- ))((())(((())((()))((((()
+ ))((())(((())((()))((((()
()))(()))((())
@@ -651,7 +651,7 @@
var ra2 = Math.floor(ww.size()*Math.random());
var a = ww.get(ra2);
var orig = $(a).html()
- $(a).html(''+ orig + '')
+ $(a).html(''+ orig + '')
}, 5000);
diff --git a/ilinx/Ixse2.html b/ilinx/Ixse2.html
new file mode 100644
index 0000000..a5606f6
--- /dev/null
+++ b/ilinx/Ixse2.html
@@ -0,0 +1,701 @@
+
+
+
+
+
+ Hypervirus
+
+
+ Whatever ultramodernity places under the dominion
+
+ of signs postmodernity subverts with virus. As culture
+
+ migrates into partial-machines (lacking an autonomous
+
+ reproductive system) semiotics subsides into virotechnics.
+
+
+ 0010101011011100101101010101001100100010001010
+
+ 1011101000010101100101001010001100100111001000100
+
+ 000000010011111100010010010101010100001000010101
+
+ 00111111001001000100011010010001010010101111000101
+
+ 001000010001110100 Yes No Yes No Yes Yes No longer
+
+ what does it mean? but how does it spread?
+
+
+ Having no proper substance, or sense beyond its re re
+
+ re replication, yes no no usage of virus is ever metaphori-
+
+ cal. The word ‘virus’ is more re re virus.
+
+
+ Postmodern culture re re chatters-out virus virus virus
+
+ virus virus virus virus virus virus virus 0110001001001
+
+ 011010010010110010010010010010 ‘virus’ (viroductile,
+
+ virogenic, immunosuppressor and and or, meta-, or or
+
+ and or hyper-) virus.
+
+
+ 10110010010011101100001001001. hypervirus eats the end
+
+ of history
+
+
+ 00100100100010]1110100001001101010101010101000
+
+ 10011010100100101001001010010110100100101111010001
+
+ 0101010101010100101010010101101010010000001000101
+
+ 1101010010010101001010010010101010010001001001001
+
+ 00100100101001001010110101001001001010110101010101
+
+ 0101111010000100]1010101010101000100110110101010100
+
+ 11001000100010101011101000010101100101001010001100
+
+ 1001110010001000000000000100111111100010010010101
+
+
+ 0101000010000 K-(coding for cyber)p0sitive proc-
+
+ esses auto-intensify by occurring. A cultural example is
+
+ hype: products that AT AT trade on what they will be in
+
+ the future, vir virtual fashion on off, imminent technical
+
+ standards, self-fulfilling prophecies and and or and artifi-
+
+ cial destinies. Anticipating a trend end end end ACC ACC
+
+ accelerates it (which is in itself a re re recursive trend)
+
+
+ Hyping collapses SF into CATA CATA catalytic tic
+
+ efficiency, re-routing tomorrow through what its prospect
+
+ CT CT CT makes today.
+
+
+ Virohyping sweeps through the advertising industry.
+
+
+ Everyone will be doing it.
+
+
+ Virus is parasitic tic replicator code: an asignifying
+
+ sequence of machinic data ATA ATA flow-break on/off,
+
+ 1/0, yang/yin intrinsically destined for war. In place of
+
+ mess message-content virodata is assembled bled from
+
+ asignifying materials with CATA catalytic (or positively
+
+ disproportionate) efficiency: intruder passcode, locational
+
+ ZIP-code, pseudogenomic substitute instructions, muta-
+
+ tional junk (complex but latent segments), and garbage
+
+ (redundant scrapcrapcrapcrapcrapcrapcrapcrapcrap-
+
+ crapcrapcrapcrap).
+
+
+ Biovirus TA TA TA targets organisms, hacking and
+
+ reprogramming ATGAC'ITATCCACGGTACATTCAGT
+
+ cellular DNA to produce more virus virus virus virus virus
+
+ virus virus virus. Its enzymic cut-and-past recombinant
+
+ wetware-splicing crosses singularity when retroviral
+
+ reverse-transcriptase clicks in (enabling ontogenetic DNA-
+
+ RNA circuitry and endocellular computation).
