> <span class='ocrx_word' id='word_1_188' title='bbox 1218 2232 1328 2276; x_wconf 91' lang='eng' dir='ltr'>trend)</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_9' title="bbox 355 2293 1367 2451">
<span class='ocr_line' id='line_1_37' title="bbox 416 2293 1365 2334; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_189' title='bbox 416 2293 554 2334; x_wconf 94' lang='eng' dir='ltr'>Hyping</span> <span class='ocrx_word' id='word_1_190' title='bbox 569 2293 731 2333; x_wconf 94' lang='eng' dir='ltr'>collapses</span> <span class='ocrx_word' id='word_1_191' title='bbox 751 2302 786 2323; x_wconf 87' lang='eng' dir='ltr'>SF</span> <span class='ocrx_word' id='word_1_192' title='bbox 808 2293 878 2323; x_wconf 98' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_193' title='bbox 898 2293 1010 2323; x_wconf 95' lang='eng' dir='ltr'>CATA</span> <span class='ocrx_word' id='word_1_194' title='bbox 1027 2293 1137 2323; x_wconf 95' lang='eng' dir='ltr'>CATA</span> <span class='ocrx_word' id='word_1_195' title='bbox 1154 2293 1305 2334; x_wconf 97' lang='eng' dir='ltr'>catalytic</span> <span class='ocrx_word' id='word_1_196' title='bbox 1324 2293 1365 2323; x_wconf 99' lang='eng' dir='ltr'>tic</span>
</span>
<span class='ocr_line' id='line_1_38' title="bbox 355 2351 1367 2392; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_197' title='bbox 355 2351 524 2392; x_wconf 84' lang='eng' dir='ltr'>efficiency,</span> <span class='ocrx_word' id='word_1_198' title='bbox 534 2351 713 2392; x_wconf 93' lang='eng' dir='ltr'>re-routing</span> <span class='ocrx_word' id='word_1_199' title='bbox 723 2357 903 2381; x_wconf 98' lang='eng' dir='ltr'>tomorrow</span> <span class='ocrx_word' id='word_1_200' title='bbox 912 2351 1057 2392; x_wconf 96' lang='eng' dir='ltr'>through</span> <span class='ocrx_word' id='word_1_201' title='bbox 1065 2351 1153 2381; x_wconf 98' lang='eng' dir='ltr'>what</span> <span class='ocrx_word' id='word_1_202' title='bbox 1162 2351 1202 2381; x_wconf 98' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_203' title='bbox 1211 2357 1367 2391; x_wconf 94' lang='eng' dir='ltr'>prospect</span>
</span>
<span class='ocr_line' id='line_1_39' title="bbox 356 2410 793 2451; baseline -0.002 -10; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_204' title='bbox 356 2411 412 2441; x_wconf 89' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_205' title='bbox 422 2410 482 2440; x_wconf 89' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_206' title='bbox 491 2410 551 2440; x_wconf 89' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_207' title='bbox 559 2410 673 2440; x_wconf 88' lang='eng' dir='ltr'>makes</span> <span class='ocrx_word' id='word_1_208' title='bbox 686 2410 793 2451; x_wconf 88' lang='eng' dir='ltr'>today.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_10' title="bbox 414 2468 1363 2509">
<span class='ocr_line' id='line_1_40' title="bbox 414 2468 1363 2509; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_209' title='bbox 414 2468 617 2509; x_wconf 93' lang='eng' dir='ltr'>Virohyping</span> <span class='ocrx_word' id='word_1_210' title='bbox 628 2478 754 2508; x_wconf 94' lang='eng' dir='ltr'>sweeps</span> <span class='ocrx_word' id='word_1_211' title='bbox 766 2468 913 2509; x_wconf 96' lang='eng' dir='ltr'>through</span> <span class='ocrx_word' id='word_1_212' title='bbox 927 2468 983 2498; x_wconf 98' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_213' title='bbox 995 2468 1197 2509; x_wconf 94' lang='eng' dir='ltr'>advertising</span> <span class='ocrx_word' id='word_1_214' title='bbox 1208 2468 1363 2509; x_wconf 95' lang='eng' dir='ltr'>industry.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_11' title="bbox 418 2526 883 2567">
<span class='ocr_line' id='line_1_41' title="bbox 418 2526 883 2567; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_215' title='bbox 418 2527 582 2567; x_wconf 90' lang='eng' dir='ltr'>Everyone</span> <span class='ocrx_word' id='word_1_216' title='bbox 596 2526 660 2556; x_wconf 95' lang='eng' dir='ltr'>will</span> <span class='ocrx_word' id='word_1_217' title='bbox 674 2526 716 2556; x_wconf 98' lang='eng' dir='ltr'>be</span> <span class='ocrx_word' id='word_1_218' title='bbox 729 2526 836 2567; x_wconf 95' lang='eng' dir='ltr'>doing</span> <span class='ocrx_word' id='word_1_219' title='bbox 848 2526 883 2556; x_wconf 98' lang='eng' dir='ltr'>it.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_12' title="bbox 355 2585 1369 3154">
<span class='ocr_line' id='line_1_42' title="bbox 414 2585 1367 2626; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_220' title='bbox 414 2585 508 2615; x_wconf 93' lang='eng' dir='ltr'>Virus</span> <span class='ocrx_word' id='word_1_221' title='bbox 524 2585 551 2615; x_wconf 99' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_222' title='bbox 566 2585 719 2625; x_wconf 94' lang='eng' dir='ltr'>parasitic</span> <span class='ocrx_word' id='word_1_223' title='bbox 737 2585 780 2615; x_wconf 98' lang='eng' dir='ltr'>tic</span> <span class='ocrx_word' id='word_1_224' title='bbox 797 2585 976 2625; x_wconf 94' lang='eng' dir='ltr'>replicator</span> <span class='ocrx_word' id='word_1_225' title='bbox 991 2585 1087 2615; x_wconf 90' lang='eng' dir='ltr'>code:</span> <span class='ocrx_word' id='word_1_226' title='bbox 1105 2595 1147 2615; x_wconf 99' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_227' title='bbox 1165 2585 1367 2626; x_wconf 94' lang='eng' dir='ltr'>asignifying</span>
</span>
<span class='ocr_line' id='line_1_43' title="bbox 356 2643 1365 2683; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_228' title='bbox 356 2653 515 2683; x_wconf 93' lang='eng' dir='ltr'>sequence</span> <span class='ocrx_word' id='word_1_229' title='bbox 529 2643 567 2673; x_wconf 94' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_230' title='bbox 578 2643 741 2673; x_wconf 98' lang='eng' dir='ltr'>machinic</span> <span class='ocrx_word' id='word_1_231' title='bbox 757 2643 833 2673; x_wconf 95' lang='eng' dir='ltr'>data</span> <span class='ocrx_word' id='word_1_232' title='bbox 846 2643 930 2673; x_wconf 91' lang='eng' dir='ltr'>ATA</span> <span class='ocrx_word' id='word_1_233' title='bbox 941 2644 1025 2673; x_wconf 95' lang='eng' dir='ltr'>ATA</span> <span class='ocrx_word' id='word_1_234' title='bbox 1040 2643 1229 2673; x_wconf 91' lang='eng' dir='ltr'>flow-break</span> <span class='ocrx_word' id='word_1_235' title='bbox 1243 2643 1365 2681; x_wconf 86' lang='eng' dir='ltr'>on/off,</span>
</span>
<span class='ocr_line' id='line_1_44' title="bbox 356 2703 1369 2744; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_236' title='bbox 356 2703 419 2741; x_wconf 94' lang='eng'>1/0,</span> <span class='ocrx_word' id='word_1_237' title='bbox 434 2703 594 2744; x_wconf 96' lang='eng' dir='ltr'>yang/yin</span> <span class='ocrx_word' id='word_1_238' title='bbox 609 2703 824 2744; x_wconf 93' lang='eng' dir='ltr'>intrinsically</span> <span class='ocrx_word' id='word_1_239' title='bbox 838 2703 994 2733; x_wconf 95' lang='eng' dir='ltr'>destined</span> <span class='ocrx_word' id='word_1_240' title='bbox 1010 2703 1062 2733; x_wconf 94' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_241' title='bbox 1076 2713 1148 2733; x_wconf 98' lang='eng' dir='ltr'>war.</span> <span class='ocrx_word' id='word_1_242' title='bbox 1167 2704 1206 2733; x_wconf 93' lang='eng' dir='ltr'>In</span> <span class='ocrx_word' id='word_1_243' title='bbox 1220 2703 1314 2743; x_wconf 94' lang='eng' dir='ltr'>place</span> <span class='ocrx_word' id='word_1_244' title='bbox 1330 2703 1369 2733; x_wconf 94' lang='eng' dir='ltr'>of</span>
</span>
<span class='ocr_line' id='line_1_45' title="bbox 355 2761 1365 2802; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_245' title='bbox 355 2771 441 2791; x_wconf 92' lang='eng' dir='ltr'>mess</span> <span class='ocrx_word' id='word_1_246' title='bbox 456 2767 752 2802; x_wconf 94' lang='eng' dir='ltr'>message-content</span> <span class='ocrx_word' id='word_1_247' title='bbox 768 2761 919 2791; x_wconf 93' lang='eng' dir='ltr'>virodata</span> <span class='ocrx_word' id='word_1_248' title='bbox 937 2761 963 2791; x_wconf 99' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_249' title='bbox 981 2761 1167 2791; x_wconf 95' lang='eng' dir='ltr'>assembled</span> <span class='ocrx_word' id='word_1_250' title='bbox 1182 2761 1263 2791; x_wconf 95' lang='eng' dir='ltr'>bled</span> <span class='ocrx_word' id='word_1_251' title='bbox 1279 2761 1365 2791; x_wconf 94' lang='eng' dir='ltr'>from</span>
</span>
<span class='ocr_line' id='line_1_46' title="bbox 357 2818 1366 2862; baseline 0 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_252' title='bbox 357 2818 552 2861; x_wconf 88' lang='eng' dir='ltr'>asignifying</span> <span class='ocrx_word' id='word_1_253' title='bbox 564 2820 727 2850; x_wconf 95' lang='eng' dir='ltr'>materials</span> <span class='ocrx_word' id='word_1_254' title='bbox 743 2820 818 2850; x_wconf 99' lang='eng' dir='ltr'>with</span> <span class='ocrx_word' id='word_1_255' title='bbox 834 2820 947 2851; x_wconf 91' lang='eng' dir='ltr'>CATA</span> <span class='ocrx_word' id='word_1_256' title='bbox 960 2820 1110 2861; x_wconf 91' lang='eng' dir='ltr'>catalytic</span> <span class='ocrx_word' id='word_1_257' title='bbox 1127 2818 1176 2862; x_wconf 93' lang='eng' dir='ltr'>(or</span> <span class='ocrx_word' id='word_1_258' title='bbox 1190 2820 1366 2861; x_wconf 93' lang='eng' dir='ltr'>positively</span>
</span>
<span class='ocr_line' id='line_1_47' title="bbox 358 2876 1368 2920; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_259' title='bbox 358 2876 671 2920; x_wconf 90' lang='eng' dir='ltr'>disproportionate)</span> <span class='ocrx_word' id='word_1_260' title='bbox 682 2878 856 2918; x_wconf 84' lang='eng' dir='ltr'>efficiency:</span> <span class='ocrx_word' id='word_1_261' title='bbox 867 2878 1012 2908; x_wconf 91' lang='eng' dir='ltr'>intruder</span> <span class='ocrx_word' id='word_1_262' title='bbox 1019 2878 1187 2918; x_wconf 93' lang='eng' dir='ltr'>passcode,</span> <span class='ocrx_word' id='word_1_263' title='bbox 1197 2878 1368 2908; x_wconf 92' lang='eng' dir='ltr'>locational</span>
</span>
<span class='ocr_line' id='line_1_48' title="bbox 359 2936 1367 2977; baseline 0 -11; x_size 37; x_descenders 7; x_ascenders 10"><span class='ocrx_word' id='word_1_264' title='bbox 359 2936 520 2973; x_wconf 83' lang='eng' dir='ltr'>ZIP-code,</span> <span class='ocrx_word' id='word_1_265' title='bbox 534 2936 824 2977; x_wconf 91' lang='eng' dir='ltr'>pseudogenomic</span> <span class='ocrx_word' id='word_1_266' title='bbox 838 2936 1016 2966; x_wconf 94' lang='eng' dir='ltr'>substitute</span> <span class='ocrx_word' id='word_1_267' title='bbox 1030 2936 1251 2973; x_wconf 86' lang='eng' dir='ltr'>instructions,</span> <span class='ocrx_word' id='word_1_268' title='bbox 1267 2942 1367 2966; x_wconf 92' lang='eng' dir='ltr'>muta-</span>
</span>
<span class='ocr_line' id='line_1_49' title="bbox 359 2993 1367 3038; baseline 0.003 -13; x_size 43; x_descenders 11; x_ascenders 12"><span class='ocrx_word' id='word_1_269' title='bbox 359 2995 462 3030; x_wconf 85' lang='eng' dir='ltr'>tional</span> <span class='ocrx_word' id='word_1_270' title='bbox 469 2995 557 3036; x_wconf 86' lang='eng' dir='ltr'>junk</span> <span class='ocrx_word' id='word_1_271' title='bbox 570 2993 743 3038; x_wconf 90' lang='eng' dir='ltr'>(complex</span> <span class='ocrx_word' id='word_1_272' title='bbox 754 2995 815 3025; x_wconf 94' lang='eng' dir='ltr'>but</span> <span class='ocrx_word' id='word_1_273' title='bbox 828 2995 931 3025; x_wconf 92' lang='eng' dir='ltr'>latent</span> <span class='ocrx_word' id='word_1_274' title='bbox 943 2993 1134 3037; x_wconf 86' lang='eng' dir='ltr'>segments),</span> <span class='ocrx_word' id='word_1_275' title='bbox 1148 2995 1214 3025; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_276' title='bbox 1225 2997 1367 3038; x_wconf 91' lang='eng' dir='ltr'>garbage</span>
</span>
<span class='ocr_line' id='line_1_50' title="bbox 359 3051 1367 3096; baseline 0 -13; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_277' title='bbox 359 3051 572 3096; x_wconf 91' lang='eng' dir='ltr'>(redundant</span> <span class='ocrx_word' id='word_1_278' title='bbox 591 3063 1367 3093; x_wconf 89' lang='eng' dir='ltr'>scrapcrapcrapcrapcrapcrapcrapcrapcrap-</span>
</span>
<span class='ocr_line' id='line_1_51' title="bbox 358 3110 708 3154; baseline 0 -12; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_279' title='bbox 358 3110 708 3154; x_wconf 92' lang='eng' dir='ltr'>crapcrapcrapcrap).</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_13' title="bbox 357 3171 1368 3563">
<span class='ocr_line' id='line_1_52' title="bbox 423 3171 1368 3212; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_280' title='bbox 423 3171 572 3201; x_wconf 94' lang='eng' dir='ltr'>Biovirus</span> <span class='ocrx_word' id='word_1_281' title='bbox 586 3171 646 3201; x_wconf 90' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_282' title='bbox 655 3171 716 3201; x_wconf 92' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_283' title='bbox 724 3171 785 3201; x_wconf 92' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_284' title='bbox 799 3177 918 3212; x_wconf 94' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_285' title='bbox 935 3171 1126 3212; x_wconf 86' lang='eng' dir='ltr'>organisms,</span> <span class='ocrx_word' id='word_1_286' title='bbox 1145 3171 1287 3212; x_wconf 85' lang='eng' dir='ltr'>hacking</span> <span class='ocrx_word' id='word_1_287' title='bbox 1299 3171 1368 3201; x_wconf 92' lang='eng' dir='ltr'>and</span>
</span>
<span class='ocr_line' id='line_1_53' title="bbox 358 3229 1368 3270; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_288' title='bbox 358 3229 641 3270; x_wconf 92' lang='eng' dir='ltr'>reprogramming</span> <span class='ocrx_word' id='word_1_289' title='bbox 647 3229 1368 3259; x_wconf 71' lang='eng' dir='ltr'>ATGAC&#39;ITATCCACGGTACATTCAGT</span>
</span>
<span class='ocr_line' id='line_1_54' title="bbox 358 3287 1366 3327; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_290' title='bbox 358 3287 492 3317; x_wconf 94' lang='eng' dir='ltr'>cellular</span> <span class='ocrx_word' id='word_1_291' title='bbox 502 3296 578 3317; x_wconf 89' lang='eng' dir='ltr'>DNA</span> <span class='ocrx_word' id='word_1_292' title='bbox 592 3293 624 3317; x_wconf 99' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_293' title='bbox 634 3287 784 3327; x_wconf 92' lang='eng' dir='ltr'>produce</span> <span class='ocrx_word' id='word_1_294' title='bbox 795 3297 887 3317; x_wconf 94' lang='eng' dir='ltr'>more</span> <span class='ocrx_word' id='word_1_295' title='bbox 896 3287 984 3317; x_wconf 93' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_296' title='bbox 994 3287 1079 3317; x_wconf 94' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_297' title='bbox 1089 3287 1176 3317; x_wconf 94' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_298' title='bbox 1185 3287 1271 3317; x_wconf 95' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_299' title='bbox 1280 3287 1366 3317; x_wconf 94' lang='eng' dir='ltr'>virus</span>
</span>
<span class='ocr_line' id='line_1_55' title="bbox 358 3345 1365 3385; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_300' title='bbox 358 3345 445 3375; x_wconf 93' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_301' title='bbox 459 3345 547 3375; x_wconf 93' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_302' title='bbox 563 3345 660 3375; x_wconf 92' lang='eng' dir='ltr'>virus.</span> <span class='ocrx_word' id='word_1_303' title='bbox 680 3346 726 3375; x_wconf 95' lang='eng' dir='ltr'>Its</span> <span class='ocrx_word' id='word_1_304' title='bbox 740 3345 889 3385; x_wconf 92' lang='eng' dir='ltr'>enzymic</span> <span class='ocrx_word' id='word_1_305' title='bbox 905 3345 1127 3385; x_wconf 91' lang='eng' dir='ltr'>cut-and-past</span> <span class='ocrx_word' id='word_1_306' title='bbox 1141 3345 1365 3375; x_wconf 91' lang='eng' dir='ltr'>recombinant</span>
</span>
<span class='ocr_line' id='line_1_56' title="bbox 357 3404 1365 3445; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_307' title='bbox 357 3404 678 3445; x_wconf 92' lang='eng' dir='ltr'>wetware-splicing</span> <span class='ocrx_word' id='word_1_308' title='bbox 699 3414 829 3434; x_wconf 94' lang='eng' dir='ltr'>crosses</span> <span class='ocrx_word' id='word_1_309' title='bbox 852 3404 1054 3445; x_wconf 91' lang='eng' dir='ltr'>singularity</span> <span class='ocrx_word' id='word_1_310' title='bbox 1074 3404 1173 3434; x_wconf 92' lang='eng' dir='ltr'>when</span> <span class='ocrx_word' id='word_1_311' title='bbox 1195 3404 1365 3434; x_wconf 94' lang='eng' dir='ltr'>retroviral</span>
</span>
<span class='ocr_line' id='line_1_57' title="bbox 358 3460 1364 3505; baseline 0 -13; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_312' title='bbox 358 3462 723 3502; x_wconf 91' lang='eng' dir='ltr'>reverse-transcriptase</span> <span class='ocrx_word' id='word_1_313' title='bbox 733 3462 832 3492; x_wconf 92' lang='eng' dir='ltr'>clicks</span> <span class='ocrx_word' id='word_1_314' title='bbox 841 3462 876 3492; x_wconf 91' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_315' title='bbox 887 3460 1057 3505; x_wconf 91' lang='eng' dir='ltr'>(enabling</span> <span class='ocrx_word' id='word_1_316' title='bbox 1065 3462 1271 3503; x_wconf 91' lang='eng' dir='ltr'>ontogenetic</span> <span class='ocrx_word' id='word_1_317' title='bbox 1281 3471 1364 3492; x_wconf 91' lang='eng' dir='ltr'>DNA-</span>
</span>
<span class='ocr_line' id='line_1_58' title="bbox 360 3519 1187 3563; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_318' title='bbox 360 3530 433 3551; x_wconf 90' lang='eng' dir='ltr'>RNA</span> <span class='ocrx_word' id='word_1_319' title='bbox 446 3521 599 3561; x_wconf 92' lang='eng' dir='ltr'>circuitry</span> <span class='ocrx_word' id='word_1_320' title='bbox 611 3521 680 3551; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_321' title='bbox 692 3521 920 3551; x_wconf 91' lang='eng' dir='ltr'>endocellular</span> <span class='ocrx_word' id='word_1_322' title='bbox 932 3519 1187 3563; x_wconf 91' lang='eng' dir='ltr'>computation).</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_14' title="bbox 357 3579 1364 3901">
<span class='ocr_line' id='line_1_59' title="bbox 419 3579 1364 3609; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_323' title='bbox 419 3579 1364 3609; x_wconf 92' lang='eng' dir='ltr'>ATAGGTCATGAATCTACCGATTGCAGCTGC</span>
</span>
<span class='ocr_line' id='line_1_60' title="bbox 357 3637 1363 3667; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_324' title='bbox 357 3637 1363 3667; x_wconf 90' lang='eng' dir='ltr'>TATTCCTCGATGATCGCATGGGCTGTGATG</span>
</span>
<span class='ocr_line' id='line_1_61' title="bbox 358 3696 1363 3726; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_325' title='bbox 358 3696 1363 3726; x_wconf 77' lang='eng' dir='ltr'>GCATCGTATCCGATCGATTCGAGCGATTGCAGC</span>
