Tancre
/
ilinx
1
0
Fork 0
Code Issues Pull Requests Releases Wiki Activity
You cannot select more than 25 topics Topics must start with a letter or number, can include dashes ('-') and can be up to 35 characters long.
master
Branches Tags
${ item.name }
Create tag ${ searchTerm }
Create branch ${ searchTerm }
from '494ae5efbd'
${ noResults }
ilinx/text_base/hypervirus/3.html

95 lines
17 KiB
HTML
Raw Normal View History Unescape Escape

organizing
4 years ago
<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
<head>
<title></title>
<meta http-equiv="Content-Type" content="text/html;charset=utf-8" />
<meta name='ocr-system' content='tesseract 3.04.01' />
<meta name='ocr-capabilities' content='ocr_page ocr_carea ocr_par ocr_line ocrx_word'/>
</head>
<body>
<div class='ocr_page' id='page_1' title='image "hypervirus-03.tif"; bbox 0 0 1749 2481; ppageno 0'>
<div class='ocr_carea' id='block_1_1' title="bbox 733 371 950 392">
<p class='ocr_par' dir='ltr' id='par_1_1' title="bbox 733 371 950 392">
<span class='ocr_line' id='line_1_1' title="bbox 733 371 950 392; baseline 0 0; x_size 27.333334; x_descenders 6.8333335; x_ascenders 6.8333335"><span class='ocrx_word' id='word_1_1' title='bbox 733 371 950 392; x_wconf 84' lang='eng' dir='ltr'><strong>HYPERVIRUS</strong></span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_2' title="bbox 332 477 1343 2025">
<p class='ocr_par' dir='ltr' id='par_1_2' title="bbox 333 477 1343 755">
<span class='ocr_line' id='line_1_2' title="bbox 333 477 1343 521; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_2' title='bbox 333 477 646 521; x_wconf 85' lang='eng' dir='ltr'>disproportionate)</span> <span class='ocrx_word' id='word_1_3' title='bbox 657 479 831 519; x_wconf 80' lang='eng' dir='ltr'>efficiency:</span> <span class='ocrx_word' id='word_1_4' title='bbox 842 479 987 509; x_wconf 85' lang='eng' dir='ltr'>intruder</span> <span class='ocrx_word' id='word_1_5' title='bbox 994 479 1162 519; x_wconf 98' lang='eng' dir='ltr'>passcode,</span> <span class='ocrx_word' id='word_1_6' title='bbox 1172 479 1343 509; x_wconf 90' lang='eng' dir='ltr'>locational</span>
</span>
<span class='ocr_line' id='line_1_3' title="bbox 334 537 1342 578; baseline 0 -11; x_size 37; x_descenders 7; x_ascenders 10"><span class='ocrx_word' id='word_1_7' title='bbox 334 537 495 574; x_wconf 83' lang='eng' dir='ltr'>ZIP-code,</span> <span class='ocrx_word' id='word_1_8' title='bbox 509 537 799 578; x_wconf 95' lang='eng' dir='ltr'>pseudogenomic</span> <span class='ocrx_word' id='word_1_9' title='bbox 813 537 991 567; x_wconf 89' lang='eng' dir='ltr'>substitute</span> <span class='ocrx_word' id='word_1_10' title='bbox 1005 537 1226 574; x_wconf 86' lang='eng' dir='ltr'>instructions,</span> <span class='ocrx_word' id='word_1_11' title='bbox 1242 543 1342 567; x_wconf 92' lang='eng' dir='ltr'>muta-</span>
</span>