+
+
+ ATAGGTCATGAATCTACCGATTGCAGCTGC
+
+ TATTCCTCGATGATCGCATGGGCTGTGATG
+
+ GCATCGTATCCGATCGATTCGAGCGATTGCAGC
+
+ TACGCTATTCCTCCGAGGGATTGCAGCTACGTC
+
+ GCATCGGGCTCAGATGTAGGTCATGAATCTACC
+
+ GATTGCATGACTT ATCCACGGTACA’ITCGACT C
+
+
+ Ethnovirus targets brains Technovirus targets socio-
+
+ economic pro pro production pro processes. Infovirus
+
+ targets digital 010010010001011110100001001101010101010
+
+ 10001001101010010010100computers100101001011010010
+
+ 101111010001010101010101010010101001010110101001
+
+ 000000100010111010100100101010010100100101010101
+
+ 00100010010010010010010010100100101011010100100
+
+ 10010101101010101010111101000010011010101010101000
+
+ 1001101101010101001100100010001010101110100001010
+
+ 110010100101000110010011100100010000000001001111
+
+ 1100010010010101
+
+
+ Hypervirus targets intelligent immunosecurity struc-
+
+ tures: yes yes no yes no nomadically abstracting its proc-
+
+ esses from specific media (DNA, words, symbolic models,
+
+ bit-sequences), and operantly re-engineering itself. It
+
+ folds into itself, involutes, or plexes, by reprogramming
+
+ corpuscular code to reprogram reprogramming repro-
+
+ gramming reprogramming. ROM is melted into recursive
+
+ experimentation.
+
+
+ 001010010010010110000101010101011101010010100
+
+ 10010101000011011001101001011000010001001001000
+
+ Recording devices. Copiers. Faxes. Samplers. K-stammer
+
+ (((re)re)reruns) cross-cut by orphan drift. Repeat infec-
+
+ tion. All hype hype hype hype hype hype hype hype
+
+ hypervirus strains are plastic and interoperative.
+
+
+ INSERT. hyper-prefixing semiotic sectors TAG TAG
+
+ TAG tags them for transfer into abstract ACT ACT (nonlin-
+
+ ear transcodable) machinic systems, tuned to virtualities or
+
+ hyperspeeds (futural currencies independent of def uturali-
+
+ zation). Hypermedia configure re re every implementation
+
+ within a specific medium or territory as a subfunction of
+
+ extraterritorial processes. Going (( ( ))) ( ) ( ) (( ) ) (( ))
+
+ ( ) hyper dissolves being into ACT ACT ACT activity; a
+
+ material desubstantialisation on off on off. Hyperproc-
+
+ esses spread like Heraklitean fire re re re (although there
+
+ are no analogies or metaphors in hype hype hype hype
+
+ hyperspace).
+
+
+ Being CAG CAG cages flow within memory. Function-
+
+ ing as re re real antiontology, viral amnesia machinically
+
+ realizes and dissolves biological TGACTCACI'ITAC-
+
+ CGA'ITG, cultural, and technical 010110100100010110100
+
+ 101001001011101001010100100100100 mnemic structures:
+
+ chopping-up hierarchic-generational descendency, col-
+
+ lapsing phylogenetic tic frozen-code into ontogeny, and
+
+ immanentizing the past to operative current. Its com-
+
+ petitive just-in-time innovations delete storage CA CA
+
+ capacity, flu flu flu fluidizin g energetic and informational
+
+ stocks into and and or and and or orphan-vampire re re
+
+ transversal 110111100010101010 vir vir virocommunication
+
+ process, expressing a surplus value of code (content)
+
+ as xenoreplication-behaviour (and/0r c0n(nective dis)
+
+ junction).
+
+
+ As war increases in in in intelligence, it becomes softer.