</span>
<span class='ocr_line' id='line_1_62' title="bbox 357 3754 1362 3784; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_326' title='bbox 357 3754 1362 3784; x_wconf 75' lang='eng' dir='ltr'>TACGCTATTCCTCCGAGGGATTGCAGCTACGTC</span>
</span>
<span class='ocr_line' id='line_1_63' title="bbox 358 3812 1363 3843; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_327' title='bbox 358 3812 1363 3843; x_wconf 91' lang='eng' dir='ltr'>GCATCGGGCTCAGATGTAGGTCATGAATCTACC</span>
</span>
<span class='ocr_line' id='line_1_64' title="bbox 359 3871 1327 3901; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_328' title='bbox 359 3871 747 3901; x_wconf 79' lang='eng' dir='ltr'>GATTGCATGACTT</span> <span class='ocrx_word' id='word_1_329' title='bbox 743 3871 1298 3901; x_wconf 79' lang='eng' dir='ltr'>ATCCACGGTACA’ITCGACT</span> <span class='ocrx_word' id='word_1_330' title='bbox 1299 3871 1327 3901; x_wconf 96' lang='eng' dir='ltr'>C</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_15' title="bbox 358 3929 1372 4539">
<span class='ocr_line' id='line_1_65' title="bbox 423 3929 1362 3970; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_331' title='bbox 423 3929 623 3959; x_wconf 90' lang='eng' dir='ltr'>Ethnovirus</span> <span class='ocrx_word' id='word_1_332' title='bbox 639 3935 759 3970; x_wconf 93' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_333' title='bbox 774 3929 884 3959; x_wconf 92' lang='eng' dir='ltr'>brains</span> <span class='ocrx_word' id='word_1_334' title='bbox 897 3929 1117 3959; x_wconf 92' lang='eng' dir='ltr'>Technovirus</span> <span class='ocrx_word' id='word_1_335' title='bbox 1132 3935 1248 3970; x_wconf 92' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_336' title='bbox 1262 3929 1362 3959; x_wconf 94' lang='eng' dir='ltr'>socio-</span>
</span>
<span class='ocr_line' id='line_1_66' title="bbox 358 3988 1361 4028; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_337' title='bbox 358 3988 531 4018; x_wconf 92' lang='eng' dir='ltr'>economic</span> <span class='ocrx_word' id='word_1_338' title='bbox 549 3998 611 4028; x_wconf 93' lang='eng' dir='ltr'>pro</span> <span class='ocrx_word' id='word_1_339' title='bbox 628 3998 690 4028; x_wconf 93' lang='eng' dir='ltr'>pro</span> <span class='ocrx_word' id='word_1_340' title='bbox 707 3988 912 4028; x_wconf 91' lang='eng' dir='ltr'>production</span> <span class='ocrx_word' id='word_1_341' title='bbox 929 3998 990 4028; x_wconf 93' lang='eng' dir='ltr'>pro</span> <span class='ocrx_word' id='word_1_342' title='bbox 1007 3998 1182 4028; x_wconf 92' lang='eng' dir='ltr'>processes.</span> <span class='ocrx_word' id='word_1_343' title='bbox 1202 3988 1361 4018; x_wconf 91' lang='eng' dir='ltr'>Infovirus</span>
</span>
<span class='ocr_line' id='line_1_67' title="bbox 360 4046 1361 4087; baseline -0.001 -11; x_size 41; x_descenders 11; x_ascenders 9"><span class='ocrx_word' id='word_1_344' title='bbox 360 4052 474 4087; x_wconf 90' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_345' title='bbox 484 4046 597 4087; x_wconf 91' lang='eng' dir='ltr'>digital</span> <span class='ocrx_word' id='word_1_346' title='bbox 606 4054 1361 4076; x_wconf 94' lang='eng'>010010010001011110100001001101010101010</span>
</span>
<span class='ocr_line' id='line_1_68' title="bbox 360 4111 1360 4145; baseline 0 -10; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_347' title='bbox 360 4111 1360 4145; x_wconf 91' lang='eng' dir='ltr'>10001001101010010010100computers100101001011010010</span>
</span>
<span class='ocr_line' id='line_1_69' title="bbox 360 4171 1360 4192; baseline 0.001 -1; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_348' title='bbox 360 4171 1360 4192; x_wconf 89' lang='eng'>101111010001010101010101010010101001010110101001</span>
</span>
<span class='ocr_line' id='line_1_70' title="bbox 358 4228 1359 4250; baseline -0.001 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_349' title='bbox 358 4228 1359 4250; x_wconf 94' lang='eng'>000000100010111010100100101010010100100101010101</span>
</span>
<span class='ocr_line' id='line_1_71' title="bbox 359 4286 1358 4308; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_350' title='bbox 359 4286 1358 4308; x_wconf 91' lang='eng'>00100010010010010010010010100100101011010100100</span>
</span>
<span class='ocr_line' id='line_1_72' title="bbox 360 4344 1358 4366; baseline 0.001 -1; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_351' title='bbox 360 4344 1358 4366; x_wconf 94' lang='eng'>10010101101010101010111101000010011010101010101000</span>
</span>
<span class='ocr_line' id='line_1_73' title="bbox 361 4403 1359 4425; baseline 0.001 -1; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_352' title='bbox 361 4403 1359 4425; x_wconf 91' lang='eng'>1001101101010101001100100010001010101110100001010</span>
</span>
<span class='ocr_line' id='line_1_74' title="bbox 360 4461 1372 4482; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_353' title='bbox 360 4461 1372 4482; x_wconf 96' lang='eng'>110010100101000110010011100100010000000001001111</span>
</span>
<span class='ocr_line' id='line_1_75' title="bbox 360 4517 680 4539; baseline -0.003 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_354' title='bbox 360 4517 680 4539; x_wconf 94' lang='eng'>1100010010010101</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_16' title="bbox 360 4568 1375 5015">
<span class='ocr_line' id='line_1_76' title="bbox 425 4568 1372 4609; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_355' title='bbox 425 4568 626 4608; x_wconf 92' lang='eng' dir='ltr'>Hypervirus</span> <span class='ocrx_word' id='word_1_356' title='bbox 639 4574 759 4609; x_wconf 94' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_357' title='bbox 770 4568 957 4609; x_wconf 91' lang='eng' dir='ltr'>intelligent</span> <span class='ocrx_word' id='word_1_358' title='bbox 968 4568 1264 4608; x_wconf 91' lang='eng' dir='ltr'>immunosecurity</span> <span class='ocrx_word' id='word_1_359' title='bbox 1274 4574 1372 4598; x_wconf 94' lang='eng' dir='ltr'>struc-</span>
</span>
<span class='ocr_line' id='line_1_77' title="bbox 361 4626 1372 4667; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_360' title='bbox 361 4633 458 4656; x_wconf 89' lang='eng' dir='ltr'>tures:</span> <span class='ocrx_word' id='word_1_361' title='bbox 470 4636 525 4666; x_wconf 91' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_362' title='bbox 535 4636 589 4666; x_wconf 92' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_363' title='bbox 601 4636 646 4656; x_wconf 92' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_364' title='bbox 656 4636 712 4666; x_wconf 91' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_365' title='bbox 724 4636 769 4656; x_wconf 92' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_366' title='bbox 782 4626 1003 4666; x_wconf 91' lang='eng' dir='ltr'>nomadically</span> <span class='ocrx_word' id='word_1_367' title='bbox 1015 4626 1219 4667; x_wconf 91' lang='eng' dir='ltr'>abstracting</span> <span class='ocrx_word' id='word_1_368' title='bbox 1229 4626 1269 4656; x_wconf 94' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_369' title='bbox 1280 4636 1372 4666; x_wconf 93' lang='eng' dir='ltr'>proc-</span>
</span>
<span class='ocr_line' id='line_1_78' title="bbox 362 4682 1372 4726; baseline 0 -12; x_size 37; x_descenders 7; x_ascenders 10"><span class='ocrx_word' id='word_1_370' title='bbox 362 4694 444 4714; x_wconf 94' lang='eng' dir='ltr'>esses</span> <span class='ocrx_word' id='word_1_371' title='bbox 457 4684 540 4714; x_wconf 90' lang='eng' dir='ltr'>from</span> <span class='ocrx_word' id='word_1_372' title='bbox 552 4684 681 4724; x_wconf 88' lang='eng' dir='ltr'>specific</span> <span class='ocrx_word' id='word_1_373' title='bbox 694 4684 803 4714; x_wconf 95' lang='eng' dir='ltr'>media</span> <span class='ocrx_word' id='word_1_374' title='bbox 816 4682 918 4726; x_wconf 88' lang='eng' dir='ltr'>(DNA,</span> <span class='ocrx_word' id='word_1_375' title='bbox 928 4684 1050 4721; x_wconf 94' lang='eng' dir='ltr'>words,</span> <span class='ocrx_word' id='word_1_376' title='bbox 1061 4684 1222 4724; x_wconf 91' lang='eng' dir='ltr'>symbolic</span> <span class='ocrx_word' id='word_1_377' title='bbox 1232 4684 1372 4721; x_wconf 94' lang='eng' dir='ltr'>models,</span>
</span>
<span class='ocr_line' id='line_1_79' title="bbox 361 4741 1373 4784; baseline 0 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_378' title='bbox 361 4741 632 4784; x_wconf 91' lang='eng' dir='ltr'>bit-sequences),</span> <span class='ocrx_word' id='word_1_379' title='bbox 653 4742 722 4772; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_380' title='bbox 739 4742 921 4782; x_wconf 92' lang='eng' dir='ltr'>operantly</span> <span class='ocrx_word' id='word_1_381' title='bbox 938 4742 1207 4783; x_wconf 92' lang='eng' dir='ltr'>re-engineering</span> <span class='ocrx_word' id='word_1_382' title='bbox 1224 4742 1321 4772; x_wconf 82' lang='eng' dir='ltr'>itself.</span> <span class='ocrx_word' id='word_1_383' title='bbox 1345 4743 1373 4772; x_wconf 95' lang='eng' dir='ltr'>It</span>
</span>
<span class='ocr_line' id='line_1_80' title="bbox 361 4800 1375 4841; baseline 0 -11; x_size 37; x_descenders 7; x_ascenders 10"><span class='ocrx_word' id='word_1_384' title='bbox 361 4800 448 4830; x_wconf 82' lang='eng' dir='ltr'>folds</span> <span class='ocrx_word' id='word_1_385' title='bbox 462 4800 532 4830; x_wconf 92' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_386' title='bbox 544 4800 639 4837; x_wconf 82' lang='eng' dir='ltr'>itself,</span> <span class='ocrx_word' id='word_1_387' title='bbox 653 4800 828 4837; x_wconf 92' lang='eng' dir='ltr'>involutes,</span> <span class='ocrx_word' id='word_1_388' title='bbox 843 4810 881 4830; x_wconf 95' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_389' title='bbox 893 4800 1018 4840; x_wconf 90' lang='eng' dir='ltr'>plexes,</span> <span class='ocrx_word' id='word_1_390' title='bbox 1033 4800 1077 4840; x_wconf 93' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_391' title='bbox 1089 4800 1375 4841; x_wconf 91' lang='eng' dir='ltr'>reprogramming</span>
</span>
<span class='ocr_line' id='line_1_81' title="bbox 360 4858 1372 4899; baseline 0 -11; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_392' title='bbox 360 4858 573 4898; x_wconf 89' lang='eng' dir='ltr'>corpuscular</span> <span class='ocrx_word' id='word_1_393' title='bbox 590 4858 674 4888; x_wconf 92' lang='eng' dir='ltr'>code</span> <span class='ocrx_word' id='word_1_394' title='bbox 696 4864 730 4888; x_wconf 97' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_395' title='bbox 749 4868 940 4899; x_wconf 92' lang='eng' dir='ltr'>reprogram</span> <span class='ocrx_word' id='word_1_396' title='bbox 960 4858 1247 4899; x_wconf 91' lang='eng' dir='ltr'>reprogramming</span> <span class='ocrx_word' id='word_1_397' title='bbox 1265 4868 1372 4898; x_wconf 92' lang='eng' dir='ltr'>repro-</span>
</span>
<span class='ocr_line' id='line_1_82' title="bbox 360 4916 1373 4958; baseline -0.001 -11; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_398' title='bbox 360 4917 547 4958; x_wconf 90' lang='eng' dir='ltr'>gramming</span> <span class='ocrx_word' id='word_1_399' title='bbox 556 4916 849 4957; x_wconf 92' lang='eng' dir='ltr'>reprogramming.</span> <span class='ocrx_word' id='word_1_400' title='bbox 865 4925 945 4946; x_wconf 90' lang='eng' dir='ltr'>ROM</span> <span class='ocrx_word' id='word_1_401' title='bbox 959 4916 986 4946; x_wconf 95' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_402' title='bbox 997 4916 1121 4946; x_wconf 95' lang='eng' dir='ltr'>melted</span> <span class='ocrx_word' id='word_1_403' title='bbox 1130 4916 1202 4946; x_wconf 91' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_404' title='bbox 1213 4916 1373 4946; x_wconf 94' lang='eng' dir='ltr'>recursive</span>
</span>
<span class='ocr_line' id='line_1_83' title="bbox 361 4975 666 5015; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_405' title='bbox 361 4975 666 5015; x_wconf 90' lang='eng' dir='ltr'>experimentation.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_17' title="bbox 363 5041 1374 5364">
<span class='ocr_line' id='line_1_84' title="bbox 423 5041 1373 5062; baseline -0.001 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_406' title='bbox 423 5041 1373 5062; x_wconf 96' lang='eng'>001010010010010110000101010101011101010010100</span>
</span>
<span class='ocr_line' id='line_1_85' title="bbox 363 5100 1373 5121; baseline 0.001 -1; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_407' title='bbox 363 5100 1373 5121; x_wconf 96' lang='eng'>10010101000011011001101001011000010001001001000</span>
</span>
<span class='ocr_line' id='line_1_86' title="bbox 363 5149 1374 5190; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_408' title='bbox 363 5149 548 5190; x_wconf 91' lang='eng' dir='ltr'>Recording</span> <span class='ocrx_word' id='word_1_409' title='bbox 556 5149 695 5179; x_wconf 94' lang='eng' dir='ltr'>devices.</span> <span class='ocrx_word' id='word_1_410' title='bbox 707 5149 856 5189; x_wconf 93' lang='eng' dir='ltr'>Copiers.</span> <span class='ocrx_word' id='word_1_411' title='bbox 869 5150 979 5179; x_wconf 90' lang='eng' dir='ltr'>Faxes.</span> <span class='ocrx_word' id='word_1_412' title='bbox 992 5149 1167 5189; x_wconf 92' lang='eng' dir='ltr'>Samplers.</span> <span class='ocrx_word' id='word_1_413' title='bbox 1181 5155 1374 5179; x_wconf 90' lang='eng' dir='ltr'>K-stammer</span>
</span>
<span class='ocr_line' id='line_1_87' title="bbox 363 5207 1372 5252; baseline 0 -14; x_size 43; x_descenders 12; x_ascenders 11"><span class='ocrx_word' id='word_1_414' title='bbox 363 5207 639 5252; x_wconf 90' lang='eng' dir='ltr'>(((re)re)reruns)</span> <span class='ocrx_word' id='word_1_415' title='bbox 656 5214 814 5238; x_wconf 90' lang='eng' dir='ltr'>cross-cut</span> <span class='ocrx_word' id='word_1_416' title='bbox 829 5208 873 5248; x_wconf 92' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_417' title='bbox 886 5208 1016 5248; x_wconf 91' lang='eng' dir='ltr'>orphan</span> <span class='ocrx_word' id='word_1_418' title='bbox 1032 5207 1117 5238; x_wconf 82' lang='eng' dir='ltr'>drift.</span> <span class='ocrx_word' id='word_1_419' title='bbox 1136 5209 1261 5248; x_wconf 90' lang='eng' dir='ltr'>Repeat</span> <span class='ocrx_word' id='word_1_420' title='bbox 1274 5208 1372 5238; x_wconf 91' lang='eng' dir='ltr'>infec-</span>
</span>
<span class='ocr_line' id='line_1_88' title="bbox 363 5266 1372 5306; baseline 0 -10; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_421' title='bbox 363 5266 442 5296; x_wconf 91' lang='eng' dir='ltr'>tion.</span> <span class='ocrx_word' id='word_1_422' title='bbox 462 5266 515 5296; x_wconf 95' lang='eng' dir='ltr'>All</span> <span class='ocrx_word' id='word_1_423' title='bbox 533 5266 619 5306; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_424' title='bbox 638 5266 728 5306; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_425' title='bbox 747 5266 834 5306; x_wconf 91' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_426' title='bbox 854 5266 942 5306; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_427' title='bbox 963 5266 1051 5306; x_wconf 91' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_428' title='bbox 1070 5266 1160 5306; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_429' title='bbox 1179 5266 1266 5306; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_430' title='bbox 1286 5266 1372 5306; x_wconf 92' lang='eng' dir='ltr'>hype</span>
</span>
<span class='ocr_line' id='line_1_89' title="bbox 363 5324 1238 5364; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_431' title='bbox 363 5324 551 5364; x_wconf 92' lang='eng' dir='ltr'>hypervirus</span> <span class='ocrx_word' id='word_1_432' title='bbox 564 5324 682 5354; x_wconf 91' lang='eng' dir='ltr'>strains</span> <span class='ocrx_word' id='word_1_433' title='bbox 696 5334 748 5354; x_wconf 95' lang='eng' dir='ltr'>are</span> <span class='ocrx_word' id='word_1_434' title='bbox 761 5324 879 5364; x_wconf 91' lang='eng' dir='ltr'>plastic</span> <span class='ocrx_word' id='word_1_435' title='bbox 894 5324 959 5354; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_436' title='bbox 973 5324 1238 5364; x_wconf 91' lang='eng' dir='ltr'>interoperative.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_18' title="bbox 361 5382 1376 6063">
<span class='ocr_line' id='line_1_90' title="bbox 425 5382 1371 5423; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_437' title='bbox 425 5383 587 5412; x_wconf 70' lang='eng' dir='ltr'>INSERT.</span> <span class='ocrx_word' id='word_1_438' title='bbox 602 5382 885 5423; x_wconf 80' lang='eng' dir='ltr'>hyper-prefixing</span> <span class='ocrx_word' id='word_1_439' title='bbox 896 5382 1045 5413; x_wconf 84' lang='eng' dir='ltr'>semiotic</span> <span class='ocrx_word' id='word_1_440' title='bbox 1058 5388 1178 5412; x_wconf 84' lang='eng' dir='ltr'>sectors</span> <span class='ocrx_word' id='word_1_441' title='bbox 1186 5382 1278 5412; x_wconf 86' lang='eng' dir='ltr'>TAG</span> <span class='ocrx_word' id='word_1_442' title='bbox 1285 5382 1371 5412; x_wconf 92' lang='eng' dir='ltr'>TAG</span>
</span>
<span class='ocr_line' id='line_1_91' title="bbox 361 5438 1372 5482; baseline 0 -12; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_443' title='bbox 361 5440 446 5470; x_wconf 90' lang='eng' dir='ltr'>TAG</span> <span class='ocrx_word' id='word_1_444' title='bbox 455 5446 521 5481; x_wconf 89' lang='eng' dir='ltr'>tags</span> <span class='ocrx_word' id='word_1_445' title='bbox 529 5440 616 5470; x_wconf 93' lang='eng' dir='ltr'>them</span> <span class='ocrx_word' id='word_1_446' title='bbox 624 5440 675 5470; x_wconf 95' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_447' title='bbox 683 5440 817 5470; x_wconf 92' lang='eng' dir='ltr'>transfer</span> <span class='ocrx_word' id='word_1_448' title='bbox 824 5440 894 5470; x_wconf 92' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_449' title='bbox 902 5440 1041 5470; x_wconf 94' lang='eng' dir='ltr'>abstract</span> <span class='ocrx_word' id='word_1_450' title='bbox 1048 5440 1134 5470; x_wconf 89' lang='eng' dir='ltr'>ACT</span> <span class='ocrx_word' id='word_1_451' title='bbox 1140 5440 1225 5470; x_wconf 89' lang='eng' dir='ltr'>ACT</span> <span class='ocrx_word' id='word_1_452' title='bbox 1234 5438 1372 5482; x_wconf 91' lang='eng' dir='ltr'>(nonlin-</span>
</span>
<span class='ocr_line' id='line_1_92' title="bbox 363 5497 1375 5540; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_453' title='bbox 363 5508 415 5528; x_wconf 91' lang='eng' dir='ltr'>ear</span> <span class='ocrx_word' id='word_1_454' title='bbox 423 5497 657 5540; x_wconf 91' lang='eng' dir='ltr'>transcodable)</span> <span class='ocrx_word' id='word_1_455' title='bbox 667 5498 829 5528; x_wconf 92' lang='eng' dir='ltr'>machinic</span> <span class='ocrx_word' id='word_1_456' title='bbox 837 5504 980 5538; x_wconf 91' lang='eng' dir='ltr'>systems,</span> <span class='ocrx_word' id='word_1_457' title='bbox 992 5498 1094 5528; x_wconf 92' lang='eng' dir='ltr'>tuned</span> <span class='ocrx_word' id='word_1_458' title='bbox 1103 5504 1136 5528; x_wconf 97' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_459' title='bbox 1144 5498 1329 5528; x_wconf 94' lang='eng' dir='ltr'>virtualities</span> <span class='ocrx_word' id='word_1_460' title='bbox 1338 5508 1375 5528; x_wconf 95' lang='eng' dir='ltr'>or</span>