+
+ By trashing their hosts crude viruses feedback negatively
+
+ upon themselves, autolimiting their range of re regen-
+
+ erative infilitration. Crazy vandals like Ebola CGCGT
+
+ GAGCAATCGGACTCGGCTGCTGTGC'ITG (bodies
+
+ dissolved quickly into slime) aren’t ever going to make it
+
+ big. General principle for viral take-overs in the media: the
+
+ more unsophisticated the contagion, the bigger the splash
+
+ (diversionary tactics excepted). CAGCTACGCTATT
+
+ CTCCGAGGCTAGATTGCAGCTACGTCGCATCG
+
+ GGCTGACCGATGTAGGTCATGAATCTACCGA’IT
+
+ GCACATGACTTATCCACGGTCTATTCCTCGAT
+
+ GATCGCATCGGG CT GACCGATGGCATCGTA COPY.
+
+ CUT. PASTE. Subtle viruses are slow, synergic, flexible
+
+ and elusive. They execute sensitive behavioural con-
+
+ trol that prolongs the life of the biomachinic resources,
+
+ maximizes opportunities for propogation, infiltrates and
+
+ disables hostile security systems, and feeds-back posi-
+
+ tive -+-++-+-++ in in in innovation technoscience. In the
+
+ macroversion, a VR prey animal hid in its enemy’s head.
+
+
+ When hunting for hype hypervirus look 0k 0k ok for
+
+ its primary host species, which will be undergoing logis-
+
+ tical behavioral sophistication indexed by an explosive
+
+ increase in communicative intensity, population density,
+
+ sexual disorganisation, cultural promiscuity, and technical
+
+ sub sub subtilization (leading to neurogenomic feedback
+
+ and fluidization on off on off off on of all hard-wiring
+
+ into into cybernetic fluxes). Any plane planet net net
+
+ 00011011010010010101011 hosting such an event is about
+
+ to flip over. CATA catastrophic OKOOKOK OK zero (0
+
+ (or ((( ( )) (( ) ) ( )) ) o°)) K-virus and (RT) retroscripts
+
+ (Kobe, Tokyo, Oklahoma (Koresh, Koernke)). Apoka-
+
+ lypse spread by the coke machine. Tomorrow’s news
+
+ brews-up in Korea, Kosovo
+
+
+ Climbing out of a recombination apparatus of TA
+
+ TA TA tape-recorders and cut-ups, hypervirus infected
+
+ Burroughs in 1972, at the cusp of K(ondratieff)-wave 9
+
+
+ (the threshold of postmodernity). It rapidly reprocessed
+
+ its target into an intelligenic no yes yes no no nova-war
+
+ laboratory, volatilizing the history of language into invo-
+
+ lutionary word-virus. Mutation rat rat rat rat rates jump.
+
+ Vector switches through Butler, Gibson, and Cadigan
+
+ fine-tune its synergic interexcitation, silt-up cybershift-
+
+ inducing K(uang)-potential, and trend-lock onto 11001
+
+ 01001001010111101001011101011001000100010100100010
+
+ 01001001001001010010110100100100100100100100111010
+
+ 0100100100011001000101100101010 K-punk pulses with
+
+ telematically-accelerating neoreplicator plicator plicator
+
+ contamination.
+
+
+ ‘Looking for a hit of snowcrash?’ # Wit # ## # # #
+
+ ### ##W######## ##1## ###### # # #
+
+ #### # ##1## # # # ### ####### # #
+
+ ####### #####=# ## ##### ## # # #####
+
+ ### ############### ## # #
+
+
+ As postmodern culture crosses to hypermania and ##1##
+
+ ######################W# #
+
+ # #### ####### # ##########W# #
+
+ ################# ## # ##fitfi #
+
+ ##### ## ###### ## # W ## ## # #### ####
+
+ # stop stop go stop go stop go go goes nova, it singular-
+
+ izes multiplicities cities cities of invasively autoreplicating
+
+
+ autoreplicating plexoweapon - systems (0 ( ((() ((( ( ))
+
+ ()) ((( ) (( )) ( D») ( ) ( ))) ) that are r6 r6 r6 r6 nothing
+
+
+ beyond their war AGA AGA against security. This is no
+
+ longer a question on off on of ideological representation,
+
+ exogeneous political mobilization, theoretical critique, ##
+
+ ######## # ###################### ####
+
+ ## # # # # # ### # # # #W # or strategic orienta-
+
+ tion, but of decentralized cultural diagrams functioning
+
+ as immanent forces of antagonism. K-war derives its sole
+
+ coherence from the unity of its foe. RETURN.
+
+ Ana/Cata. Switch cur((re)re)rent. (( ) (( ))) O(r an)d( ).
+
+ K0( I Ching hexagram 49: Revolution (Molting (( )))
+
+ leaves ( ) nothing i)ntact TACT TACT. ((( (( (( ) (( )))
+
+ (( ( ( ))) (< > )> ( )> << ) ( ( » ())) ( ))) )Cyberserk
+
+ repelting-slippage into dark-side ( (( ))) distributive
+
+ ROM-scrambling TACT tactics. (( (( ) ( ) ( )) (( )) ( )) (((
+
+ )()))((((()((()))(((()())())(()))(((() (())((()
+
+ ((()))(()))))((())))((()( ()))(()))((())(((
+
+ ()ZCr0 Program) ((( ))) (((() 0) ( ( ))) (((() (( ))
+
+ ((((( ) () )()(())(( () ) (H ‘ ))) ))) ( (O 0 ())) ((
+
+
+ §5>((»><(<<><(>>
+
+
+ )
+
+
+ (
+
+
+ (
+
+
+ ))((())(((())((()))((((()
+
+ ()))(()))((())
+
+
+ ))
+
+ ))
+
+ ) ))
+
+ ((((()())()(())((())((())))())(
+
+ (((())((()))(((()(D())(()))(((()(())((((()())
+
+ ()(())((())((())))())))((())))0))))((() 0 ()))
+
+ (()))((())(((())((()))(((()())())(()))(((()
+
+ (( )) ((((( ) ( ) ) () (())( ( ( )) ((( ) )) )( )) )) ((( ) )) )( ))
+
+ )))((() 0 ()))(()))((())(((())((()))(((()(
+
+ D())(()))(((()(())((((()())()(())((())((())))(
+
+ ))0 ()))(0))((())(((())((()))(((()())())((
+
+ )))(((()(())((((()())()(())((()))))(0))
+
+
+ Hypervirus
+
+
+ Whatever ultramodernity places under the dominion
+
+ of signs postmodernity subverts with virus. As culture
+
+ migrates into partial-machines (lacking an autonomous
+
+ reproductive system) semiotics subsides into virotechnics.
+
+
+ 0010101011011100101101010101001100100010001010
+
+ 1011101000010101100101001010001100100111001000100
+
+ 000000010011111100010010010101010100001000010101
+
+ 00111111001001000100011010010001010010101111000101
+
+ 001000010001110100 Yes No Yes No Yes Yes No longer
+
+ what does it mean? but how does it spread?
+
+
+ Having no proper substance, or sense beyond its re re
+
+ re replication, yes no no usage of virus is ever metaphori-
+
+ cal. The word ‘virus’ is more re re virus.
+
+
+ Postmodern culture re re chatters-out virus virus virus
+
+ virus virus virus virus virus virus virus 0110001001001
+
+ 011010010010110010010010010010 ‘virus’ (viroductile,
+
+ virogenic, immunosuppressor and and or, meta-, or or
+
+ and or hyper-) virus.