</span>
<span class='ocr_line' id='line_1_93' title="bbox 364 5556 1371 5600; baseline 0 -13; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_461' title='bbox 364 5557 576 5597; x_wconf 91' lang='eng' dir='ltr'>hyperspeeds</span> <span class='ocrx_word' id='word_1_462' title='bbox 586 5556 720 5600; x_wconf 95' lang='eng' dir='ltr'>(futural</span> <span class='ocrx_word' id='word_1_463' title='bbox 728 5557 906 5587; x_wconf 91' lang='eng' dir='ltr'>currencies</span> <span class='ocrx_word' id='word_1_464' title='bbox 914 5557 1137 5597; x_wconf 91' lang='eng' dir='ltr'>independent</span> <span class='ocrx_word' id='word_1_465' title='bbox 1146 5557 1184 5587; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_466' title='bbox 1189 5557 1246 5587; x_wconf 95' lang='eng' dir='ltr'>def</span> <span class='ocrx_word' id='word_1_467' title='bbox 1248 5557 1371 5587; x_wconf 94' lang='eng' dir='ltr'>uturali-</span>
</span>
<span class='ocr_line' id='line_1_94' title="bbox 365 5614 1373 5657; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_468' title='bbox 365 5614 494 5657; x_wconf 91' lang='eng' dir='ltr'>zation).</span> <span class='ocrx_word' id='word_1_469' title='bbox 507 5615 725 5655; x_wconf 91' lang='eng' dir='ltr'>Hypermedia</span> <span class='ocrx_word' id='word_1_470' title='bbox 734 5615 900 5656; x_wconf 88' lang='eng' dir='ltr'>configure</span> <span class='ocrx_word' id='word_1_471' title='bbox 910 5625 942 5645; x_wconf 95' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_472' title='bbox 952 5625 983 5645; x_wconf 95' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_473' title='bbox 992 5625 1087 5655; x_wconf 92' lang='eng' dir='ltr'>every</span> <span class='ocrx_word' id='word_1_474' title='bbox 1095 5615 1373 5655; x_wconf 92' lang='eng' dir='ltr'>implementation</span>
</span>
<span class='ocr_line' id='line_1_95' title="bbox 362 5674 1376 5714; baseline 0.001 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_475' title='bbox 362 5674 476 5704; x_wconf 91' lang='eng' dir='ltr'>within</span> <span class='ocrx_word' id='word_1_476' title='bbox 487 5684 505 5704; x_wconf 96' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_477' title='bbox 517 5674 647 5714; x_wconf 88' lang='eng' dir='ltr'>specific</span> <span class='ocrx_word' id='word_1_478' title='bbox 661 5674 806 5704; x_wconf 95' lang='eng' dir='ltr'>medium</span> <span class='ocrx_word' id='word_1_479' title='bbox 820 5684 858 5704; x_wconf 95' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_480' title='bbox 870 5674 1022 5714; x_wconf 92' lang='eng' dir='ltr'>territory</span> <span class='ocrx_word' id='word_1_481' title='bbox 1032 5684 1066 5704; x_wconf 94' lang='eng' dir='ltr'>as</span> <span class='ocrx_word' id='word_1_482' title='bbox 1078 5684 1096 5704; x_wconf 96' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_483' title='bbox 1108 5674 1327 5704; x_wconf 91' lang='eng' dir='ltr'>subfunction</span> <span class='ocrx_word' id='word_1_484' title='bbox 1339 5674 1376 5704; x_wconf 98' lang='eng' dir='ltr'>of</span>
</span>
<span class='ocr_line' id='line_1_96' title="bbox 364 5730 1371 5776; baseline -0.001 -13; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_485' title='bbox 364 5732 624 5763; x_wconf 89' lang='eng' dir='ltr'>extraterritorial</span> <span class='ocrx_word' id='word_1_486' title='bbox 635 5742 815 5772; x_wconf 87' lang='eng' dir='ltr'>processes.</span> <span class='ocrx_word' id='word_1_487' title='bbox 830 5732 946 5773; x_wconf 92' lang='eng' dir='ltr'>Going</span> <span class='ocrx_word' id='word_1_488' title='bbox 959 5730 987 5775; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_489' title='bbox 1002 5730 1014 5774; x_wconf 96' lang='eng'>(</span> <span class='ocrx_word' id='word_1_490' title='bbox 1028 5730 1074 5775; x_wconf 92' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_491' title='bbox 1089 5730 1101 5774; x_wconf 96' lang='eng'>(</span> <span class='ocrx_word' id='word_1_492' title='bbox 1115 5730 1127 5774; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_493' title='bbox 1143 5730 1154 5774; x_wconf 91' lang='eng'>(</span> <span class='ocrx_word' id='word_1_494' title='bbox 1167 5730 1179 5774; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_495' title='bbox 1195 5731 1223 5775; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_496' title='bbox 1236 5730 1248 5774; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_497' title='bbox 1273 5730 1285 5774; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_498' title='bbox 1300 5731 1328 5776; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_499' title='bbox 1342 5731 1371 5776; x_wconf 89' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_97' title="bbox 367 5790 1373 5834; baseline 0 -13; x_size 42; x_descenders 11; x_ascenders 11"><span class='ocrx_word' id='word_1_500' title='bbox 367 5790 378 5834; x_wconf 91' lang='eng'>(</span> <span class='ocrx_word' id='word_1_501' title='bbox 392 5790 404 5834; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_502' title='bbox 419 5791 519 5831; x_wconf 92' lang='eng' dir='ltr'>hyper</span> <span class='ocrx_word' id='word_1_503' title='bbox 531 5791 690 5821; x_wconf 93' lang='eng' dir='ltr'>dissolves</span> <span class='ocrx_word' id='word_1_504' title='bbox 703 5791 806 5832; x_wconf 91' lang='eng' dir='ltr'>being</span> <span class='ocrx_word' id='word_1_505' title='bbox 818 5791 889 5821; x_wconf 91' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_506' title='bbox 900 5791 990 5821; x_wconf 93' lang='eng' dir='ltr'>ACT</span> <span class='ocrx_word' id='word_1_507' title='bbox 999 5791 1089 5821; x_wconf 93' lang='eng' dir='ltr'>ACT</span> <span class='ocrx_word' id='word_1_508' title='bbox 1099 5791 1187 5821; x_wconf 89' lang='eng' dir='ltr'>ACT</span> <span class='ocrx_word' id='word_1_509' title='bbox 1199 5791 1340 5831; x_wconf 87' lang='eng' dir='ltr'>activity;</span> <span class='ocrx_word' id='word_1_510' title='bbox 1355 5801 1373 5821; x_wconf 96' lang='eng' dir='ltr'>a</span>
</span>
<span class='ocr_line' id='line_1_98' title="bbox 365 5850 1372 5890; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_511' title='bbox 365 5850 508 5880; x_wconf 90' lang='eng' dir='ltr'>material</span> <span class='ocrx_word' id='word_1_512' title='bbox 523 5850 886 5880; x_wconf 91' lang='eng' dir='ltr'>desubstantialisation</span> <span class='ocrx_word' id='word_1_513' title='bbox 902 5860 945 5880; x_wconf 92' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_514' title='bbox 964 5850 1013 5880; x_wconf 83' lang='eng' dir='ltr'>off</span> <span class='ocrx_word' id='word_1_515' title='bbox 1027 5860 1070 5880; x_wconf 92' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_516' title='bbox 1087 5850 1145 5880; x_wconf 82' lang='eng' dir='ltr'>off.</span> <span class='ocrx_word' id='word_1_517' title='bbox 1164 5851 1372 5890; x_wconf 91' lang='eng' dir='ltr'>Hyperproc-</span>
</span>
<span class='ocr_line' id='line_1_99' title="bbox 363 5906 1372 5950; baseline 0 -12; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_518' title='bbox 363 5918 450 5938; x_wconf 93' lang='eng' dir='ltr'>esses</span> <span class='ocrx_word' id='word_1_519' title='bbox 460 5908 575 5948; x_wconf 93' lang='eng' dir='ltr'>spread</span> <span class='ocrx_word' id='word_1_520' title='bbox 585 5908 651 5938; x_wconf 92' lang='eng' dir='ltr'>like</span> <span class='ocrx_word' id='word_1_521' title='bbox 664 5908 878 5938; x_wconf 91' lang='eng' dir='ltr'>Heraklitean</span> <span class='ocrx_word' id='word_1_522' title='bbox 888 5908 947 5938; x_wconf 95' lang='eng' dir='ltr'>fire</span> <span class='ocrx_word' id='word_1_523' title='bbox 956 5918 991 5938; x_wconf 95' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_524' title='bbox 1001 5918 1036 5938; x_wconf 95' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_525' title='bbox 1046 5918 1081 5938; x_wconf 95' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_526' title='bbox 1094 5906 1271 5950; x_wconf 92' lang='eng' dir='ltr'>(although</span> <span class='ocrx_word' id='word_1_527' title='bbox 1284 5908 1372 5938; x_wconf 95' lang='eng' dir='ltr'>there</span>
</span>
<span class='ocr_line' id='line_1_100' title="bbox 361 5962 1370 6003; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_528' title='bbox 361 5972 418 5992; x_wconf 94' lang='eng' dir='ltr'>are</span> <span class='ocrx_word' id='word_1_529' title='bbox 431 5972 476 5992; x_wconf 94' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_530' title='bbox 490 5962 660 6003; x_wconf 89' lang='eng' dir='ltr'>analogies</span> <span class='ocrx_word' id='word_1_531' title='bbox 675 5972 714 5992; x_wconf 94' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_532' title='bbox 728 5962 919 6002; x_wconf 91' lang='eng' dir='ltr'>metaphors</span> <span class='ocrx_word' id='word_1_533' title='bbox 935 5962 970 5992; x_wconf 94' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_534' title='bbox 984 5962 1069 6003; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_535' title='bbox 1085 5962 1171 6003; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_536' title='bbox 1186 5962 1270 6003; x_wconf 92' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_537' title='bbox 1287 5962 1370 6003; x_wconf 91' lang='eng' dir='ltr'>hype</span>
</span>
<span class='ocr_line' id='line_1_101' title="bbox 364 6019 594 6063; baseline 0.004 -13; x_size 42; x_descenders 10; x_ascenders 12"><span class='ocrx_word' id='word_1_538' title='bbox 364 6019 594 6063; x_wconf 92' lang='eng' dir='ltr'>hyperspace).</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_19' title="bbox 359 6079 1372 6939">
<span class='ocr_line' id='line_1_102' title="bbox 428 6079 1370 6120; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_539' title='bbox 428 6079 530 6120; x_wconf 89' lang='eng' dir='ltr'>Being</span> <span class='ocrx_word' id='word_1_540' title='bbox 538 6079 629 6109; x_wconf 93' lang='eng' dir='ltr'>CAG</span> <span class='ocrx_word' id='word_1_541' title='bbox 637 6079 729 6109; x_wconf 93' lang='eng' dir='ltr'>CAG</span> <span class='ocrx_word' id='word_1_542' title='bbox 738 6089 829 6120; x_wconf 90' lang='eng' dir='ltr'>cages</span> <span class='ocrx_word' id='word_1_543' title='bbox 841 6079 917 6109; x_wconf 96' lang='eng' dir='ltr'>flow</span> <span class='ocrx_word' id='word_1_544' title='bbox 927 6079 1035 6109; x_wconf 94' lang='eng' dir='ltr'>within</span> <span class='ocrx_word' id='word_1_545' title='bbox 1046 6089 1193 6120; x_wconf 90' lang='eng' dir='ltr'>memory.</span> <span class='ocrx_word' id='word_1_546' title='bbox 1206 6079 1370 6109; x_wconf 90' lang='eng' dir='ltr'>Function-</span>
</span>
<span class='ocr_line' id='line_1_103' title="bbox 364 6138 1372 6179; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_547' title='bbox 364 6138 421 6179; x_wconf 89' lang='eng' dir='ltr'>ing</span> <span class='ocrx_word' id='word_1_548' title='bbox 432 6148 466 6168; x_wconf 91' lang='eng' dir='ltr'>as</span> <span class='ocrx_word' id='word_1_549' title='bbox 478 6148 510 6168; x_wconf 94' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_550' title='bbox 522 6148 556 6168; x_wconf 94' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_551' title='bbox 568 6138 634 6168; x_wconf 94' lang='eng' dir='ltr'>real</span> <span class='ocrx_word' id='word_1_552' title='bbox 647 6138 887 6179; x_wconf 90' lang='eng' dir='ltr'>antiontology,</span> <span class='ocrx_word' id='word_1_553' title='bbox 899 6138 980 6168; x_wconf 94' lang='eng' dir='ltr'>viral</span> <span class='ocrx_word' id='word_1_554' title='bbox 993 6138 1133 6168; x_wconf 91' lang='eng' dir='ltr'>amnesia</span> <span class='ocrx_word' id='word_1_555' title='bbox 1146 6138 1372 6179; x_wconf 89' lang='eng' dir='ltr'>machinically</span>
</span>
<span class='ocr_line' id='line_1_104' title="bbox 364 6196 1370 6237; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_556' title='bbox 364 6196 496 6226; x_wconf 91' lang='eng' dir='ltr'>realizes</span> <span class='ocrx_word' id='word_1_557' title='bbox 516 6196 583 6226; x_wconf 94' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_558' title='bbox 602 6196 764 6226; x_wconf 92' lang='eng' dir='ltr'>dissolves</span> <span class='ocrx_word' id='word_1_559' title='bbox 784 6196 965 6237; x_wconf 89' lang='eng' dir='ltr'>biological</span> <span class='ocrx_word' id='word_1_560' title='bbox 982 6196 1370 6226; x_wconf 65' lang='eng' dir='ltr'>TGACTCACI&#39;ITAC-</span>
</span>
<span class='ocr_line' id='line_1_105' title="bbox 364 6254 1369 6290; baseline 0 -6; x_size 36; x_descenders 6; x_ascenders 8"><span class='ocrx_word' id='word_1_561' title='bbox 364 6254 549 6290; x_wconf 76' lang='eng' dir='ltr'>CGA&#39;ITG,</span> <span class='ocrx_word' id='word_1_562' title='bbox 559 6254 707 6290; x_wconf 90' lang='eng' dir='ltr'>cultural,</span> <span class='ocrx_word' id='word_1_563' title='bbox 718 6254 784 6284; x_wconf 91' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_564' title='bbox 794 6254 953 6284; x_wconf 91' lang='eng' dir='ltr'>technical</span> <span class='ocrx_word' id='word_1_565' title='bbox 963 6262 1369 6284; x_wconf 91' lang='eng'>010110100100010110100</span>
</span>
<span class='ocr_line' id='line_1_106' title="bbox 364 6313 1368 6343; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_566' title='bbox 364 6321 1031 6343; x_wconf 93' lang='eng'>101001001011101001010100100100100</span> <span class='ocrx_word' id='word_1_567' title='bbox 1038 6313 1181 6343; x_wconf 92' lang='eng' dir='ltr'>mnemic</span> <span class='ocrx_word' id='word_1_568' title='bbox 1189 6319 1368 6343; x_wconf 89' lang='eng' dir='ltr'>structures:</span>
</span>
<span class='ocr_line' id='line_1_107' title="bbox 363 6371 1369 6412; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_569' title='bbox 363 6371 598 6412; x_wconf 90' lang='eng' dir='ltr'>chopping-up</span> <span class='ocrx_word' id='word_1_570' title='bbox 618 6371 1038 6412; x_wconf 90' lang='eng' dir='ltr'>hierarchic-generational</span> <span class='ocrx_word' id='word_1_571' title='bbox 1056 6371 1288 6412; x_wconf 92' lang='eng' dir='ltr'>descendency,</span> <span class='ocrx_word' id='word_1_572' title='bbox 1307 6371 1369 6402; x_wconf 89' lang='eng' dir='ltr'>col-</span>
</span>
<span class='ocr_line' id='line_1_108' title="bbox 364 6430 1370 6471; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_573' title='bbox 364 6430 495 6471; x_wconf 89' lang='eng' dir='ltr'>lapsing</span> <span class='ocrx_word' id='word_1_574' title='bbox 505 6430 743 6471; x_wconf 89' lang='eng' dir='ltr'>phylogenetic</span> <span class='ocrx_word' id='word_1_575' title='bbox 756 6430 799 6460; x_wconf 97' lang='eng' dir='ltr'>tic</span> <span class='ocrx_word' id='word_1_576' title='bbox 812 6430 1024 6460; x_wconf 89' lang='eng' dir='ltr'>frozen-code</span> <span class='ocrx_word' id='word_1_577' title='bbox 1037 6430 1107 6460; x_wconf 94' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_578' title='bbox 1119 6436 1291 6471; x_wconf 90' lang='eng' dir='ltr'>ontogeny,</span> <span class='ocrx_word' id='word_1_579' title='bbox 1304 6430 1370 6460; x_wconf 94' lang='eng' dir='ltr'>and</span>
</span>
<span class='ocr_line' id='line_1_109' title="bbox 364 6488 1369 6529; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_580' title='bbox 364 6488 639 6529; x_wconf 90' lang='eng' dir='ltr'>immanentizing</span> <span class='ocrx_word' id='word_1_581' title='bbox 659 6488 713 6518; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_582' title='bbox 730 6494 805 6528; x_wconf 92' lang='eng' dir='ltr'>past</span> <span class='ocrx_word' id='word_1_583' title='bbox 825 6494 860 6518; x_wconf 96' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_584' title='bbox 878 6488 1045 6528; x_wconf 91' lang='eng' dir='ltr'>operative</span> <span class='ocrx_word' id='word_1_585' title='bbox 1064 6494 1202 6518; x_wconf 87' lang='eng' dir='ltr'>current.</span> <span class='ocrx_word' id='word_1_586' title='bbox 1223 6489 1265 6518; x_wconf 93' lang='eng' dir='ltr'>Its</span> <span class='ocrx_word' id='word_1_587' title='bbox 1285 6498 1369 6518; x_wconf 90' lang='eng' dir='ltr'>com-</span>
</span>
<span class='ocr_line' id='line_1_110' title="bbox 363 6547 1371 6588; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_588' title='bbox 363 6547 498 6587; x_wconf 94' lang='eng' dir='ltr'>petitive</span> <span class='ocrx_word' id='word_1_589' title='bbox 511 6547 723 6588; x_wconf 86' lang='eng' dir='ltr'>just-in-time</span> <span class='ocrx_word' id='word_1_590' title='bbox 741 6547 955 6577; x_wconf 92' lang='eng' dir='ltr'>innovations</span> <span class='ocrx_word' id='word_1_591' title='bbox 973 6547 1078 6577; x_wconf 96' lang='eng' dir='ltr'>delete</span> <span class='ocrx_word' id='word_1_592' title='bbox 1096 6553 1224 6588; x_wconf 89' lang='eng' dir='ltr'>storage</span> <span class='ocrx_word' id='word_1_593' title='bbox 1240 6547 1298 6577; x_wconf 93' lang='eng' dir='ltr'>CA</span> <span class='ocrx_word' id='word_1_594' title='bbox 1312 6547 1371 6577; x_wconf 95' lang='eng' dir='ltr'>CA</span>
</span>
<span class='ocr_line' id='line_1_111' title="bbox 364 6605 1369 6646; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_595' title='bbox 364 6605 517 6645; x_wconf 92' lang='eng' dir='ltr'>capacity,</span> <span class='ocrx_word' id='word_1_596' title='bbox 529 6605 576 6635; x_wconf 89' lang='eng' dir='ltr'>flu</span> <span class='ocrx_word' id='word_1_597' title='bbox 587 6605 632 6635; x_wconf 90' lang='eng' dir='ltr'>flu</span> <span class='ocrx_word' id='word_1_598' title='bbox 643 6605 689 6635; x_wconf 89' lang='eng' dir='ltr'>flu</span> <span class='ocrx_word' id='word_1_599' title='bbox 700 6605 849 6635; x_wconf 94' lang='eng' dir='ltr'>fluidizin</span> <span class='ocrx_word' id='word_1_600' title='bbox 851 6615 874 6646; x_wconf 90' lang='eng' dir='ltr'>g</span> <span class='ocrx_word' id='word_1_601' title='bbox 882 6605 1045 6646; x_wconf 89' lang='eng' dir='ltr'>energetic</span> <span class='ocrx_word' id='word_1_602' title='bbox 1054 6605 1119 6635; x_wconf 94' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_603' title='bbox 1128 6605 1369 6635; x_wconf 87' lang='eng' dir='ltr'>informational</span>
</span>