+
+
+ 10110010010011101100001001001. hypervirus eats the end
+
+ of history
+
+
+ 00100100100010]1110100001001101010101010101000
+
+ 10011010100100101001001010010110100100101111010001
+
+ 0101010101010100101010010101101010010000001000101
+
+ 1101010010010101001010010010101010010001001001001
+
+ 00100100101001001010110101001001001010110101010101
+
+ 0101111010000100]1010101010101000100110110101010100
+
+ 11001000100010101011101000010101100101001010001100
+
+ 1001110010001000000000000100111111100010010010101
+
+
+ 0101000010000 K-(coding for cyber)p0sitive proc-
+
+ esses auto-intensify by occurring. A cultural example is
+
+ hype: products that AT AT trade on what they will be in
+
+ the future, vir virtual fashion on off, imminent technical
+
+ standards, self-fulfilling prophecies and and or and artifi-
+
+ cial destinies. Anticipating a trend end end end ACC ACC
+
+ accelerates it (which is in itself a re re recursive trend)
+
+
+ Hyping collapses SF into CATA CATA catalytic tic
+
+ efficiency, re-routing tomorrow through what its prospect
+
+ CT CT CT makes today.
+
+
+ Virohyping sweeps through the advertising industry.
+
+
+ Everyone will be doing it.
+
+
+ Virus is parasitic tic replicator code: an asignifying
+
+ sequence of machinic data ATA ATA flow-break on/off,
+
+ 1/0, yang/yin intrinsically destined for war. In place of
+
+ mess message-content virodata is assembled bled from
+
+ asignifying materials with CATA catalytic (or positively
+
+ disproportionate) efficiency: intruder passcode, locational
+
+ ZIP-code, pseudogenomic substitute instructions, muta-
+
+ tional junk (complex but latent segments), and garbage
+
+ (redundant scrapcrapcrapcrapcrapcrapcrapcrapcrap-
+
+ crapcrapcrapcrap).
+
+
+ Biovirus TA TA TA targets organisms, hacking and
+
+ reprogramming ATGAC'ITATCCACGGTACATTCAGT
+
+ cellular DNA to produce more virus virus virus virus virus
+
+ virus virus virus. Its enzymic cut-and-past recombinant
+
+ wetware-splicing crosses singularity when retroviral
+
+ reverse-transcriptase clicks in (enabling ontogenetic DNA-
+
+ RNA circuitry and endocellular computation).
+
+
+ ATAGGTCATGAATCTACCGATTGCAGCTGC
+
+ TATTCCTCGATGATCGCATGGGCTGTGATG
+
+ GCATCGTATCCGATCGATTCGAGCGATTGCAGC
+
+ TACGCTATTCCTCCGAGGGATTGCAGCTACGTC
+
+ GCATCGGGCTCAGATGTAGGTCATGAATCTACC
+
+ GATTGCATGACTT ATCCACGGTACA’ITCGACT C
+
+
+ Ethnovirus targets brains Technovirus targets socio-
+
+ economic pro pro production pro processes. Infovirus
+
+ targets digital 010010010001011110100001001101010101010
+
+ 10001001101010010010100computers100101001011010010
+
+ 101111010001010101010101010010101001010110101001
+
+ 000000100010111010100100101010010100100101010101
+
+ 00100010010010010010010010100100101011010100100
+
+ 10010101101010101010111101000010011010101010101000
+
+ 1001101101010101001100100010001010101110100001010
+
+ 110010100101000110010011100100010000000001001111
+
+ 1100010010010101
+
+
+ Hypervirus targets intelligent immunosecurity struc-
+
+ tures: yes yes no yes no nomadically abstracting its proc-
+
+ esses from specific media (DNA, words, symbolic models,
+
+ bit-sequences), and operantly re-engineering itself. It
+
+ folds into itself, involutes, or plexes, by reprogramming
+
+ corpuscular code to reprogram reprogramming repro-
+
+ gramming reprogramming. ROM is melted into recursive
+
+ experimentation.
+
+
+ 001010010010010110000101010101011101010010100
+
+ 10010101000011011001101001011000010001001001000
+
+ Recording devices. Copiers. Faxes. Samplers. K-stammer
+
+ (((re)re)reruns) cross-cut by orphan drift. Repeat infec-
+
+ tion. All hype hype hype hype hype hype hype hype
+
+ hypervirus strains are plastic and interoperative.
+
+
+ INSERT. hyper-prefixing semiotic sectors TAG TAG
+
+ TAG tags them for transfer into abstract ACT ACT (nonlin-
+
+ ear transcodable) machinic systems, tuned to virtualities or
+
+ hyperspeeds (futural currencies independent of def uturali-
+
+ zation). Hypermedia configure re re every implementation
+
+ within a specific medium or territory as a subfunction of
+
+ extraterritorial processes. Going (( ( ))) ( ) ( ) (( ) ) (( ))
+
+ ( ) hyper dissolves being into ACT ACT ACT activity; a
+
+ material desubstantialisation on off on off. Hyperproc-
+
+ esses spread like Heraklitean fire re re re (although there
+
+ are no analogies or metaphors in hype hype hype hype
+
+ hyperspace).
+
+
+ Being CAG CAG cages flow within memory. Function-
+
+ ing as re re real antiontology, viral amnesia machinically
+
+ realizes and dissolves biological TGACTCACI'ITAC-
+
+ CGA'ITG, cultural, and technical 010110100100010110100
+
+ 101001001011101001010100100100100 mnemic structures:
+
+ chopping-up hierarchic-generational descendency, col-
+
+ lapsing phylogenetic tic frozen-code into ontogeny, and
+
+ immanentizing the past to operative current. Its com-
+
+ petitive just-in-time innovations delete storage CA CA
+
+ capacity, flu flu flu fluidizin g energetic and informational
+
+ stocks into and and or and and or orphan-vampire re re
+
+ transversal 110111100010101010 vir vir virocommunication
+
+ process, expressing a surplus value of code (content)
+
+ as xenoreplication-behaviour (and/0r c0n(nective dis)
+
+ junction).
+
+
+ As war increases in in in intelligence, it becomes softer.
+
+ By trashing their hosts crude viruses feedback negatively
+
+ upon themselves, autolimiting their range of re regen-
+
+ erative infilitration. Crazy vandals like Ebola CGCGT
+
+ GAGCAATCGGACTCGGCTGCTGTGC'ITG (bodies
+
+ dissolved quickly into slime) aren’t ever going to make it
+
+ big. General principle for viral take-overs in the media: the
+
+ more unsophisticated the contagion, the bigger the splash
+
+ (diversionary tactics excepted). CAGCTACGCTATT
+
+ CTCCGAGGCTAGATTGCAGCTACGTCGCATCG
+
+ GGCTGACCGATGTAGGTCATGAATCTACCGA’IT
+
+ GCACATGACTTATCCACGGTCTATTCCTCGAT
+
+ GATCGCATCGGG CT GACCGATGGCATCGTA COPY.
+
+ CUT. PASTE. Subtle viruses are slow, synergic, flexible
+
+ and elusive. They execute sensitive behavioural con-
+
+ trol that prolongs the life of the biomachinic resources,
+
+ maximizes opportunities for propogation, infiltrates and
+
+ disables hostile security systems, and feeds-back posi-
+
+ tive -+-++-+-++ in in in innovation technoscience. In the
+
+ macroversion, a VR prey animal hid in its enemy’s head.
+
+
+ When hunting for hype hypervirus look 0k 0k ok for
+
+ its primary host species, which will be undergoing logis-
+
+ tical behavioral sophistication indexed by an explosive
+
+ increase in communicative intensity, population density,
+
+ sexual disorganisation, cultural promiscuity, and technical
+
+ sub sub subtilization (leading to neurogenomic feedback
+
+ and fluidization on off on off off on of all hard-wiring
+
+ into into cybernetic fluxes). Any plane planet net net
+
+ 00011011010010010101011 hosting such an event is about
+
+ to flip over. CATA catastrophic OKOOKOK OK zero (0
+
+ (or ((( ( )) (( ) ) ( )) ) o°)) K-virus and (RT) retroscripts
+
+ (Kobe, Tokyo, Oklahoma (Koresh, Koernke)). Apoka-
+
+ lypse spread by the coke machine. Tomorrow’s news
+
+ brews-up in Korea, Kosovo
+
+
+ Climbing out of a recombination apparatus of TA
+
+ TA TA tape-recorders and cut-ups, hypervirus infected
+
+ Burroughs in 1972, at the cusp of K(ondratieff)-wave 9
+
+
+ (the threshold of postmodernity). It rapidly reprocessed
+
+ its target into an intelligenic no yes yes no no nova-war
+
+ laboratory, volatilizing the history of language into invo-
+
+ lutionary word-virus. Mutation rat rat rat rat rates jump.