<span class='ocr_line' id='line_1_112' title="bbox 364 6663 1369 6703; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_604' title='bbox 364 6663 474 6693; x_wconf 92' lang='eng' dir='ltr'>stocks</span> <span class='ocrx_word' id='word_1_605' title='bbox 488 6663 560 6693; x_wconf 94' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_606' title='bbox 573 6663 642 6693; x_wconf 94' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_607' title='bbox 654 6663 722 6693; x_wconf 94' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_608' title='bbox 734 6673 772 6693; x_wconf 94' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_609' title='bbox 785 6663 854 6693; x_wconf 94' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_610' title='bbox 866 6663 934 6693; x_wconf 94' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_611' title='bbox 946 6673 984 6693; x_wconf 94' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_612' title='bbox 996 6663 1280 6703; x_wconf 92' lang='eng' dir='ltr'>orphan-vampire</span> <span class='ocrx_word' id='word_1_613' title='bbox 1290 6673 1324 6693; x_wconf 94' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_614' title='bbox 1337 6673 1369 6693; x_wconf 94' lang='eng' dir='ltr'>re</span>
</span>
<span class='ocr_line' id='line_1_113' title="bbox 365 6721 1370 6751; baseline 0 0; x_size 42.087334; x_descenders 12.087336; x_ascenders 8"><span class='ocrx_word' id='word_1_615' title='bbox 365 6721 556 6751; x_wconf 91' lang='eng' dir='ltr'>transversal</span> <span class='ocrx_word' id='word_1_616' title='bbox 566 6729 908 6751; x_wconf 91' lang='eng'>110111100010101010</span> <span class='ocrx_word' id='word_1_617' title='bbox 917 6721 963 6751; x_wconf 89' lang='eng' dir='ltr'>vir</span> <span class='ocrx_word' id='word_1_618' title='bbox 972 6721 1020 6751; x_wconf 91' lang='eng' dir='ltr'>vir</span> <span class='ocrx_word' id='word_1_619' title='bbox 1026 6721 1370 6751; x_wconf 85' lang='eng' dir='ltr'>virocommunication</span>
</span>
<span class='ocr_line' id='line_1_114' title="bbox 363 6778 1366 6822; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_620' title='bbox 363 6790 509 6820; x_wconf 92' lang='eng' dir='ltr'>process,</span> <span class='ocrx_word' id='word_1_621' title='bbox 529 6780 726 6821; x_wconf 89' lang='eng' dir='ltr'>expressing</span> <span class='ocrx_word' id='word_1_622' title='bbox 743 6790 761 6810; x_wconf 97' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_623' title='bbox 781 6780 914 6820; x_wconf 93' lang='eng' dir='ltr'>surplus</span> <span class='ocrx_word' id='word_1_624' title='bbox 934 6780 1028 6810; x_wconf 94' lang='eng' dir='ltr'>value</span> <span class='ocrx_word' id='word_1_625' title='bbox 1047 6780 1085 6810; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_626' title='bbox 1099 6780 1184 6810; x_wconf 96' lang='eng' dir='ltr'>code</span> <span class='ocrx_word' id='word_1_627' title='bbox 1203 6778 1366 6822; x_wconf 90' lang='eng' dir='ltr'>(content)</span>
</span>
<span class='ocr_line' id='line_1_115' title="bbox 364 6836 1367 6880; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_628' title='bbox 364 6848 398 6868; x_wconf 92' lang='eng' dir='ltr'>as</span> <span class='ocrx_word' id='word_1_629' title='bbox 417 6838 905 6878; x_wconf 94' lang='eng' dir='ltr'>xenoreplication-behaviour</span> <span class='ocrx_word' id='word_1_630' title='bbox 924 6836 1063 6880; x_wconf 94' lang='eng' dir='ltr'>(and/0r</span> <span class='ocrx_word' id='word_1_631' title='bbox 1079 6836 1284 6880; x_wconf 94' lang='eng' dir='ltr'>c0n(nective</span> <span class='ocrx_word' id='word_1_632' title='bbox 1302 6836 1367 6880; x_wconf 91' lang='eng' dir='ltr'>dis)</span>
</span>
<span class='ocr_line' id='line_1_116' title="bbox 359 6895 542 6939; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_633' title='bbox 359 6895 542 6939; x_wconf 86' lang='eng' dir='ltr'>junction).</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_20' title="bbox 362 6955 1377 8107">
<span class='ocr_line' id='line_1_117' title="bbox 425 6955 1366 6996; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_634' title='bbox 425 6956 468 6985; x_wconf 91' lang='eng' dir='ltr'>As</span> <span class='ocrx_word' id='word_1_635' title='bbox 478 6965 543 6985; x_wconf 94' lang='eng' dir='ltr'>war</span> <span class='ocrx_word' id='word_1_636' title='bbox 552 6955 710 6985; x_wconf 92' lang='eng' dir='ltr'>increases</span> <span class='ocrx_word' id='word_1_637' title='bbox 721 6955 753 6985; x_wconf 92' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_638' title='bbox 763 6955 797 6985; x_wconf 94' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_639' title='bbox 807 6955 840 6985; x_wconf 94' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_640' title='bbox 849 6955 1065 6996; x_wconf 90' lang='eng' dir='ltr'>intelligence,</span> <span class='ocrx_word' id='word_1_641' title='bbox 1074 6955 1097 6985; x_wconf 98' lang='eng' dir='ltr'>it</span> <span class='ocrx_word' id='word_1_642' title='bbox 1106 6955 1254 6985; x_wconf 92' lang='eng' dir='ltr'>becomes</span> <span class='ocrx_word' id='word_1_643' title='bbox 1265 6955 1366 6985; x_wconf 87' lang='eng' dir='ltr'>softer.</span>
</span>
<span class='ocr_line' id='line_1_118' title="bbox 367 7014 1369 7055; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_644' title='bbox 367 7015 412 7055; x_wconf 92' lang='eng' dir='ltr'>By</span> <span class='ocrx_word' id='word_1_645' title='bbox 423 7014 571 7055; x_wconf 89' lang='eng' dir='ltr'>trashing</span> <span class='ocrx_word' id='word_1_646' title='bbox 582 7014 666 7044; x_wconf 94' lang='eng' dir='ltr'>their</span> <span class='ocrx_word' id='word_1_647' title='bbox 676 7014 766 7044; x_wconf 92' lang='eng' dir='ltr'>hosts</span> <span class='ocrx_word' id='word_1_648' title='bbox 779 7014 877 7044; x_wconf 94' lang='eng' dir='ltr'>crude</span> <span class='ocrx_word' id='word_1_649' title='bbox 888 7014 1011 7044; x_wconf 93' lang='eng' dir='ltr'>viruses</span> <span class='ocrx_word' id='word_1_650' title='bbox 1023 7014 1181 7044; x_wconf 88' lang='eng' dir='ltr'>feedback</span> <span class='ocrx_word' id='word_1_651' title='bbox 1189 7014 1369 7055; x_wconf 89' lang='eng' dir='ltr'>negatively</span>
</span>
<span class='ocr_line' id='line_1_119' title="bbox 365 7071 1367 7112; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_652' title='bbox 365 7081 459 7111; x_wconf 94' lang='eng' dir='ltr'>upon</span> <span class='ocrx_word' id='word_1_653' title='bbox 477 7071 684 7107; x_wconf 92' lang='eng' dir='ltr'>themselves,</span> <span class='ocrx_word' id='word_1_654' title='bbox 703 7071 930 7112; x_wconf 89' lang='eng' dir='ltr'>autolimiting</span> <span class='ocrx_word' id='word_1_655' title='bbox 949 7071 1028 7101; x_wconf 94' lang='eng' dir='ltr'>their</span> <span class='ocrx_word' id='word_1_656' title='bbox 1045 7081 1143 7112; x_wconf 89' lang='eng' dir='ltr'>range</span> <span class='ocrx_word' id='word_1_657' title='bbox 1160 7071 1198 7101; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_658' title='bbox 1211 7081 1243 7101; x_wconf 94' lang='eng' dir='ltr'>re</span> <span class='ocrx_word' id='word_1_659' title='bbox 1259 7081 1367 7112; x_wconf 91' lang='eng' dir='ltr'>regen-</span>
</span>
<span class='ocr_line' id='line_1_120' title="bbox 364 7130 1368 7170; baseline -0.001 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_660' title='bbox 364 7130 484 7160; x_wconf 94' lang='eng' dir='ltr'>erative</span> <span class='ocrx_word' id='word_1_661' title='bbox 501 7130 719 7160; x_wconf 90' lang='eng' dir='ltr'>infilitration.</span> <span class='ocrx_word' id='word_1_662' title='bbox 739 7130 847 7170; x_wconf 92' lang='eng' dir='ltr'>Crazy</span> <span class='ocrx_word' id='word_1_663' title='bbox 861 7130 999 7160; x_wconf 92' lang='eng' dir='ltr'>vandals</span> <span class='ocrx_word' id='word_1_664' title='bbox 1017 7130 1079 7160; x_wconf 93' lang='eng' dir='ltr'>like</span> <span class='ocrx_word' id='word_1_665' title='bbox 1097 7130 1201 7160; x_wconf 90' lang='eng' dir='ltr'>Ebola</span> <span class='ocrx_word' id='word_1_666' title='bbox 1217 7130 1368 7161; x_wconf 90' lang='eng' dir='ltr'>CGCGT</span>
</span>
<span class='ocr_line' id='line_1_121' title="bbox 364 7187 1366 7231; baseline 0 -12; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_667' title='bbox 364 7189 1222 7219; x_wconf 78' lang='eng' dir='ltr'>GAGCAATCGGACTCGGCTGCTGTGC&#39;ITG</span> <span class='ocrx_word' id='word_1_668' title='bbox 1238 7187 1366 7231; x_wconf 92' lang='eng' dir='ltr'>(bodies</span>
</span>
<span class='ocr_line' id='line_1_122' title="bbox 364 7245 1367 7289; baseline 0 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_669' title='bbox 364 7247 533 7277; x_wconf 92' lang='eng' dir='ltr'>dissolved</span> <span class='ocrx_word' id='word_1_670' title='bbox 543 7247 679 7287; x_wconf 92' lang='eng' dir='ltr'>quickly</span> <span class='ocrx_word' id='word_1_671' title='bbox 688 7247 760 7277; x_wconf 94' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_672' title='bbox 772 7245 879 7289; x_wconf 92' lang='eng' dir='ltr'>slime)</span> <span class='ocrx_word' id='word_1_673' title='bbox 891 7245 992 7277; x_wconf 78' lang='eng' dir='ltr'>aren’t</span> <span class='ocrx_word' id='word_1_674' title='bbox 1000 7257 1077 7277; x_wconf 94' lang='eng' dir='ltr'>ever</span> <span class='ocrx_word' id='word_1_675' title='bbox 1083 7247 1186 7288; x_wconf 89' lang='eng' dir='ltr'>going</span> <span class='ocrx_word' id='word_1_676' title='bbox 1197 7253 1229 7277; x_wconf 96' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_677' title='bbox 1239 7247 1333 7277; x_wconf 85' lang='eng' dir='ltr'>make</span> <span class='ocrx_word' id='word_1_678' title='bbox 1342 7247 1367 7277; x_wconf 98' lang='eng' dir='ltr'>it</span>
</span>
<span class='ocr_line' id='line_1_123' title="bbox 364 7304 1367 7345; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_679' title='bbox 364 7304 428 7345; x_wconf 90' lang='eng' dir='ltr'>big.</span> <span class='ocrx_word' id='word_1_680' title='bbox 439 7304 581 7334; x_wconf 93' lang='eng' dir='ltr'>General</span> <span class='ocrx_word' id='word_1_681' title='bbox 589 7304 748 7344; x_wconf 94' lang='eng' dir='ltr'>principle</span> <span class='ocrx_word' id='word_1_682' title='bbox 758 7304 810 7334; x_wconf 89' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_683' title='bbox 816 7304 895 7334; x_wconf 94' lang='eng' dir='ltr'>viral</span> <span class='ocrx_word' id='word_1_684' title='bbox 906 7304 1079 7334; x_wconf 89' lang='eng' dir='ltr'>take-overs</span> <span class='ocrx_word' id='word_1_685' title='bbox 1088 7304 1121 7334; x_wconf 94' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_686' title='bbox 1129 7304 1184 7334; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_687' title='bbox 1191 7304 1301 7334; x_wconf 86' lang='eng' dir='ltr'>media:</span> <span class='ocrx_word' id='word_1_688' title='bbox 1312 7304 1367 7334; x_wconf 96' lang='eng' dir='ltr'>the</span>
</span>
<span class='ocr_line' id='line_1_124' title="bbox 362 7363 1366 7404; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_689' title='bbox 362 7373 455 7393; x_wconf 92' lang='eng' dir='ltr'>more</span> <span class='ocrx_word' id='word_1_690' title='bbox 464 7363 746 7403; x_wconf 92' lang='eng' dir='ltr'>unsophisticated</span> <span class='ocrx_word' id='word_1_691' title='bbox 755 7363 810 7393; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_692' title='bbox 819 7363 1007 7404; x_wconf 89' lang='eng' dir='ltr'>contagion,</span> <span class='ocrx_word' id='word_1_693' title='bbox 1016 7363 1071 7393; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_694' title='bbox 1079 7363 1190 7404; x_wconf 90' lang='eng' dir='ltr'>bigger</span> <span class='ocrx_word' id='word_1_695' title='bbox 1200 7363 1250 7393; x_wconf 90' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_696' title='bbox 1259 7363 1366 7403; x_wconf 89' lang='eng' dir='ltr'>splash</span>
</span>
<span class='ocr_line' id='line_1_125' title="bbox 366 7419 1367 7463; baseline 0 -12; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_697' title='bbox 366 7419 614 7463; x_wconf 89' lang='eng' dir='ltr'>(diversionary</span> <span class='ocrx_word' id='word_1_698' title='bbox 634 7421 750 7451; x_wconf 92' lang='eng' dir='ltr'>tactics</span> <span class='ocrx_word' id='word_1_699' title='bbox 770 7419 965 7463; x_wconf 94' lang='eng' dir='ltr'>excepted).</span> <span class='ocrx_word' id='word_1_700' title='bbox 986 7421 1367 7451; x_wconf 82' lang='eng' dir='ltr'>CAGCTACGCTATT</span>
</span>
<span class='ocr_line' id='line_1_126' title="bbox 365 7479 1366 7509; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_701' title='bbox 365 7479 1366 7509; x_wconf 90' lang='eng' dir='ltr'>CTCCGAGGCTAGATTGCAGCTACGTCGCATCG</span>
</span>
<span class='ocr_line' id='line_1_127' title="bbox 364 7543 1377 7573; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_702' title='bbox 364 7543 1377 7573; x_wconf 77' lang='eng' dir='ltr'>GGCTGACCGATGTAGGTCATGAATCTACCGA’IT</span>
</span>
<span class='ocr_line' id='line_1_128' title="bbox 364 7601 1377 7632; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_703' title='bbox 364 7601 1377 7632; x_wconf 85' lang='eng' dir='ltr'>GCACATGACTTATCCACGGTCTATTCCTCGAT</span>
</span>
<span class='ocr_line' id='line_1_129' title="bbox 365 7660 1373 7690; baseline 0 0; x_size 42.336521; x_descenders 11.282458; x_ascenders 10.51901"><span class='ocrx_word' id='word_1_704' title='bbox 365 7660 717 7690; x_wconf 90' lang='eng' dir='ltr'>GATCGCATCGGG</span> <span class='ocrx_word' id='word_1_705' title='bbox 720 7660 777 7690; x_wconf 92' lang='eng' dir='ltr'>CT</span> <span class='ocrx_word' id='word_1_706' title='bbox 777 7660 1248 7690; x_wconf 89' lang='eng' dir='ltr'>GACCGATGGCATCGTA</span> <span class='ocrx_word' id='word_1_707' title='bbox 1253 7660 1373 7690; x_wconf 88' lang='eng' dir='ltr'>COPY.</span>
</span>
<span class='ocr_line' id='line_1_130' title="bbox 365 7717 1375 7759; baseline -0.001 -10; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_708' title='bbox 365 7719 462 7749; x_wconf 89' lang='eng' dir='ltr'>CUT.</span> <span class='ocrx_word' id='word_1_709' title='bbox 478 7718 615 7748; x_wconf 86' lang='eng' dir='ltr'>PASTE.</span> <span class='ocrx_word' id='word_1_710' title='bbox 632 7718 748 7748; x_wconf 92' lang='eng' dir='ltr'>Subtle</span> <span class='ocrx_word' id='word_1_711' title='bbox 761 7718 886 7748; x_wconf 91' lang='eng' dir='ltr'>viruses</span> <span class='ocrx_word' id='word_1_712' title='bbox 900 7728 953 7748; x_wconf 93' lang='eng' dir='ltr'>are</span> <span class='ocrx_word' id='word_1_713' title='bbox 968 7718 1056 7755; x_wconf 92' lang='eng' dir='ltr'>slow,</span> <span class='ocrx_word' id='word_1_714' title='bbox 1071 7718 1228 7759; x_wconf 90' lang='eng' dir='ltr'>synergic,</span> <span class='ocrx_word' id='word_1_715' title='bbox 1245 7717 1375 7748; x_wconf 87' lang='eng' dir='ltr'>flexible</span>
</span>
<span class='ocr_line' id='line_1_131' title="bbox 365 7777 1374 7818; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_716' title='bbox 365 7777 432 7807; x_wconf 89' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_717' title='bbox 452 7777 585 7807; x_wconf 86' lang='eng' dir='ltr'>elusive.</span> <span class='ocrx_word' id='word_1_718' title='bbox 606 7777 697 7818; x_wconf 90' lang='eng' dir='ltr'>They</span> <span class='ocrx_word' id='word_1_719' title='bbox 716 7783 856 7807; x_wconf 90' lang='eng' dir='ltr'>execute</span> <span class='ocrx_word' id='word_1_720' title='bbox 876 7777 1036 7807; x_wconf 92' lang='eng' dir='ltr'>sensitive</span> <span class='ocrx_word' id='word_1_721' title='bbox 1056 7777 1276 7807; x_wconf 89' lang='eng' dir='ltr'>behavioural</span> <span class='ocrx_word' id='word_1_722' title='bbox 1296 7787 1374 7807; x_wconf 90' lang='eng' dir='ltr'>con-</span>
</span>
<span class='ocr_line' id='line_1_132' title="bbox 367 7834 1374 7875; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_723' title='bbox 367 7834 426 7864; x_wconf 94' lang='eng' dir='ltr'>trol</span> <span class='ocrx_word' id='word_1_724' title='bbox 442 7834 513 7864; x_wconf 89' lang='eng' dir='ltr'>that</span> <span class='ocrx_word' id='word_1_725' title='bbox 523 7834 684 7875; x_wconf 92' lang='eng' dir='ltr'>prolongs</span> <span class='ocrx_word' id='word_1_726' title='bbox 700 7834 754 7864; x_wconf 95' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_727' title='bbox 769 7834 824 7864; x_wconf 93' lang='eng' dir='ltr'>life</span> <span class='ocrx_word' id='word_1_728' title='bbox 838 7834 877 7864; x_wconf 93' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_729' title='bbox 889 7834 944 7864; x_wconf 95' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_730' title='bbox 959 7834 1183 7864; x_wconf 91' lang='eng' dir='ltr'>biomachinic</span> <span class='ocrx_word' id='word_1_731' title='bbox 1198 7844 1374 7871; x_wconf 91' lang='eng' dir='ltr'>resources,</span>
</span>
<span class='ocr_line' id='line_1_133' title="bbox 366 7892 1375 7933; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_732' title='bbox 366 7892 553 7922; x_wconf 92' lang='eng' dir='ltr'>maximizes</span> <span class='ocrx_word' id='word_1_733' title='bbox 562 7892 810 7932; x_wconf 92' lang='eng' dir='ltr'>opportunities</span> <span class='ocrx_word' id='word_1_734' title='bbox 820 7892 872 7922; x_wconf 93' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_735' title='bbox 879 7892 1118 7933; x_wconf 92' lang='eng' dir='ltr'>propogation,</span> <span class='ocrx_word' id='word_1_736' title='bbox 1129 7892 1299 7922; x_wconf 91' lang='eng' dir='ltr'>infiltrates</span> <span class='ocrx_word' id='word_1_737' title='bbox 1309 7892 1375 7922; x_wconf 92' lang='eng' dir='ltr'>and</span>
</span>
<span class='ocr_line' id='line_1_134' title="bbox 365 7951 1374 7992; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_738' title='bbox 365 7951 508 7981; x_wconf 93' lang='eng' dir='ltr'>disables</span> <span class='ocrx_word' id='word_1_739' title='bbox 526 7951 643 7981; x_wconf 94' lang='eng' dir='ltr'>hostile</span> <span class='ocrx_word' id='word_1_740' title='bbox 663 7951 806 7992; x_wconf 91' lang='eng' dir='ltr'>security</span> <span class='ocrx_word' id='word_1_741' title='bbox 824 7957 973 7992; x_wconf 94' lang='eng' dir='ltr'>systems,</span> <span class='ocrx_word' id='word_1_742' title='bbox 993 7951 1060 7981; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_743' title='bbox 1080 7951 1271 7981; x_wconf 91' lang='eng' dir='ltr'>feeds-back</span> <span class='ocrx_word' id='word_1_744' title='bbox 1287 7951 1374 7991; x_wconf 88' lang='eng' dir='ltr'>posi-</span>
</span>