+
+ Vector switches through Butler, Gibson, and Cadigan
+
+ fine-tune its synergic interexcitation, silt-up cybershift-
+
+ inducing K(uang)-potential, and trend-lock onto 11001
+
+ 01001001010111101001011101011001000100010100100010
+
+ 01001001001001010010110100100100100100100100111010
+
+ 0100100100011001000101100101010 K-punk pulses with
+
+ telematically-accelerating neoreplicator plicator plicator
+
+ contamination.
+
+
+ ‘Looking for a hit of snowcrash?’ # Wit # ## # # #
+
+ ### ##W######## ##1## ###### # # #
+
+ #### # ##1## # # # ### ####### # #
+
+ ####### #####=# ## ##### ## # # #####
+
+ ### ############### ## # #
+
+
+ As postmodern culture crosses to hypermania and ##1##
+
+ ######################W# #
+
+ # #### ####### # ##########W# #
+
+ ################# ## # ##fitfi #
+
+ ##### ## ###### ## # W ## ## # #### ####
+
+ # stop stop go stop go stop go go goes nova, it singular-
+
+ izes multiplicities cities cities of invasively autoreplicating
+
+
+ autoreplicating plexoweapon - systems (0 ( ((() ((( ( ))
+
+ ()) ((( ) (( )) ( D») ( ) ( ))) ) that are r6 r6 r6 r6 nothing
+
+
+ beyond their war AGA AGA against security. This is no
+
+ longer a question on off on of ideological representation,
+
+ exogeneous political mobilization, theoretical critique, ##
+
+ ######## # ###################### ####
+
+ ## # # # # # ### # # # #W # or strategic orienta-
+
+ tion, but of decentralized cultural diagrams functioning
+
+ as immanent forces of antagonism. K-war derives its sole
+
+ coherence from the unity of its foe. RETURN.
+
+ Ana/Cata. Switch cur((re)re)rent. (( ) (( ))) O(r an)d( ).
+
+ K0( I Ching hexagram 49: Revolution (Molting (( )))
+
+ leaves ( ) nothing i)ntact TACT TACT. ((( (( (( ) (( )))
+
+ (( ( ( ))) (< > )> ( )> << ) ( ( » ())) ( ))) )Cyberserk
+
+ repelting-slippage into dark-side ( (( ))) distributive
+
+ ROM-scrambling TACT tactics. (( (( ) ( ) ( )) (( )) ( )) (((
+
+ )()))((((()((()))(((()())())(()))(((() (())((()
+
+ ((()))(()))))((())))((()( ()))(()))((())(((
+
+ ()ZCr0 Program) ((( ))) (((() 0) ( ( ))) (((() (( ))
+
+ ((((( ) () )()(())(( () ) (H ‘ ))) ))) ( (O 0 ())) ((
+
+
+ §5>((»><(<<><(>>
+
+
+ )
+
+
+ (
+
+
+ (
+
+
+ ))((())(((())((()))((((()
+
+ ()))(()))((())
+
+
+ ))
+
+ ))
+
+ ) ))
+
+ ((((()())()(())((())((())))())(
+
+ (((())((()))(((()(D())(()))(((()(())((((()())
+
+ ()(())((())((())))())))((())))0))))((() 0 ()))
+
+ (()))((())(((())((()))(((()())())(()))(((()
+
+ (( )) ((((( ) ( ) ) () (())( ( ( )) ((( ) )) )( )) )) ((( ) )) )( ))
+
+ )))((() 0 ()))(()))((())(((())((()))(((()(
+
+ D())(()))(((()(())((((()())()(())((())((())))(
+
+ ))0 ()))(0))((())(((())((()))(((()())())((
+
+ )))(((()(())((((()())()(())((()))))(0))
+
+