<span class='ocr_line' id='line_1_135' title="bbox 367 8009 1376 8039; baseline 0 0; x_size 40.988487; x_descenders 10.988487; x_ascenders 10"><span class='ocrx_word' id='word_1_745' title='bbox 367 8009 428 8039; x_wconf 94' lang='eng' dir='ltr'>tive</span> <span class='ocrx_word' id='word_1_746' title='bbox 446 8020 608 8037; x_wconf 91' lang='eng'>-+-++-+-++</span> <span class='ocrx_word' id='word_1_747' title='bbox 625 8009 659 8039; x_wconf 88' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_748' title='bbox 675 8009 708 8039; x_wconf 92' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_749' title='bbox 724 8009 758 8039; x_wconf 92' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_750' title='bbox 774 8009 971 8039; x_wconf 89' lang='eng' dir='ltr'>innovation</span> <span class='ocrx_word' id='word_1_751' title='bbox 987 8009 1247 8039; x_wconf 91' lang='eng' dir='ltr'>technoscience.</span> <span class='ocrx_word' id='word_1_752' title='bbox 1267 8010 1305 8039; x_wconf 88' lang='eng' dir='ltr'>In</span> <span class='ocrx_word' id='word_1_753' title='bbox 1321 8009 1376 8039; x_wconf 94' lang='eng' dir='ltr'>the</span>
</span>
<span class='ocr_line' id='line_1_136' title="bbox 366 8064 1372 8107; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_754' title='bbox 366 8066 614 8103; x_wconf 91' lang='eng' dir='ltr'>macroversion,</span> <span class='ocrx_word' id='word_1_755' title='bbox 628 8076 646 8096; x_wconf 95' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_756' title='bbox 658 8075 706 8096; x_wconf 83' lang='eng' dir='ltr'>VR</span> <span class='ocrx_word' id='word_1_757' title='bbox 718 8076 800 8107; x_wconf 93' lang='eng' dir='ltr'>prey</span> <span class='ocrx_word' id='word_1_758' title='bbox 812 8066 933 8096; x_wconf 92' lang='eng' dir='ltr'>animal</span> <span class='ocrx_word' id='word_1_759' title='bbox 948 8066 1006 8096; x_wconf 95' lang='eng' dir='ltr'>hid</span> <span class='ocrx_word' id='word_1_760' title='bbox 1020 8066 1054 8096; x_wconf 88' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_761' title='bbox 1068 8066 1108 8096; x_wconf 92' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_762' title='bbox 1121 8064 1263 8107; x_wconf 79' lang='eng' dir='ltr'>enemy’s</span> <span class='ocrx_word' id='word_1_763' title='bbox 1276 8066 1372 8096; x_wconf 95' lang='eng' dir='ltr'>head.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_21' title="bbox 367 8124 1377 8924">
<span class='ocr_line' id='line_1_137' title="bbox 426 8124 1377 8165; baseline 0.001 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_764' title='bbox 426 8124 532 8154; x_wconf 92' lang='eng' dir='ltr'>When</span> <span class='ocrx_word' id='word_1_765' title='bbox 545 8124 687 8165; x_wconf 89' lang='eng' dir='ltr'>hunting</span> <span class='ocrx_word' id='word_1_766' title='bbox 699 8124 751 8154; x_wconf 93' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_767' title='bbox 761 8124 849 8165; x_wconf 93' lang='eng' dir='ltr'>hype</span> <span class='ocrx_word' id='word_1_768' title='bbox 861 8124 1056 8165; x_wconf 93' lang='eng' dir='ltr'>hypervirus</span> <span class='ocrx_word' id='word_1_769' title='bbox 1068 8124 1148 8154; x_wconf 94' lang='eng' dir='ltr'>look</span> <span class='ocrx_word' id='word_1_770' title='bbox 1158 8124 1204 8154; x_wconf 94' lang='eng' dir='ltr'>0k</span> <span class='ocrx_word' id='word_1_771' title='bbox 1215 8124 1258 8154; x_wconf 97' lang='eng' dir='ltr'>0k</span> <span class='ocrx_word' id='word_1_772' title='bbox 1269 8124 1314 8154; x_wconf 94' lang='eng' dir='ltr'>ok</span> <span class='ocrx_word' id='word_1_773' title='bbox 1325 8124 1377 8154; x_wconf 93' lang='eng' dir='ltr'>for</span>
</span>
<span class='ocr_line' id='line_1_138' title="bbox 367 8182 1374 8225; baseline -0.002 -11; x_size 41; x_descenders 11; x_ascenders 9"><span class='ocrx_word' id='word_1_774' title='bbox 367 8184 404 8214; x_wconf 89' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_775' title='bbox 416 8184 559 8225; x_wconf 91' lang='eng' dir='ltr'>primary</span> <span class='ocrx_word' id='word_1_776' title='bbox 569 8184 644 8214; x_wconf 93' lang='eng' dir='ltr'>host</span> <span class='ocrx_word' id='word_1_777' title='bbox 655 8184 793 8224; x_wconf 90' lang='eng' dir='ltr'>species,</span> <span class='ocrx_word' id='word_1_778' title='bbox 804 8184 912 8214; x_wconf 90' lang='eng' dir='ltr'>which</span> <span class='ocrx_word' id='word_1_779' title='bbox 924 8184 990 8214; x_wconf 94' lang='eng' dir='ltr'>will</span> <span class='ocrx_word' id='word_1_780' title='bbox 1004 8184 1043 8214; x_wconf 91' lang='eng' dir='ltr'>be</span> <span class='ocrx_word' id='word_1_781' title='bbox 1057 8182 1268 8224; x_wconf 85' lang='eng' dir='ltr'>undergoing</span> <span class='ocrx_word' id='word_1_782' title='bbox 1280 8183 1374 8224; x_wconf 88' lang='eng' dir='ltr'>logis-</span>
</span>
<span class='ocr_line' id='line_1_139' title="bbox 367 8241 1375 8282; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_783' title='bbox 367 8241 440 8271; x_wconf 90' lang='eng' dir='ltr'>tical</span> <span class='ocrx_word' id='word_1_784' title='bbox 454 8241 644 8271; x_wconf 93' lang='eng' dir='ltr'>behavioral</span> <span class='ocrx_word' id='word_1_785' title='bbox 659 8241 914 8281; x_wconf 90' lang='eng' dir='ltr'>sophistication</span> <span class='ocrx_word' id='word_1_786' title='bbox 932 8241 1073 8271; x_wconf 92' lang='eng' dir='ltr'>indexed</span> <span class='ocrx_word' id='word_1_787' title='bbox 1092 8241 1135 8282; x_wconf 96' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_788' title='bbox 1149 8251 1191 8271; x_wconf 92' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_789' title='bbox 1207 8241 1375 8281; x_wconf 93' lang='eng' dir='ltr'>explosive</span>
</span>
<span class='ocr_line' id='line_1_140' title="bbox 368 8300 1374 8341; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_790' title='bbox 368 8300 505 8330; x_wconf 91' lang='eng' dir='ltr'>increase</span> <span class='ocrx_word' id='word_1_791' title='bbox 518 8300 552 8330; x_wconf 88' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_792' title='bbox 562 8300 839 8330; x_wconf 90' lang='eng' dir='ltr'>communicative</span> <span class='ocrx_word' id='word_1_793' title='bbox 850 8300 1013 8341; x_wconf 92' lang='eng' dir='ltr'>intensity,</span> <span class='ocrx_word' id='word_1_794' title='bbox 1025 8300 1228 8340; x_wconf 92' lang='eng' dir='ltr'>population</span> <span class='ocrx_word' id='word_1_795' title='bbox 1238 8300 1374 8341; x_wconf 92' lang='eng' dir='ltr'>density,</span>
</span>
<span class='ocr_line' id='line_1_141' title="bbox 367 8358 1375 8399; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_796' title='bbox 367 8358 473 8388; x_wconf 92' lang='eng' dir='ltr'>sexual</span> <span class='ocrx_word' id='word_1_797' title='bbox 482 8358 761 8399; x_wconf 92' lang='eng' dir='ltr'>disorganisation,</span> <span class='ocrx_word' id='word_1_798' title='bbox 771 8358 908 8388; x_wconf 90' lang='eng' dir='ltr'>cultural</span> <span class='ocrx_word' id='word_1_799' title='bbox 917 8358 1135 8399; x_wconf 91' lang='eng' dir='ltr'>promiscuity,</span> <span class='ocrx_word' id='word_1_800' title='bbox 1144 8358 1209 8388; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_801' title='bbox 1220 8358 1375 8388; x_wconf 90' lang='eng' dir='ltr'>technical</span>
</span>
<span class='ocr_line' id='line_1_142' title="bbox 367 8415 1376 8459; baseline 0 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_802' title='bbox 367 8417 427 8447; x_wconf 94' lang='eng' dir='ltr'>sub</span> <span class='ocrx_word' id='word_1_803' title='bbox 437 8417 498 8447; x_wconf 93' lang='eng' dir='ltr'>sub</span> <span class='ocrx_word' id='word_1_804' title='bbox 508 8417 732 8447; x_wconf 92' lang='eng' dir='ltr'>subtilization</span> <span class='ocrx_word' id='word_1_805' title='bbox 743 8415 892 8459; x_wconf 92' lang='eng' dir='ltr'>(leading</span> <span class='ocrx_word' id='word_1_806' title='bbox 902 8423 936 8447; x_wconf 94' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_807' title='bbox 945 8417 1205 8458; x_wconf 91' lang='eng' dir='ltr'>neurogenomic</span> <span class='ocrx_word' id='word_1_808' title='bbox 1215 8417 1376 8447; x_wconf 91' lang='eng' dir='ltr'>feedback</span>
</span>
<span class='ocr_line' id='line_1_143' title="bbox 367 8474 1377 8515; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_809' title='bbox 367 8474 431 8504; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_810' title='bbox 450 8474 653 8504; x_wconf 88' lang='eng' dir='ltr'>fluidization</span> <span class='ocrx_word' id='word_1_811' title='bbox 671 8484 717 8504; x_wconf 92' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_812' title='bbox 733 8474 785 8504; x_wconf 82' lang='eng' dir='ltr'>off</span> <span class='ocrx_word' id='word_1_813' title='bbox 798 8484 844 8504; x_wconf 89' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_814' title='bbox 861 8474 912 8504; x_wconf 82' lang='eng' dir='ltr'>off</span> <span class='ocrx_word' id='word_1_815' title='bbox 925 8474 976 8504; x_wconf 82' lang='eng' dir='ltr'>off</span> <span class='ocrx_word' id='word_1_816' title='bbox 989 8484 1035 8504; x_wconf 92' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_817' title='bbox 1052 8474 1091 8504; x_wconf 93' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_818' title='bbox 1104 8474 1147 8504; x_wconf 95' lang='eng' dir='ltr'>all</span> <span class='ocrx_word' id='word_1_819' title='bbox 1165 8474 1377 8515; x_wconf 87' lang='eng' dir='ltr'>hard-wiring</span>
</span>
<span class='ocr_line' id='line_1_144' title="bbox 367 8531 1376 8575; baseline 0 -12; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_820' title='bbox 367 8533 437 8563; x_wconf 92' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_821' title='bbox 456 8533 525 8563; x_wconf 92' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_822' title='bbox 543 8533 731 8574; x_wconf 89' lang='eng' dir='ltr'>cybernetic</span> <span class='ocrx_word' id='word_1_823' title='bbox 751 8531 883 8575; x_wconf 91' lang='eng' dir='ltr'>fluxes).</span> <span class='ocrx_word' id='word_1_824' title='bbox 901 8533 976 8574; x_wconf 89' lang='eng' dir='ltr'>Any</span> <span class='ocrx_word' id='word_1_825' title='bbox 994 8533 1094 8573; x_wconf 92' lang='eng' dir='ltr'>plane</span> <span class='ocrx_word' id='word_1_826' title='bbox 1112 8533 1227 8573; x_wconf 89' lang='eng' dir='ltr'>planet</span> <span class='ocrx_word' id='word_1_827' title='bbox 1245 8539 1301 8563; x_wconf 92' lang='eng' dir='ltr'>net</span> <span class='ocrx_word' id='word_1_828' title='bbox 1318 8539 1376 8563; x_wconf 92' lang='eng' dir='ltr'>net</span>
</span>
<span class='ocr_line' id='line_1_145' title="bbox 367 8591 1376 8632; baseline 0.001 -12; x_size 41; x_descenders 11; x_ascenders 8"><span class='ocrx_word' id='word_1_829' title='bbox 367 8599 820 8621; x_wconf 91' lang='eng'>00011011010010010101011</span> <span class='ocrx_word' id='word_1_830' title='bbox 832 8591 968 8632; x_wconf 87' lang='eng' dir='ltr'>hosting</span> <span class='ocrx_word' id='word_1_831' title='bbox 977 8591 1063 8621; x_wconf 90' lang='eng' dir='ltr'>such</span> <span class='ocrx_word' id='word_1_832' title='bbox 1073 8601 1115 8621; x_wconf 90' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_833' title='bbox 1126 8597 1223 8621; x_wconf 92' lang='eng' dir='ltr'>event</span> <span class='ocrx_word' id='word_1_834' title='bbox 1233 8591 1259 8621; x_wconf 92' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_835' title='bbox 1271 8591 1376 8621; x_wconf 90' lang='eng' dir='ltr'>about</span>
</span>
<span class='ocr_line' id='line_1_146' title="bbox 368 8648 1376 8692; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_836' title='bbox 368 8656 401 8680; x_wconf 97' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_837' title='bbox 412 8649 470 8690; x_wconf 88' lang='eng' dir='ltr'>flip</span> <span class='ocrx_word' id='word_1_838' title='bbox 479 8660 561 8680; x_wconf 93' lang='eng' dir='ltr'>over.</span> <span class='ocrx_word' id='word_1_839' title='bbox 573 8650 684 8680; x_wconf 92' lang='eng' dir='ltr'>CATA</span> <span class='ocrx_word' id='word_1_840' title='bbox 693 8650 915 8690; x_wconf 91' lang='eng' dir='ltr'>catastrophic</span> <span class='ocrx_word' id='word_1_841' title='bbox 925 8650 1163 8680; x_wconf 92' lang='eng' dir='ltr'>OKOOKOK</span> <span class='ocrx_word' id='word_1_842' title='bbox 1174 8650 1241 8680; x_wconf 93' lang='eng' dir='ltr'>OK</span> <span class='ocrx_word' id='word_1_843' title='bbox 1251 8660 1326 8680; x_wconf 93' lang='eng' dir='ltr'>zero</span> <span class='ocrx_word' id='word_1_844' title='bbox 1338 8648 1376 8692; x_wconf 93' lang='eng'>(0</span>
</span>
<span class='ocr_line' id='line_1_147' title="bbox 369 8706 1375 8751; baseline 0 -13; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_845' title='bbox 369 8706 431 8750; x_wconf 93' lang='eng' dir='ltr'>(or</span> <span class='ocrx_word' id='word_1_846' title='bbox 443 8706 488 8751; x_wconf 90' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_847' title='bbox 501 8706 514 8750; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_848' title='bbox 527 8706 554 8750; x_wconf 93' lang='eng'>))</span> <span class='ocrx_word' id='word_1_849' title='bbox 570 8706 598 8750; x_wconf 89' lang='eng'>((</span> <span class='ocrx_word' id='word_1_850' title='bbox 612 8706 624 8750; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_851' title='bbox 638 8706 650 8750; x_wconf 94' lang='eng'>)</span> <span class='ocrx_word' id='word_1_852' title='bbox 666 8706 679 8750; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_853' title='bbox 694 8706 721 8750; x_wconf 93' lang='eng'>))</span> <span class='ocrx_word' id='word_1_854' title='bbox 737 8706 748 8750; x_wconf 93' lang='eng'>)</span> <span class='ocrx_word' id='word_1_855' title='bbox 762 8706 835 8750; x_wconf 89' lang='eng' dir='ltr'>o°))</span> <span class='ocrx_word' id='word_1_856' title='bbox 848 8708 977 8738; x_wconf 87' lang='eng' dir='ltr'>K-virus</span> <span class='ocrx_word' id='word_1_857' title='bbox 989 8708 1057 8738; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_858' title='bbox 1070 8706 1156 8750; x_wconf 90' lang='eng' dir='ltr'>(RT)</span> <span class='ocrx_word' id='word_1_859' title='bbox 1171 8708 1375 8748; x_wconf 89' lang='eng' dir='ltr'>retroscripts</span>
</span>
<span class='ocr_line' id='line_1_148' title="bbox 369 8764 1374 8809; baseline 0 -13; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_860' title='bbox 369 8765 490 8809; x_wconf 93' lang='eng' dir='ltr'>(Kobe,</span> <span class='ocrx_word' id='word_1_861' title='bbox 504 8766 626 8807; x_wconf 93' lang='eng' dir='ltr'>Tokyo,</span> <span class='ocrx_word' id='word_1_862' title='bbox 643 8766 836 8796; x_wconf 93' lang='eng' dir='ltr'>Oklahoma</span> <span class='ocrx_word' id='word_1_863' title='bbox 854 8764 1010 8808; x_wconf 93' lang='eng' dir='ltr'>(Koresh,</span> <span class='ocrx_word' id='word_1_864' title='bbox 1028 8764 1227 8808; x_wconf 92' lang='eng' dir='ltr'>Koernke)).</span> <span class='ocrx_word' id='word_1_865' title='bbox 1244 8766 1374 8806; x_wconf 93' lang='eng' dir='ltr'>Apoka-</span>
</span>
<span class='ocr_line' id='line_1_149' title="bbox 368 8822 1375 8865; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_866' title='bbox 368 8824 459 8865; x_wconf 92' lang='eng' dir='ltr'>lypse</span> <span class='ocrx_word' id='word_1_867' title='bbox 478 8824 596 8864; x_wconf 92' lang='eng' dir='ltr'>spread</span> <span class='ocrx_word' id='word_1_868' title='bbox 615 8824 660 8865; x_wconf 96' lang='eng' dir='ltr'>by</span> <span class='ocrx_word' id='word_1_869' title='bbox 681 8824 734 8854; x_wconf 94' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_870' title='bbox 756 8824 838 8854; x_wconf 91' lang='eng' dir='ltr'>coke</span> <span class='ocrx_word' id='word_1_871' title='bbox 859 8824 1026 8854; x_wconf 89' lang='eng' dir='ltr'>machine.</span> <span class='ocrx_word' id='word_1_872' title='bbox 1046 8822 1267 8854; x_wconf 83' lang='eng' dir='ltr'>Tomorrow’s</span> <span class='ocrx_word' id='word_1_873' title='bbox 1286 8834 1375 8854; x_wconf 88' lang='eng' dir='ltr'>news</span>
</span>
<span class='ocr_line' id='line_1_150' title="bbox 367 8884 858 8924; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_874' title='bbox 367 8884 529 8924; x_wconf 93' lang='eng' dir='ltr'>brews-up</span> <span class='ocrx_word' id='word_1_875' title='bbox 541 8884 575 8914; x_wconf 88' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_876' title='bbox 587 8884 706 8921; x_wconf 93' lang='eng' dir='ltr'>Korea,</span> <span class='ocrx_word' id='word_1_877' title='bbox 721 8884 858 8914; x_wconf 92' lang='eng' dir='ltr'>Kosovo</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_22' title="bbox 367 8941 1379 9101">
<span class='ocr_line' id='line_1_151' title="bbox 429 8941 1379 8982; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_878' title='bbox 429 8941 598 8982; x_wconf 92' lang='eng' dir='ltr'>Climbing</span> <span class='ocrx_word' id='word_1_879' title='bbox 615 8947 676 8971; x_wconf 94' lang='eng' dir='ltr'>out</span> <span class='ocrx_word' id='word_1_880' title='bbox 692 8941 734 8971; x_wconf 93' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_881' title='bbox 748 8951 766 8971; x_wconf 95' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_882' title='bbox 785 8941 1053 8971; x_wconf 90' lang='eng' dir='ltr'>recombination</span> <span class='ocrx_word' id='word_1_883' title='bbox 1072 8947 1251 8981; x_wconf 93' lang='eng' dir='ltr'>apparatus</span> <span class='ocrx_word' id='word_1_884' title='bbox 1269 8941 1307 8971; x_wconf 93' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_885' title='bbox 1322 8941 1379 8971; x_wconf 92' lang='eng' dir='ltr'>TA</span>
</span>
<span class='ocr_line' id='line_1_152' title="bbox 367 9001 1375 9042; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_886' title='bbox 367 9001 420 9031; x_wconf 92' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_887' title='bbox 434 9001 488 9031; x_wconf 92' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_888' title='bbox 504 9001 759 9041; x_wconf 91' lang='eng' dir='ltr'>tape-recorders</span> <span class='ocrx_word' id='word_1_889' title='bbox 778 9001 841 9031; x_wconf 92' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_890' title='bbox 859 9007 1004 9041; x_wconf 90' lang='eng' dir='ltr'>cut-ups,</span> <span class='ocrx_word' id='word_1_891' title='bbox 1021 9001 1215 9042; x_wconf 93' lang='eng' dir='ltr'>hypervirus</span> <span class='ocrx_word' id='word_1_892' title='bbox 1231 9001 1375 9031; x_wconf 91' lang='eng' dir='ltr'>infected</span>
</span>
<span class='ocr_line' id='line_1_153' title="bbox 369 9057 1375 9101; baseline 0 -12; x_size 43; x_descenders 11; x_ascenders 12"><span class='ocrx_word' id='word_1_893' title='bbox 369 9059 556 9100; x_wconf 93' lang='eng' dir='ltr'>Burroughs</span> <span class='ocrx_word' id='word_1_894' title='bbox 571 9059 605 9089; x_wconf 92' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_895' title='bbox 621 9067 706 9100; x_wconf 83' lang='eng'>1972,</span> <span class='ocrx_word' id='word_1_896' title='bbox 723 9065 757 9089; x_wconf 95' lang='eng' dir='ltr'>at</span> <span class='ocrx_word' id='word_1_897' title='bbox 772 9059 828 9089; x_wconf 94' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_898' title='bbox 843 9069 925 9099; x_wconf 91' lang='eng' dir='ltr'>cusp</span> <span class='ocrx_word' id='word_1_899' title='bbox 941 9059 980 9089; x_wconf 93' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_900' title='bbox 993 9057 1340 9101; x_wconf 83' lang='eng' dir='ltr'>K(ondratieff)-wave</span> <span class='ocrx_word' id='word_1_901' title='bbox 1355 9067 1375 9100; x_wconf 85' lang='eng'><em>9</em></span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_3' title="bbox 362 9127 1374 10513">
<p class='ocr_par' dir='ltr' id='par_1_23' title="bbox 362 9127 1374 9803">
<span class='ocr_line' id='line_1_154' title="bbox 365 9127 1374 9172; baseline 0 -13; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_902' title='bbox 365 9127 435 9172; x_wconf 94' lang='eng' dir='ltr'>(the</span> <span class='ocrx_word' id='word_1_903' title='bbox 448 9129 620 9159; x_wconf 93' lang='eng' dir='ltr'>threshold</span> <span class='ocrx_word' id='word_1_904' title='bbox 632 9129 669 9159; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_905' title='bbox 677 9128 974 9172; x_wconf 92' lang='eng' dir='ltr'>postmodernity).</span> <span class='ocrx_word' id='word_1_906' title='bbox 990 9130 1015 9159; x_wconf 95' lang='eng' dir='ltr'>It</span> <span class='ocrx_word' id='word_1_907' title='bbox 1027 9129 1155 9169; x_wconf 92' lang='eng' dir='ltr'>rapidly</span> <span class='ocrx_word' id='word_1_908' title='bbox 1164 9129 1374 9169; x_wconf 89' lang='eng' dir='ltr'>reprocessed</span>
</span>
<span class='ocr_line' id='line_1_155' title="bbox 364 9189 1374 9230; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_909' title='bbox 364 9189 405 9219; x_wconf 94' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_910' title='bbox 420 9195 523 9230; x_wconf 94' lang='eng' dir='ltr'>target</span> <span class='ocrx_word' id='word_1_911' title='bbox 536 9189 610 9219; x_wconf 93' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_912' title='bbox 623 9199 667 9219; x_wconf 93' lang='eng' dir='ltr'>an</span> <span class='ocrx_word' id='word_1_913' title='bbox 681 9189 884 9230; x_wconf 93' lang='eng' dir='ltr'>intelligenic</span> <span class='ocrx_word' id='word_1_914' title='bbox 900 9199 944 9219; x_wconf 93' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_915' title='bbox 955 9199 1013 9229; x_wconf 93' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_916' title='bbox 1024 9199 1079 9229; x_wconf 91' lang='eng' dir='ltr'>yes</span> <span class='ocrx_word' id='word_1_917' title='bbox 1094 9199 1138 9219; x_wconf 93' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_918' title='bbox 1153 9199 1197 9219; x_wconf 93' lang='eng' dir='ltr'>no</span> <span class='ocrx_word' id='word_1_919' title='bbox 1212 9199 1374 9219; x_wconf 90' lang='eng' dir='ltr'>nova-war</span>
</span>
<span class='ocr_line' id='line_1_156' title="bbox 365 9246 1372 9287; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_920' title='bbox 365 9246 561 9286; x_wconf 91' lang='eng' dir='ltr'>laboratory,</span> <span class='ocrx_word' id='word_1_921' title='bbox 570 9246 779 9287; x_wconf 93' lang='eng' dir='ltr'>volatilizing</span> <span class='ocrx_word' id='word_1_922' title='bbox 788 9246 842 9276; x_wconf 94' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_923' title='bbox 854 9246 980 9286; x_wconf 92' lang='eng' dir='ltr'>history</span> <span class='ocrx_word' id='word_1_924' title='bbox 988 9246 1026 9276; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_925' title='bbox 1032 9246 1194 9287; x_wconf 93' lang='eng' dir='ltr'>language</span> <span class='ocrx_word' id='word_1_926' title='bbox 1204 9246 1275 9276; x_wconf 93' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_927' title='bbox 1284 9246 1372 9276; x_wconf 92' lang='eng' dir='ltr'>invo-</span>
</span>
<span class='ocr_line' id='line_1_157' title="bbox 364 9305 1370 9346; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_928' title='bbox 364 9305 530 9345; x_wconf 91' lang='eng' dir='ltr'>lutionary</span> <span class='ocrx_word' id='word_1_929' title='bbox 539 9305 745 9335; x_wconf 94' lang='eng' dir='ltr'>word-virus.</span> <span class='ocrx_word' id='word_1_930' title='bbox 759 9305 931 9335; x_wconf 93' lang='eng' dir='ltr'>Mutation</span> <span class='ocrx_word' id='word_1_931' title='bbox 941 9311 990 9335; x_wconf 95' lang='eng' dir='ltr'>rat</span> <span class='ocrx_word' id='word_1_932' title='bbox 1000 9311 1047 9335; x_wconf 95' lang='eng' dir='ltr'>rat</span> <span class='ocrx_word' id='word_1_933' title='bbox 1058 9311 1106 9335; x_wconf 95' lang='eng' dir='ltr'>rat</span> <span class='ocrx_word' id='word_1_934' title='bbox 1116 9311 1164 9335; x_wconf 95' lang='eng' dir='ltr'>rat</span> <span class='ocrx_word' id='word_1_935' title='bbox 1175 9311 1259 9335; x_wconf 94' lang='eng' dir='ltr'>rates</span> <span class='ocrx_word' id='word_1_936' title='bbox 1264 9305 1370 9346; x_wconf 80' lang='eng' dir='ltr'>jump.</span>
</span>
<span class='ocr_line' id='line_1_158' title="bbox 362 9363 1373 9404; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_937' title='bbox 362 9364 479 9393; x_wconf 94' lang='eng' dir='ltr'>Vector</span> <span class='ocrx_word' id='word_1_938' title='bbox 498 9363 650 9393; x_wconf 94' lang='eng' dir='ltr'>switches</span> <span class='ocrx_word' id='word_1_939' title='bbox 670 9363 817 9404; x_wconf 94' lang='eng' dir='ltr'>through</span> <span class='ocrx_word' id='word_1_940' title='bbox 838 9363 958 9400; x_wconf 94' lang='eng' dir='ltr'>Butler,</span> <span class='ocrx_word' id='word_1_941' title='bbox 977 9363 1117 9400; x_wconf 93' lang='eng' dir='ltr'>Gibson,</span> <span class='ocrx_word' id='word_1_942' title='bbox 1136 9363 1206 9393; x_wconf 93' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_943' title='bbox 1222 9363 1373 9404; x_wconf 92' lang='eng' dir='ltr'>Cadigan</span>
</span>
<span class='ocr_line' id='line_1_159' title="bbox 364 9422 1371 9463; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_944' title='bbox 364 9422 523 9452; x_wconf 93' lang='eng' dir='ltr'>fine-tune</span> <span class='ocrx_word' id='word_1_945' title='bbox 540 9422 581 9452; x_wconf 94' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_946' title='bbox 596 9422 750 9463; x_wconf 92' lang='eng' dir='ltr'>synergic</span> <span class='ocrx_word' id='word_1_947' title='bbox 765 9422 1039 9459; x_wconf 90' lang='eng' dir='ltr'>interexcitation,</span> <span class='ocrx_word' id='word_1_948' title='bbox 1057 9422 1169 9462; x_wconf 93' lang='eng' dir='ltr'>silt-up</span> <span class='ocrx_word' id='word_1_949' title='bbox 1185 9422 1371 9462; x_wconf 90' lang='eng' dir='ltr'>cybershift-</span>
</span>
<span class='ocr_line' id='line_1_160' title="bbox 364 9478 1370 9523; baseline 0 -13; x_size 42; x_descenders 12; x_ascenders 10"><span class='ocrx_word' id='word_1_950' title='bbox 364 9480 527 9521; x_wconf 93' lang='eng' dir='ltr'>inducing</span> <span class='ocrx_word' id='word_1_951' title='bbox 543 9478 887 9523; x_wconf 89' lang='eng' dir='ltr'>K(uang)-potential,</span> <span class='ocrx_word' id='word_1_952' title='bbox 905 9480 972 9510; x_wconf 93' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_953' title='bbox 988 9480 1171 9510; x_wconf 92' lang='eng' dir='ltr'>trend-lock</span> <span class='ocrx_word' id='word_1_954' title='bbox 1184 9486 1267 9510; x_wconf 93' lang='eng' dir='ltr'>onto</span> <span class='ocrx_word' id='word_1_955' title='bbox 1284 9488 1370 9511; x_wconf 85' lang='eng'>11001</span>
</span>
<span class='ocr_line' id='line_1_161' title="bbox 364 9547 1371 9569; baseline 0.001 -1; x_size 41.848484; x_descenders 10.848485; x_ascenders 10.450311"><span class='ocrx_word' id='word_1_956' title='bbox 364 9547 1371 9569; x_wconf 91' lang='eng'>01001001010111101001011101011001000100010100100010</span>
</span>
<span class='ocr_line' id='line_1_162' title="bbox 364 9606 1371 9628; baseline 0 0; x_size 41.848484; x_descenders 10.848485; x_ascenders 10.450311"><span class='ocrx_word' id='word_1_957' title='bbox 364 9606 1371 9628; x_wconf 94' lang='eng'>01001001001001010010110100100100100100100100111010</span>
</span>
<span class='ocr_line' id='line_1_163' title="bbox 364 9656 1371 9696; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 9"><span class='ocrx_word' id='word_1_958' title='bbox 364 9665 1011 9686; x_wconf 97' lang='eng'>0100100100011001000101100101010</span> <span class='ocrx_word' id='word_1_959' title='bbox 1026 9656 1157 9696; x_wconf 88' lang='eng' dir='ltr'>K-punk</span> <span class='ocrx_word' id='word_1_960' title='bbox 1168 9656 1281 9696; x_wconf 91' lang='eng' dir='ltr'>pulses</span> <span class='ocrx_word' id='word_1_961' title='bbox 1291 9656 1371 9686; x_wconf 94' lang='eng' dir='ltr'>with</span>
</span>
<span class='ocr_line' id='line_1_164' title="bbox 365 9714 1372 9755; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_962' title='bbox 365 9714 828 9755; x_wconf 93' lang='eng' dir='ltr'>telematically-accelerating</span> <span class='ocrx_word' id='word_1_963' title='bbox 839 9714 1077 9754; x_wconf 93' lang='eng' dir='ltr'>neoreplicator</span> <span class='ocrx_word' id='word_1_964' title='bbox 1086 9714 1225 9754; x_wconf 93' lang='eng' dir='ltr'>plicator</span> <span class='ocrx_word' id='word_1_965' title='bbox 1234 9714 1372 9754; x_wconf 93' lang='eng' dir='ltr'>plicator</span>
</span>
<span class='ocr_line' id='line_1_165' title="bbox 363 9773 639 9803; baseline 0 0; x_size 40.558296; x_descenders 10.558295; x_ascenders 10"><span class='ocrx_word' id='word_1_966' title='bbox 363 9773 639 9803; x_wconf 93' lang='eng' dir='ltr'>contamination.</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_24' title="bbox 362 9828 1370 10095">
<span class='ocr_line' id='line_1_166' title="bbox 428 9828 1370 9872; baseline 0.001 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_967' title='bbox 428 9828 595 9872; x_wconf 78' lang='eng' dir='ltr'>‘Looking</span> <span class='ocrx_word' id='word_1_968' title='bbox 605 9831 661 9861; x_wconf 95' lang='eng' dir='ltr'>for</span> <span class='ocrx_word' id='word_1_969' title='bbox 672 9841 691 9861; x_wconf 94' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_970' title='bbox 705 9831 753 9861; x_wconf 96' lang='eng' dir='ltr'>hit</span> <span class='ocrx_word' id='word_1_971' title='bbox 766 9831 805 9861; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_972' title='bbox 815 9829 1032 9861; x_wconf 81' lang='eng' dir='ltr'>snowcrash?’</span> <span class='ocrx_word' id='word_1_973' title='bbox 1045 9835 1065 9861; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_974' title='bbox 1077 9835 1138 9861; x_wconf 47' lang='eng' dir='ltr'>Wit</span> <span class='ocrx_word' id='word_1_975' title='bbox 1149 9835 1169 9861; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_976' title='bbox 1202 9835 1244 9861; x_wconf 72' lang='eng'>##</span> <span class='ocrx_word' id='word_1_977' title='bbox 1267 9836 1284 9861; x_wconf 74' lang='eng'>#</span> <span class='ocrx_word' id='word_1_978' title='bbox 1306 9836 1326 9862; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_979' title='bbox 1350 9836 1370 9862; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_167' title="bbox 362 9894 1370 9920; baseline 0 0; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_980' title='bbox 362 9894 446 9920; x_wconf 72' lang='eng'>###</span> <span class='ocrx_word' id='word_1_981' title='bbox 478 9894 849 9920; x_wconf 55' lang='eng' dir='ltr'>##W########</span> <span class='ocrx_word' id='word_1_982' title='bbox 882 9894 988 9920; x_wconf 44' lang='eng'>##1##</span> <span class='ocrx_word' id='word_1_983' title='bbox 1040 9894 1204 9920; x_wconf 69' lang='eng'>######</span> <span class='ocrx_word' id='word_1_984' title='bbox 1247 9894 1267 9920; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_985' title='bbox 1296 9894 1317 9920; x_wconf 70' lang='eng'>#</span> <span class='ocrx_word' id='word_1_986' title='bbox 1350 9894 1370 9920; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_168' title="bbox 362 9952 1369 9979; baseline 0 -1; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_987' title='bbox 362 9952 467 9978; x_wconf 70' lang='eng'>####</span> <span class='ocrx_word' id='word_1_988' title='bbox 502 9952 522 9978; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_989' title='bbox 557 9952 663 9978; x_wconf 54' lang='eng'>##1##</span> <span class='ocrx_word' id='word_1_990' title='bbox 697 9952 717 9978; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_991' title='bbox 752 9952 772 9978; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_992' title='bbox 807 9952 827 9978; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_993' title='bbox 861 9952 968 9978; x_wconf 71' lang='eng'>###</span> <span class='ocrx_word' id='word_1_994' title='bbox 1002 9952 1242 9978; x_wconf 71' lang='eng'>#######</span> <span class='ocrx_word' id='word_1_995' title='bbox 1275 9954 1293 9978; x_wconf 73' lang='eng'>#</span> <span class='ocrx_word' id='word_1_996' title='bbox 1349 9953 1369 9979; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_169' title="bbox 363 10011 1370 10037; baseline 0 0; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_997' title='bbox 363 10011 529 10037; x_wconf 71' lang='eng'>#######</span> <span class='ocrx_word' id='word_1_998' title='bbox 585 10011 732 10037; x_wconf 64' lang='eng'>#####=#</span> <span class='ocrx_word' id='word_1_999' title='bbox 798 10011 840 10037; x_wconf 70' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1000' title='bbox 861 10011 1008 10037; x_wconf 69' lang='eng'>#####</span> <span class='ocrx_word' id='word_1_1001' title='bbox 1040 10011 1080 10037; x_wconf 70' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1002' title='bbox 1112 10011 1132 10037; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1003' title='bbox 1185 10011 1205 10037; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1004' title='bbox 1238 10011 1370 10037; x_wconf 68' lang='eng'>#####</span>
</span>
<span class='ocr_line' id='line_1_170' title="bbox 362 10069 1191 10095; baseline 0 0; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_1005' title='bbox 362 10069 446 10095; x_wconf 71' lang='eng'>###</span> <span class='ocrx_word' id='word_1_1006' title='bbox 480 10069 1002 10095; x_wconf 70' lang='eng'>###############</span> <span class='ocrx_word' id='word_1_1007' title='bbox 1044 10069 1084 10095; x_wconf 70' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1008' title='bbox 1117 10069 1137 10095; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1009' title='bbox 1170 10069 1191 10095; x_wconf 70' lang='eng'>#</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_25' title="bbox 362 10123 1370 10513">
<span class='ocr_line' id='line_1_171' title="bbox 424 10123 1369 10163; baseline 0.001 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_1010' title='bbox 424 10123 469 10153; x_wconf 90' lang='eng' dir='ltr'>As</span> <span class='ocrx_word' id='word_1_1011' title='bbox 478 10123 699 10163; x_wconf 93' lang='eng' dir='ltr'>postmodern</span> <span class='ocrx_word' id='word_1_1012' title='bbox 708 10123 834 10153; x_wconf 94' lang='eng' dir='ltr'>culture</span> <span class='ocrx_word' id='word_1_1013' title='bbox 844 10133 967 10153; x_wconf 94' lang='eng' dir='ltr'>crosses</span> <span class='ocrx_word' id='word_1_1014' title='bbox 978 10129 1011 10153; x_wconf 97' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_1015' title='bbox 1020 10123 1228 10163; x_wconf 90' lang='eng' dir='ltr'>hypermania</span> <span class='ocrx_word' id='word_1_1016' title='bbox 1239 10123 1297 10153; x_wconf 91' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_1017' title='bbox 1307 10128 1369 10154; x_wconf 51' lang='eng'>##1##</span>
</span>
<span class='ocr_line' id='line_1_172' title="bbox 362 10186 1370 10213; baseline 0 -1; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_1018' title='bbox 362 10186 1288 10212; x_wconf 56' lang='eng' dir='ltr'>######################W#</span> <span class='ocrx_word' id='word_1_1019' title='bbox 1350 10187 1370 10213; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_173' title="bbox 363 10244 1368 10270; baseline 0 0; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_1020' title='bbox 363 10244 384 10270; x_wconf 70' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1021' title='bbox 416 10244 510 10270; x_wconf 71' lang='eng'>####</span> <span class='ocrx_word' id='word_1_1022' title='bbox 544 10244 779 10270; x_wconf 69' lang='eng'>#######</span> <span class='ocrx_word' id='word_1_1023' title='bbox 814 10244 834 10270; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1024' title='bbox 868 10244 1314 10270; x_wconf 56' lang='eng' dir='ltr'>##########W#</span> <span class='ocrx_word' id='word_1_1025' title='bbox 1348 10244 1368 10270; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_174' title="bbox 363 10302 1369 10329; baseline 0 -1; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_1026' title='bbox 363 10302 941 10328; x_wconf 68' lang='eng'>#################</span> <span class='ocrx_word' id='word_1_1027' title='bbox 983 10302 1043 10328; x_wconf 71' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1028' title='bbox 1084 10302 1104 10328; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1029' title='bbox 1146 10302 1305 10328; x_wconf 43' lang='eng' dir='ltr'>##fitfi</span> <span class='ocrx_word' id='word_1_1030' title='bbox 1349 10303 1369 10329; x_wconf 72' lang='eng'>#</span>
</span>
<span class='ocr_line' id='line_1_175' title="bbox 362 10361 1369 10387; baseline 0 0; x_size 35.098728; x_descenders 9.0987291; x_ascenders 8.7647762"><span class='ocrx_word' id='word_1_1031' title='bbox 362 10361 476 10387; x_wconf 72' lang='eng'>#####</span> <span class='ocrx_word' id='word_1_1032' title='bbox 533 10361 574 10387; x_wconf 72' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1033' title='bbox 594 10361 738 10387; x_wconf 56' lang='eng'>######</span> <span class='ocrx_word' id='word_1_1034' title='bbox 777 10361 827 10387; x_wconf 71' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1035' title='bbox 847 10361 868 10387; x_wconf 70' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1036' title='bbox 888 10361 949 10387; x_wconf 51' lang='eng' dir='ltr'><em>W</em></span> <span class='ocrx_word' id='word_1_1037' title='bbox 969 10361 1009 10387; x_wconf 70' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1038' title='bbox 1036 10361 1076 10387; x_wconf 70' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1039' title='bbox 1104 10361 1124 10387; x_wconf 72' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1040' title='bbox 1143 10361 1251 10387; x_wconf 71' lang='eng'>####</span> <span class='ocrx_word' id='word_1_1041' title='bbox 1270 10361 1369 10387; x_wconf 69' lang='eng'>####</span>
</span>
<span class='ocr_line' id='line_1_176' title="bbox 362 10414 1368 10455; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_1042' title='bbox 362 10418 383 10444; x_wconf 70' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1043' title='bbox 395 10420 472 10454; x_wconf 92' lang='eng' dir='ltr'>stop</span> <span class='ocrx_word' id='word_1_1044' title='bbox 484 10420 561 10454; x_wconf 92' lang='eng' dir='ltr'>stop</span> <span class='ocrx_word' id='word_1_1045' title='bbox 573 10424 618 10455; x_wconf 94' lang='eng' dir='ltr'>go</span> <span class='ocrx_word' id='word_1_1046' title='bbox 631 10420 708 10454; x_wconf 92' lang='eng' dir='ltr'>stop</span> <span class='ocrx_word' id='word_1_1047' title='bbox 720 10424 765 10455; x_wconf 94' lang='eng' dir='ltr'>go</span> <span class='ocrx_word' id='word_1_1048' title='bbox 778 10420 854 10454; x_wconf 92' lang='eng' dir='ltr'>stop</span> <span class='ocrx_word' id='word_1_1049' title='bbox 866 10424 912 10455; x_wconf 94' lang='eng' dir='ltr'>go</span> <span class='ocrx_word' id='word_1_1050' title='bbox 924 10424 968 10455; x_wconf 93' lang='eng' dir='ltr'>go</span> <span class='ocrx_word' id='word_1_1051' title='bbox 980 10424 1059 10455; x_wconf 94' lang='eng' dir='ltr'>goes</span> <span class='ocrx_word' id='word_1_1052' title='bbox 1073 10424 1163 10451; x_wconf 92' lang='eng' dir='ltr'>nova,</span> <span class='ocrx_word' id='word_1_1053' title='bbox 1179 10414 1201 10444; x_wconf 95' lang='eng' dir='ltr'>it</span> <span class='ocrx_word' id='word_1_1054' title='bbox 1214 10414 1368 10455; x_wconf 85' lang='eng' dir='ltr'>singular-</span>
</span>
<span class='ocr_line' id='line_1_177' title="bbox 364 10472 1370 10513; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_1055' title='bbox 364 10472 429 10502; x_wconf 94' lang='eng' dir='ltr'>izes</span> <span class='ocrx_word' id='word_1_1056' title='bbox 437 10472 675 10512; x_wconf 93' lang='eng' dir='ltr'>multiplicities</span> <span class='ocrx_word' id='word_1_1057' title='bbox 682 10472 772 10502; x_wconf 94' lang='eng' dir='ltr'>cities</span> <span class='ocrx_word' id='word_1_1058' title='bbox 782 10472 871 10502; x_wconf 94' lang='eng' dir='ltr'>cities</span> <span class='ocrx_word' id='word_1_1059' title='bbox 881 10472 919 10502; x_wconf 97' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_1060' title='bbox 926 10472 1095 10512; x_wconf 92' lang='eng' dir='ltr'>invasively</span> <span class='ocrx_word' id='word_1_1061' title='bbox 1103 10472 1370 10513; x_wconf 90' lang='eng' dir='ltr'>autoreplicating</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_4' title="bbox 364 10529 1370 10634">
<p class='ocr_par' dir='ltr' id='par_1_26' title="bbox 364 10529 1370 10634">
<span class='ocr_line' id='line_1_178' title="bbox 364 10529 1365 10575; baseline -0.002 -14; x_size 42; x_descenders 11; x_ascenders 11"><span class='ocrx_word' id='word_1_1062' title='bbox 364 10531 644 10572; x_wconf 93' lang='eng' dir='ltr'>autoreplicating</span> <span class='ocrx_word' id='word_1_1063' title='bbox 652 10531 897 10571; x_wconf 89' lang='eng' dir='ltr'>plexoweapon</span> <span class='ocrx_word' id='word_1_1064' title='bbox 908 10547 930 10551; x_wconf 98' lang='eng'><em>-</em></span> <span class='ocrx_word' id='word_1_1065' title='bbox 941 10537 1074 10571; x_wconf 93' lang='eng' dir='ltr'>systems</span> <span class='ocrx_word' id='word_1_1066' title='bbox 1086 10529 1138 10574; x_wconf 70' lang='eng'>(0</span> <span class='ocrx_word' id='word_1_1067' title='bbox 1152 10530 1163 10574; x_wconf 91' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1068' title='bbox 1175 10530 1244 10575; x_wconf 89' lang='eng'>((()</span> <span class='ocrx_word' id='word_1_1069' title='bbox 1258 10529 1298 10574; x_wconf 91' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_1070' title='bbox 1312 10529 1324 10574; x_wconf 92' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1071' title='bbox 1337 10530 1365 10575; x_wconf 86' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_179' title="bbox 365 10586 1370 10634; baseline -0.006 0; x_size 59.8125; x_descenders 15.8125; x_ascenders 15.8125"><span class='ocrx_word' id='word_1_1072' title='bbox 365 10587 420 10634; x_wconf 86' lang='eng'>())</span> <span class='ocrx_word' id='word_1_1073' title='bbox 435 10589 481 10634; x_wconf 90' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_1074' title='bbox 494 10589 506 10633; x_wconf 91' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1075' title='bbox 521 10587 550 10632; x_wconf 89' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1076' title='bbox 562 10588 601 10632; x_wconf 88' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1077' title='bbox 617 10587 629 10632; x_wconf 91' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1078' title='bbox 643 10586 722 10632; x_wconf 69' lang='eng' dir='ltr'>D»)</span> <span class='ocrx_word' id='word_1_1079' title='bbox 737 10587 749 10632; x_wconf 93' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1080' title='bbox 763 10588 776 10632; x_wconf 90' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1081' title='bbox 790 10587 802 10632; x_wconf 93' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1082' title='bbox 816 10586 862 10630; x_wconf 85' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1083' title='bbox 885 10586 898 10630; x_wconf 88' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1084' title='bbox 914 10587 982 10617; x_wconf 65' lang='eng' dir='ltr'>that</span> <span class='ocrx_word' id='word_1_1085' title='bbox 993 10597 1044 10617; x_wconf 66' lang='eng' dir='ltr'>are</span> <span class='ocrx_word' id='word_1_1086' title='bbox 1056 10597 1087 10617; x_wconf 70' lang='eng' dir='ltr'>r6</span> <span class='ocrx_word' id='word_1_1087' title='bbox 1098 10597 1130 10617; x_wconf 70' lang='eng' dir='ltr'>r6</span> <span class='ocrx_word' id='word_1_1088' title='bbox 1142 10597 1174 10617; x_wconf 70' lang='eng' dir='ltr'>r6</span> <span class='ocrx_word' id='word_1_1089' title='bbox 1185 10597 1216 10617; x_wconf 70' lang='eng' dir='ltr'>r6</span> <span class='ocrx_word' id='word_1_1090' title='bbox 1229 10587 1370 10628; x_wconf 72' lang='eng' dir='ltr'>nothing</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_5' title="bbox 360 10647 1376 11679">
<p class='ocr_par' dir='ltr' id='par_1_27' title="bbox 360 10647 1376 11679">
<span class='ocr_line' id='line_1_180' title="bbox 365 10647 1367 10688; baseline -0.001 -10; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_1091' title='bbox 365 10648 500 10688; x_wconf 92' lang='eng' dir='ltr'>beyond</span> <span class='ocrx_word' id='word_1_1092' title='bbox 516 10647 598 10677; x_wconf 94' lang='eng' dir='ltr'>their</span> <span class='ocrx_word' id='word_1_1093' title='bbox 611 10657 679 10677; x_wconf 94' lang='eng' dir='ltr'>war</span> <span class='ocrx_word' id='word_1_1094' title='bbox 689 10647 786 10677; x_wconf 94' lang='eng' dir='ltr'>AGA</span> <span class='ocrx_word' id='word_1_1095' title='bbox 792 10647 889 10677; x_wconf 94' lang='eng' dir='ltr'>AGA</span> <span class='ocrx_word' id='word_1_1096' title='bbox 900 10647 1027 10688; x_wconf 93' lang='eng' dir='ltr'>against</span> <span class='ocrx_word' id='word_1_1097' title='bbox 1040 10647 1181 10687; x_wconf 92' lang='eng' dir='ltr'>security.</span> <span class='ocrx_word' id='word_1_1098' title='bbox 1195 10647 1269 10677; x_wconf 88' lang='eng' dir='ltr'>This</span> <span class='ocrx_word' id='word_1_1099' title='bbox 1281 10647 1307 10677; x_wconf 95' lang='eng' dir='ltr'>is</span> <span class='ocrx_word' id='word_1_1100' title='bbox 1324 10657 1367 10677; x_wconf 93' lang='eng' dir='ltr'>no</span>
</span>
<span class='ocr_line' id='line_1_181' title="bbox 361 10706 1373 10747; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_1101' title='bbox 361 10706 478 10747; x_wconf 91' lang='eng' dir='ltr'>longer</span> <span class='ocrx_word' id='word_1_1102' title='bbox 487 10716 505 10736; x_wconf 97' lang='eng' dir='ltr'>a</span> <span class='ocrx_word' id='word_1_1103' title='bbox 514 10706 668 10746; x_wconf 90' lang='eng' dir='ltr'>question</span> <span class='ocrx_word' id='word_1_1104' title='bbox 677 10716 723 10736; x_wconf 94' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_1105' title='bbox 733 10706 785 10736; x_wconf 85' lang='eng' dir='ltr'>off</span> <span class='ocrx_word' id='word_1_1106' title='bbox 790 10716 837 10736; x_wconf 94' lang='eng' dir='ltr'>on</span> <span class='ocrx_word' id='word_1_1107' title='bbox 846 10706 885 10736; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_1108' title='bbox 892 10706 1092 10747; x_wconf 91' lang='eng' dir='ltr'>ideological</span> <span class='ocrx_word' id='word_1_1109' title='bbox 1103 10706 1373 10746; x_wconf 92' lang='eng' dir='ltr'>representation,</span>
</span>
<span class='ocr_line' id='line_1_182' title="bbox 361 10762 1375 10803; baseline 0 -11; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_1110' title='bbox 361 10772 567 10803; x_wconf 90' lang='eng' dir='ltr'>exogeneous</span> <span class='ocrx_word' id='word_1_1111' title='bbox 577 10762 723 10802; x_wconf 94' lang='eng' dir='ltr'>political</span> <span class='ocrx_word' id='word_1_1112' title='bbox 733 10762 972 10799; x_wconf 92' lang='eng' dir='ltr'>mobilization,</span> <span class='ocrx_word' id='word_1_1113' title='bbox 984 10762 1170 10792; x_wconf 94' lang='eng' dir='ltr'>theoretical</span> <span class='ocrx_word' id='word_1_1114' title='bbox 1180 10762 1326 10802; x_wconf 94' lang='eng' dir='ltr'>critique,</span> <span class='ocrx_word' id='word_1_1115' title='bbox 1335 10767 1375 10792; x_wconf 75' lang='eng'>##</span>
</span>
<span class='ocr_line' id='line_1_183' title="bbox 360 10826 1374 10851; baseline 0 0; x_size 34.235298; x_descenders 9.2352991; x_ascenders 8.5866337"><span class='ocrx_word' id='word_1_1116' title='bbox 360 10826 555 10851; x_wconf 74' lang='eng'>########</span> <span class='ocrx_word' id='word_1_1117' title='bbox 577 10826 597 10851; x_wconf 76' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1118' title='bbox 618 10826 1227 10851; x_wconf 64' lang='eng'>######################</span> <span class='ocrx_word' id='word_1_1119' title='bbox 1271 10826 1374 10851; x_wconf 73' lang='eng'>####</span>
</span>
<span class='ocr_line' id='line_1_184' title="bbox 361 10880 1373 10921; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_1120' title='bbox 361 10885 402 10911; x_wconf 73' lang='eng'>##</span> <span class='ocrx_word' id='word_1_1121' title='bbox 435 10885 455 10910; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1122' title='bbox 467 10885 487 10910; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1123' title='bbox 499 10885 519 10910; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1124' title='bbox 551 10885 571 10910; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1125' title='bbox 583 10885 603 10910; x_wconf 76' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1126' title='bbox 615 10885 677 10910; x_wconf 76' lang='eng'>###</span> <span class='ocrx_word' id='word_1_1127' title='bbox 734 10885 754 10910; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1128' title='bbox 777 10885 797 10910; x_wconf 77' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1129' title='bbox 844 10885 864 10910; x_wconf 76' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1130' title='bbox 876 10884 939 10910; x_wconf 54' lang='eng' dir='ltr'>#W</span> <span class='ocrx_word' id='word_1_1131' title='bbox 985 10885 1005 10910; x_wconf 76' lang='eng'>#</span> <span class='ocrx_word' id='word_1_1132' title='bbox 1018 10890 1057 10910; x_wconf 94' lang='eng' dir='ltr'>or</span> <span class='ocrx_word' id='word_1_1133' title='bbox 1070 10880 1222 10921; x_wconf 90' lang='eng' dir='ltr'>strategic</span> <span class='ocrx_word' id='word_1_1134' title='bbox 1235 10880 1373 10910; x_wconf 93' lang='eng' dir='ltr'>orienta-</span>
</span>
<span class='ocr_line' id='line_1_185' title="bbox 364 10938 1376 10979; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_1135' title='bbox 364 10938 443 10974; x_wconf 94' lang='eng' dir='ltr'>tion,</span> <span class='ocrx_word' id='word_1_1136' title='bbox 456 10938 516 10968; x_wconf 94' lang='eng' dir='ltr'>but</span> <span class='ocrx_word' id='word_1_1137' title='bbox 528 10938 564 10968; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_1138' title='bbox 573 10938 818 10968; x_wconf 94' lang='eng' dir='ltr'>decentralized</span> <span class='ocrx_word' id='word_1_1139' title='bbox 829 10938 971 10968; x_wconf 94' lang='eng' dir='ltr'>cultural</span> <span class='ocrx_word' id='word_1_1140' title='bbox 983 10938 1148 10979; x_wconf 90' lang='eng' dir='ltr'>diagrams</span> <span class='ocrx_word' id='word_1_1141' title='bbox 1163 10938 1376 10979; x_wconf 88' lang='eng' dir='ltr'>functioning</span>
</span>
<span class='ocr_line' id='line_1_186' title="bbox 362 10996 1373 11037; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_1142' title='bbox 362 11006 396 11026; x_wconf 92' lang='eng' dir='ltr'>as</span> <span class='ocrx_word' id='word_1_1143' title='bbox 407 10996 588 11026; x_wconf 92' lang='eng' dir='ltr'>immanent</span> <span class='ocrx_word' id='word_1_1144' title='bbox 599 10996 704 11026; x_wconf 89' lang='eng' dir='ltr'>forces</span> <span class='ocrx_word' id='word_1_1145' title='bbox 716 10996 755 11026; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_1146' title='bbox 762 10996 986 11037; x_wconf 90' lang='eng' dir='ltr'>antagonism.</span> <span class='ocrx_word' id='word_1_1147' title='bbox 1000 11005 1105 11026; x_wconf 89' lang='eng' dir='ltr'>K-war</span> <span class='ocrx_word' id='word_1_1148' title='bbox 1113 10996 1242 11026; x_wconf 92' lang='eng' dir='ltr'>derives</span> <span class='ocrx_word' id='word_1_1149' title='bbox 1253 10996 1292 11026; x_wconf 92' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_1150' title='bbox 1305 10996 1373 11026; x_wconf 92' lang='eng' dir='ltr'>sole</span>
</span>
<span class='ocr_line' id='line_1_187' title="bbox 362 11054 1207 11094; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_1151' title='bbox 362 11054 541 11084; x_wconf 94' lang='eng' dir='ltr'>coherence</span> <span class='ocrx_word' id='word_1_1152' title='bbox 555 11054 638 11084; x_wconf 88' lang='eng' dir='ltr'>from</span> <span class='ocrx_word' id='word_1_1153' title='bbox 653 11054 708 11084; x_wconf 96' lang='eng' dir='ltr'>the</span> <span class='ocrx_word' id='word_1_1154' title='bbox 722 11054 815 11094; x_wconf 93' lang='eng' dir='ltr'>unity</span> <span class='ocrx_word' id='word_1_1155' title='bbox 828 11054 867 11084; x_wconf 89' lang='eng' dir='ltr'>of</span> <span class='ocrx_word' id='word_1_1156' title='bbox 877 11054 916 11084; x_wconf 92' lang='eng' dir='ltr'>its</span> <span class='ocrx_word' id='word_1_1157' title='bbox 933 11054 996 11084; x_wconf 88' lang='eng' dir='ltr'>foe.</span> <span class='ocrx_word' id='word_1_1158' title='bbox 1013 11055 1207 11084; x_wconf 92' lang='eng' dir='ltr'>RETURN.</span>
</span>
<span class='ocr_line' id='line_1_188' title="bbox 423 11109 1371 11155; baseline 0 -13; x_size 45; x_descenders 12; x_ascenders 13"><span class='ocrx_word' id='word_1_1159' title='bbox 423 11111 598 11150; x_wconf 92' lang='eng' dir='ltr'>Ana/Cata.</span> <span class='ocrx_word' id='word_1_1160' title='bbox 610 11112 728 11142; x_wconf 97' lang='eng' dir='ltr'>Switch</span> <span class='ocrx_word' id='word_1_1161' title='bbox 735 11110 1004 11155; x_wconf 89' lang='eng' dir='ltr'>cur((re)re)rent.</span> <span class='ocrx_word' id='word_1_1162' title='bbox 1016 11110 1044 11155; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1163' title='bbox 1054 11110 1066 11154; x_wconf 89' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1164' title='bbox 1078 11109 1106 11154; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1165' title='bbox 1116 11109 1159 11154; x_wconf 88' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1166' title='bbox 1170 11110 1235 11155; x_wconf 93' lang='eng' dir='ltr'>O(r</span> <span class='ocrx_word' id='word_1_1167' title='bbox 1241 11110 1338 11155; x_wconf 89' lang='eng' dir='ltr'>an)d(</span> <span class='ocrx_word' id='word_1_1168' title='bbox 1348 11111 1371 11155; x_wconf 89' lang='eng'>).</span>
</span>
<span class='ocr_line' id='line_1_189' title="bbox 365 11167 1372 11213; baseline 0 -13; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_1169' title='bbox 365 11168 430 11213; x_wconf 90' lang='eng' dir='ltr'>K0(</span> <span class='ocrx_word' id='word_1_1170' title='bbox 448 11171 461 11199; x_wconf 95' lang='eng' dir='ltr'>I</span> <span class='ocrx_word' id='word_1_1171' title='bbox 477 11170 588 11211; x_wconf 91' lang='eng' dir='ltr'>Ching</span> <span class='ocrx_word' id='word_1_1172' title='bbox 603 11170 781 11211; x_wconf 91' lang='eng' dir='ltr'>hexagram</span> <span class='ocrx_word' id='word_1_1173' title='bbox 811 11179 862 11211; x_wconf 78' lang='eng'>49:</span> <span class='ocrx_word' id='word_1_1174' title='bbox 882 11170 1085 11200; x_wconf 93' lang='eng' dir='ltr'>Revolution</span> <span class='ocrx_word' id='word_1_1175' title='bbox 1100 11167 1266 11212; x_wconf 91' lang='eng' dir='ltr'>(Molting</span> <span class='ocrx_word' id='word_1_1176' title='bbox 1280 11168 1309 11212; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1177' title='bbox 1326 11168 1372 11213; x_wconf 89' lang='eng'>)))</span>
</span>
<span class='ocr_line' id='line_1_190' title="bbox 363 11225 1372 11271; baseline 0 -13; x_size 45; x_descenders 12; x_ascenders 13"><span class='ocrx_word' id='word_1_1178' title='bbox 363 11228 466 11258; x_wconf 93' lang='eng' dir='ltr'>leaves</span> <span class='ocrx_word' id='word_1_1179' title='bbox 483 11225 495 11270; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1180' title='bbox 512 11226 524 11270; x_wconf 91' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1181' title='bbox 540 11228 684 11269; x_wconf 91' lang='eng' dir='ltr'>nothing</span> <span class='ocrx_word' id='word_1_1182' title='bbox 697 11227 816 11271; x_wconf 89' lang='eng' dir='ltr'>i)ntact</span> <span class='ocrx_word' id='word_1_1183' title='bbox 829 11228 945 11258; x_wconf 93' lang='eng' dir='ltr'>TACT</span> <span class='ocrx_word' id='word_1_1184' title='bbox 957 11228 1078 11258; x_wconf 91' lang='eng' dir='ltr'>TACT.</span> <span class='ocrx_word' id='word_1_1185' title='bbox 1097 11226 1141 11271; x_wconf 92' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_1186' title='bbox 1159 11226 1187 11270; x_wconf 92' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1187' title='bbox 1205 11226 1234 11270; x_wconf 92' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1188' title='bbox 1251 11227 1263 11271; x_wconf 89' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1189' title='bbox 1280 11226 1309 11270; x_wconf 92' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1190' title='bbox 1327 11226 1372 11271; x_wconf 89' lang='eng'>)))</span>
</span>
<span class='ocr_line' id='line_1_191' title="bbox 364 11284 1375 11330; baseline -0.003 0; x_size 80.018547; x_descenders 13; x_ascenders 23.018549"><span class='ocrx_word' id='word_1_1191' title='bbox 364 11286 392 11330; x_wconf 81' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1192' title='bbox 411 11285 423 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1193' title='bbox 440 11285 452 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1194' title='bbox 471 11286 515 11330; x_wconf 79' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1195' title='bbox 534 11284 561 11329; x_wconf 83' lang='eng'>(&lt;</span> <span class='ocrx_word' id='word_1_1196' title='bbox 580 11286 592 11330; x_wconf 79' lang='eng'><em>&gt;</em></span> <span class='ocrx_word' id='word_1_1197' title='bbox 610 11284 637 11329; x_wconf 81' lang='eng'>)&gt;</span> <span class='ocrx_word' id='word_1_1198' title='bbox 658 11285 670 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1199' title='bbox 689 11285 717 11329; x_wconf 83' lang='eng'>)&gt;</span> <span class='ocrx_word' id='word_1_1200' title='bbox 751 11284 780 11329; x_wconf 81' lang='eng'>&lt;&lt;</span> <span class='ocrx_word' id='word_1_1201' title='bbox 798 11286 810 11330; x_wconf 80' lang='eng'><em>)</em></span> <span class='ocrx_word' id='word_1_1202' title='bbox 830 11285 842 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1203' title='bbox 861 11285 873 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1204' title='bbox 892 11285 920 11329; x_wconf 83' lang='eng'>»</span> <span class='ocrx_word' id='word_1_1205' title='bbox 954 11284 1031 11330; x_wconf 79' lang='eng'><strong>()))</strong></span> <span class='ocrx_word' id='word_1_1206' title='bbox 1050 11285 1062 11330; x_wconf 86' lang='eng'><strong>(</strong></span> <span class='ocrx_word' id='word_1_1207' title='bbox 1081 11284 1126 11330; x_wconf 79' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1208' title='bbox 1158 11285 1375 11329; x_wconf 78' lang='eng' dir='ltr'>)Cyberserk</span>
</span>
<span class='ocr_line' id='line_1_192' title="bbox 363 11342 1372 11387; baseline 0 -12; x_size 44; x_descenders 11; x_ascenders 13"><span class='ocrx_word' id='word_1_1209' title='bbox 363 11345 697 11386; x_wconf 91' lang='eng' dir='ltr'>repelting-slippage</span> <span class='ocrx_word' id='word_1_1210' title='bbox 719 11345 789 11375; x_wconf 94' lang='eng' dir='ltr'>into</span> <span class='ocrx_word' id='word_1_1211' title='bbox 810 11345 983 11375; x_wconf 93' lang='eng' dir='ltr'>dark-side</span> <span class='ocrx_word' id='word_1_1212' title='bbox 1004 11342 1016 11387; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1213' title='bbox 1039 11342 1068 11387; x_wconf 91' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1214' title='bbox 1092 11342 1135 11386; x_wconf 89' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1215' title='bbox 1158 11345 1372 11375; x_wconf 92' lang='eng' dir='ltr'>distributive</span>
</span>
<span class='ocr_line' id='line_1_193' title="bbox 365 11400 1372 11446; baseline 0 -14; x_size 44; x_descenders 12; x_ascenders 12"><span class='ocrx_word' id='word_1_1216' title='bbox 365 11402 659 11443; x_wconf 81' lang='eng' dir='ltr'>ROM-scrambling</span> <span class='ocrx_word' id='word_1_1217' title='bbox 668 11402 783 11432; x_wconf 93' lang='eng' dir='ltr'>TACT</span> <span class='ocrx_word' id='word_1_1218' title='bbox 795 11402 918 11432; x_wconf 93' lang='eng' dir='ltr'>tactics.</span> <span class='ocrx_word' id='word_1_1219' title='bbox 934 11401 963 11445; x_wconf 94' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1220' title='bbox 979 11400 1005 11444; x_wconf 93' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1221' title='bbox 1019 11400 1031 11444; x_wconf 93' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1222' title='bbox 1048 11400 1060 11444; x_wconf 96' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1223' title='bbox 1074 11400 1086 11444; x_wconf 93' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1224' title='bbox 1102 11400 1114 11444; x_wconf 96' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1225' title='bbox 1128 11400 1153 11444; x_wconf 92' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1226' title='bbox 1171 11400 1199 11444; x_wconf 93' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1227' title='bbox 1213 11400 1241 11444; x_wconf 92' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1228' title='bbox 1257 11401 1269 11446; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1229' title='bbox 1283 11401 1311 11446; x_wconf 87' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1230' title='bbox 1326 11401 1372 11445; x_wconf 91' lang='eng'>(((</span>
</span>
<span class='ocr_line' id='line_1_194' title="bbox 364 11458 1372 11505; baseline 0 -1; x_size 60.254128; x_descenders 16.254128; x_ascenders 15.112474"><span class='ocrx_word' id='word_1_1231' title='bbox 364 11458 1195 11505; x_wconf 85' lang='eng'>)()))((((()((()))(((()())())(()))(((()</span> <span class='ocrx_word' id='word_1_1232' title='bbox 1212 11459 1372 11504; x_wconf 85' lang='eng'>(())((()</span>
</span>
<span class='ocr_line' id='line_1_195' title="bbox 364 11517 1372 11563; baseline -0.001 0; x_size 60.254128; x_descenders 16.254128; x_ascenders 15.112474"><span class='ocrx_word' id='word_1_1233' title='bbox 364 11517 927 11563; x_wconf 84' lang='eng'>((()))(()))))((())))((()(</span> <span class='ocrx_word' id='word_1_1234' title='bbox 970 11517 1372 11563; x_wconf 85' lang='eng'>()))(()))((())(((</span>
</span>
<span class='ocr_line' id='line_1_196' title="bbox 364 11574 1370 11622; baseline 0 -1; x_size 60.254128; x_descenders 16.254128; x_ascenders 15.112474"><span class='ocrx_word' id='word_1_1235' title='bbox 364 11577 497 11621; x_wconf 63' lang='eng' dir='ltr'>()ZCr0</span> <span class='ocrx_word' id='word_1_1236' title='bbox 509 11575 689 11619; x_wconf 69' lang='eng' dir='ltr'>Program)</span> <span class='ocrx_word' id='word_1_1237' title='bbox 706 11574 751 11618; x_wconf 85' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_1238' title='bbox 766 11575 812 11620; x_wconf 88' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1239' title='bbox 828 11575 918 11620; x_wconf 85' lang='eng'>(((()</span> <span class='ocrx_word' id='word_1_1240' title='bbox 1006 11576 1062 11621; x_wconf 72' lang='eng'>0)</span> <span class='ocrx_word' id='word_1_1241' title='bbox 1078 11577 1090 11621; x_wconf 93' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1242' title='bbox 1106 11577 1118 11621; x_wconf 93' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1243' title='bbox 1133 11576 1178 11621; x_wconf 85' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1244' title='bbox 1194 11576 1282 11622; x_wconf 86' lang='eng'>(((()</span> <span class='ocrx_word' id='word_1_1245' title='bbox 1299 11576 1328 11621; x_wconf 87' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1246' title='bbox 1343 11577 1370 11621; x_wconf 89' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_197' title="bbox 365 11634 1372 11679; baseline 0 -1; x_size 60.254128; x_descenders 16.254128; x_ascenders 15.112474"><span class='ocrx_word' id='word_1_1247' title='bbox 365 11635 442 11679; x_wconf 88' lang='eng'>(((((</span> <span class='ocrx_word' id='word_1_1248' title='bbox 456 11635 468 11679; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1249' title='bbox 484 11634 521 11679; x_wconf 83' lang='eng'>()</span> <span class='ocrx_word' id='word_1_1250' title='bbox 537 11634 683 11678; x_wconf 81' lang='eng'>)()(())((</span> <span class='ocrx_word' id='word_1_1251' title='bbox 698 11634 737 11678; x_wconf 84' lang='eng'>()</span> <span class='ocrx_word' id='word_1_1252' title='bbox 753 11634 766 11678; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1253' title='bbox 781 11634 828 11678; x_wconf 61' lang='eng' dir='ltr'>(H</span> <span class='ocrx_word' id='word_1_1254' title='bbox 842 11634 855 11663; x_wconf 64' lang='eng'>‘</span> <span class='ocrx_word' id='word_1_1255' title='bbox 869 11634 927 11678; x_wconf 55' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1256' title='bbox 1004 11634 1051 11678; x_wconf 56' lang='eng'>)))</span> <span class='ocrx_word' id='word_1_1257' title='bbox 1068 11634 1081 11678; x_wconf 80' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1258' title='bbox 1096 11634 1150 11678; x_wconf 70' lang='eng' dir='ltr'>(O</span> <span class='ocrx_word' id='word_1_1259' title='bbox 1189 11634 1217 11678; x_wconf 77' lang='eng'>0</span> <span class='ocrx_word' id='word_1_1260' title='bbox 1255 11634 1316 11679; x_wconf 87' lang='eng'>()))</span> <span class='ocrx_word' id='word_1_1261' title='bbox 1333 11634 1372 11679; x_wconf 95' lang='eng'>((</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_6' title="bbox 1005 11664 1370 11795">
<p class='ocr_par' dir='ltr' id='par_1_28' title="bbox 801 11664 1370 11795">
<span class='ocr_line' id='line_1_198' title="bbox 1005 11664 1370 11795; baseline 0 -58; x_size 80.41758; x_descenders 7.4175825; x_ascenders 28"><span class='ocrx_word' id='word_1_1262' title='bbox 1005 11664 1370 11795; x_wconf 49' lang='eng'>§5&gt;((»&gt;&lt;(&lt;&lt;&gt;&lt;(&gt;&gt;</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_7' title="bbox 364 11518 1371 11796">
<p class='ocr_par' dir='ltr' id='par_1_29' title="bbox 931 11518 943 11562">
<span class='ocr_line' id='line_1_199' title="bbox 931 11518 943 11562; baseline 0 0; x_size 59.826088; x_descenders 14.956522; x_ascenders 14.956522"><span class='ocrx_word' id='word_1_1263' title='bbox 931 11518 943 11562; x_wconf 93' lang='eng'>)</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_30' title="bbox 935 11576 947 11620">
<span class='ocr_line' id='line_1_200' title="bbox 935 11576 947 11620; baseline 0 0; x_size 59.826088; x_descenders 14.956522; x_ascenders 14.956522"><span class='ocrx_word' id='word_1_1264' title='bbox 935 11576 947 11620; x_wconf 95' lang='eng'>(</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_31' title="bbox 933 11633 946 11678">
<span class='ocr_line' id='line_1_201' title="bbox 933 11633 946 11678; baseline 0 0; x_size 59.826088; x_descenders 14.956522; x_ascenders 14.956522"><span class='ocrx_word' id='word_1_1265' title='bbox 933 11633 946 11678; x_wconf 88' lang='eng'>(</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_32' title="bbox 364 11692 1371 11796">
<span class='ocr_line' id='line_1_202' title="bbox 364 11692 948 11738; baseline -0.003 0; x_size 59.826088; x_descenders 14.956522; x_ascenders 14.956522"><span class='ocrx_word' id='word_1_1266' title='bbox 364 11692 948 11738; x_wconf 85' lang='eng'>)))((())(((())((()))(((((</span>
</span>
<span class='ocr_line' id='line_1_203' title="bbox 1054 11751 1371 11796; baseline 0 0; x_size 59.826088; x_descenders 14.956522; x_ascenders 14.956522"><span class='ocrx_word' id='word_1_1267' title='bbox 1054 11751 1371 11796; x_wconf 84' lang='eng'>()))(()))((())</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_8' title="bbox 364 11575 1372 12264">
<p class='ocr_par' dir='ltr' id='par_1_33' title="bbox 364 11575 1372 12264">
<span class='ocr_line' id='line_1_204' title="bbox 962 11575 990 11619; baseline 0 0; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1268' title='bbox 962 11575 990 11619; x_wconf 89' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_205' title="bbox 959 11634 990 11678; baseline 0 0; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1269' title='bbox 959 11634 990 11678; x_wconf 85' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_206' title="bbox 908 11692 991 11737; baseline -0.012 0; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1270' title='bbox 908 11693 920 11737; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1271' title='bbox 963 11692 991 11736; x_wconf 89' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_207' title="bbox 365 11750 1004 11796; baseline 0 -1; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1272' title='bbox 365 11750 1004 11796; x_wconf 83' lang='eng'>((((()())()(())((())((())))())(</span>
</span>
<span class='ocr_line' id='line_1_208' title="bbox 365 11809 1371 11855; baseline 0 -1; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1273' title='bbox 365 11809 1371 11855; x_wconf 69' lang='eng' dir='ltr'>(((())((()))(((()(D())(()))(((()(())((((()())</span>
</span>
<span class='ocr_line' id='line_1_209' title="bbox 365 11867 1371 11913; baseline -0.001 0; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1274' title='bbox 365 11867 1210 11913; x_wconf 74' lang='eng'>()(())((())((())))())))((())))0))))((()</span> <span class='ocrx_word' id='word_1_1275' title='bbox 1246 11867 1274 11911; x_wconf 82' lang='eng'>0</span> <span class='ocrx_word' id='word_1_1276' title='bbox 1309 11867 1371 11912; x_wconf 85' lang='eng'>()))</span>
</span>
<span class='ocr_line' id='line_1_210' title="bbox 365 11925 1371 11971; baseline 0 -1; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1277' title='bbox 365 11925 1371 11971; x_wconf 87' lang='eng'>(()))((())(((())((()))(((()())())(()))(((()</span>
</span>
<span class='ocr_line' id='line_1_211' title="bbox 365 11984 1370 12030; baseline 0 -1; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1278' title='bbox 365 11986 393 12030; x_wconf 92' lang='eng'>((</span> <span class='ocrx_word' id='word_1_1279' title='bbox 407 11985 435 12030; x_wconf 85' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1280' title='bbox 452 11985 528 12029; x_wconf 88' lang='eng'>(((((</span> <span class='ocrx_word' id='word_1_1281' title='bbox 542 11985 555 12029; x_wconf 91' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1282' title='bbox 570 11985 582 12030; x_wconf 96' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1283' title='bbox 597 11986 609 12030; x_wconf 89' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1284' title='bbox 624 11985 636 12029; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1285' title='bbox 654 11985 682 12029; x_wconf 88' lang='eng'>()</span> <span class='ocrx_word' id='word_1_1286' title='bbox 699 11985 778 12030; x_wconf 85' lang='eng'>(())(</span> <span class='ocrx_word' id='word_1_1287' title='bbox 794 11985 806 12030; x_wconf 94' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1288' title='bbox 822 11985 834 12030; x_wconf 96' lang='eng'>(</span> <span class='ocrx_word' id='word_1_1289' title='bbox 850 11984 878 12029; x_wconf 89' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1290' title='bbox 895 11984 941 12030; x_wconf 87' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_1291' title='bbox 956 11986 968 12030; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1292' title='bbox 985 11984 1013 12029; x_wconf 84' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1293' title='bbox 1029 11985 1059 12030; x_wconf 85' lang='eng'>)(</span> <span class='ocrx_word' id='word_1_1294' title='bbox 1074 11985 1102 12029; x_wconf 89' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1295' title='bbox 1119 11984 1147 12029; x_wconf 90' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1296' title='bbox 1164 11985 1210 12030; x_wconf 87' lang='eng'>(((</span> <span class='ocrx_word' id='word_1_1297' title='bbox 1225 11986 1237 12030; x_wconf 86' lang='eng'>)</span> <span class='ocrx_word' id='word_1_1298' title='bbox 1253 11985 1281 12029; x_wconf 88' lang='eng'>))</span> <span class='ocrx_word' id='word_1_1299' title='bbox 1297 11985 1327 12030; x_wconf 87' lang='eng'>)(</span> <span class='ocrx_word' id='word_1_1300' title='bbox 1342 11985 1370 12029; x_wconf 88' lang='eng'>))</span>
</span>
<span class='ocr_line' id='line_1_212' title="bbox 364 12042 1372 12089; baseline -0.001 0; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1301' title='bbox 364 12043 508 12089; x_wconf 84' lang='eng'>)))((()</span> <span class='ocrx_word' id='word_1_1302' title='bbox 548 12043 575 12088; x_wconf 85' lang='eng'>0</span> <span class='ocrx_word' id='word_1_1303' title='bbox 614 12042 1372 12089; x_wconf 86' lang='eng'>()))(()))((())(((())((()))(((()(</span>
</span>
<span class='ocr_line' id='line_1_213' title="bbox 365 12101 1371 12147; baseline 0 0; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1304' title='bbox 365 12101 1371 12147; x_wconf 66' lang='eng' dir='ltr'>D())(()))(((()(())((((()())()(())((())((())))(</span>
</span>
<span class='ocr_line' id='line_1_214' title="bbox 366 12159 1371 12206; baseline 0 -1; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1305' title='bbox 366 12160 435 12205; x_wconf 86' lang='eng'>))0</span> <span class='ocrx_word' id='word_1_1306' title='bbox 462 12159 1371 12206; x_wconf 76' lang='eng'>()))(0))((())(((())((()))(((()())())((</span>
</span>
<span class='ocr_line' id='line_1_215' title="bbox 366 12218 1214 12264; baseline 0 -1; x_size 59.422222; x_descenders 14.855556; x_ascenders 14.855556"><span class='ocrx_word' id='word_1_1307' title='bbox 366 12218 1214 12264; x_wconf 74' lang='eng'>)))(((()(())((((()())()(())((()))))(0))</span>
</span>
</p>
</div>
</div>
<script type="text/javascript">
var ww = $('.ocrx_word');
ww.each( function(x){
let t = $(this).attr('title').split(" "),
left = parseInt(t[1]),
top = parseInt(t[2]);
console.log('title = ', left , top);
left *= 0.4;
top *= 0.5;
this.style.left = left + 'px';
this.style.top = top + 'px';
});
window.setInterval( function(){
// console.log('interval', ww);
var ra = Math.floor(ww.size()*Math.random());
var w = ww.get(ra);
// console.log(w);
$(w).css('color', 'red');
}, 250);
$( function() {
$( ".draggable" ).draggable();
} );
//store all class 'ocr_line' in 'lines'
var lines = document.querySelectorAll(".ocr_line");
//loop through each element in 'lines'
for (var i = 0; i < lines.length; i++){
var line = lines[i];
var words = line.querySelectorAll(".ocrx_word");
for (var e = 0; e < words.length; e++){
var span = words[e];
span.classList.add("draggable");
}
}
</script>
</body>
</html>

49
meltdown/index.html
Unescape Escape View File

@ -0,0 +1,49 @@
<!DOCTYPE html>
<html>
<head>
<meta charset="utf-8">
<title></title>
<link rel="stylesheet" href="https://unpkg.com/leaflet@1.5.1/dist/leaflet.css"
integrity="sha512-xwE/Az9zrjBIphAcBb3F6JVqxf46+CDLwfLMHloNu6KEQCAWi6HcDUbeOfBIptF7tcCzusKFjFw2yuvEpDL9wQ=="
crossorigin=""/>
<script src="https://unpkg.com/leaflet@1.5.1/dist/leaflet.js"
integrity="sha512-GffPMF3RvMeYyc1LWMHtK8EbPv0iNZ8/oTtHPx9/cc2ILxQ+u905qIwdpULaqDkyBKgOaB57QTMg7ztg8Jm2Og=="
crossorigin=""></script>
<script src="./leaflet-hash/leaflet-hash.js" type="text/javascript"></script>
<style>
html, body, #mapid {
position: relative;
height:100%;
width:100%;
padding:0px;
margin:0px;
background-color: black;
color: white;
font-family: "Lucida Console", Monaco, monospace;
font-size: 18px;
}
.redirect {
position: absolute;
z-index: 101;
/* margin-left: 50%;*/
margin-top: 300px;
}
p {
width: 100px;
height: 100px;
text-align:center;
vertical-align: middle;
font-size: 14px;
}
</style>
</head>
<body>
<span id="bttn"></span>
<div id="mapid"></div>
<script type="text/javascript" src="text2.js"></script>
<script type="text/javascript" src="main.js"></script>
</body>
</html>

Some files were not shown because too many files have changed in this diff Show More

Write Preview
Loading…
Cancel
Save