<span class='ocr_line' id='line_1_4' title="bbox 334 594 1342 639; baseline 0.003 -13; x_size 43; x_descenders 11; x_ascenders 12"><span class='ocrx_word' id='word_1_12' title='bbox 334 596 437 631; x_wconf 86' lang='eng' dir='ltr'>tional</span> <span class='ocrx_word' id='word_1_13' title='bbox 444 596 532 637; x_wconf 86' lang='eng' dir='ltr'>junk</span> <span class='ocrx_word' id='word_1_14' title='bbox 545 594 718 639; x_wconf 90' lang='eng' dir='ltr'>(complex</span> <span class='ocrx_word' id='word_1_15' title='bbox 729 596 790 626; x_wconf 95' lang='eng' dir='ltr'>but</span> <span class='ocrx_word' id='word_1_16' title='bbox 803 596 906 626; x_wconf 99' lang='eng' dir='ltr'>latent</span> <span class='ocrx_word' id='word_1_17' title='bbox 918 594 1109 638; x_wconf 86' lang='eng' dir='ltr'>segments),</span> <span class='ocrx_word' id='word_1_18' title='bbox 1123 596 1189 626; x_wconf 99' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_19' title='bbox 1200 598 1342 639; x_wconf 85' lang='eng' dir='ltr'>garbage</span>
</span>
<span class='ocr_line' id='line_1_5' title="bbox 334 652 1342 697; baseline 0 -13; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_20' title='bbox 334 652 547 697; x_wconf 92' lang='eng' dir='ltr'>(redundant</span> <span class='ocrx_word' id='word_1_21' title='bbox 566 664 1342 694; x_wconf 93' lang='eng' dir='ltr'>scrapcrapcrapcrapcrapcrapcrapcrapcrap-</span>
</span>
<span class='ocr_line' id='line_1_6' title="bbox 333 711 683 755; baseline 0 -12; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_22' title='bbox 333 711 683 755; x_wconf 95' lang='eng' dir='ltr'>crapcrapcrapcrap).</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_3' title="bbox 332 771 1343 1163">
<span class='ocr_line' id='line_1_7' title="bbox 398 771 1343 812; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_23' title='bbox 398 771 547 801; x_wconf 93' lang='eng' dir='ltr'>Biovirus</span> <span class='ocrx_word' id='word_1_24' title='bbox 561 771 621 801; x_wconf 90' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_25' title='bbox 630 771 691 801; x_wconf 91' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_26' title='bbox 699 771 760 801; x_wconf 91' lang='eng' dir='ltr'>TA</span> <span class='ocrx_word' id='word_1_27' title='bbox 774 777 893 812; x_wconf 98' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_28' title='bbox 910 771 1101 812; x_wconf 86' lang='eng' dir='ltr'>organisms,</span> <span class='ocrx_word' id='word_1_29' title='bbox 1120 771 1262 812; x_wconf 82' lang='eng' dir='ltr'>hacking</span> <span class='ocrx_word' id='word_1_30' title='bbox 1274 771 1343 801; x_wconf 92' lang='eng' dir='ltr'>and</span>
</span>
<span class='ocr_line' id='line_1_8' title="bbox 333 829 1343 870; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_31' title='bbox 333 829 616 870; x_wconf 98' lang='eng' dir='ltr'>reprogramming</span> <span class='ocrx_word' id='word_1_32' title='bbox 622 829 1343 859; x_wconf 67' lang='eng' dir='ltr'><strong>ATGAmATCCACGGTACATFCAGT</strong></span>
</span>
<span class='ocr_line' id='line_1_9' title="bbox 333 887 1341 927; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_33' title='bbox 333 887 467 917; x_wconf 95' lang='eng' dir='ltr'>cellular</span> <span class='ocrx_word' id='word_1_34' title='bbox 477 896 553 917; x_wconf 89' lang='eng' dir='ltr'>DNA</span> <span class='ocrx_word' id='word_1_35' title='bbox 567 893 599 917; x_wconf 99' lang='eng' dir='ltr'>to</span> <span class='ocrx_word' id='word_1_36' title='bbox 609 887 759 927; x_wconf 94' lang='eng' dir='ltr'>produce</span> <span class='ocrx_word' id='word_1_37' title='bbox 770 897 862 917; x_wconf 99' lang='eng' dir='ltr'>more</span> <span class='ocrx_word' id='word_1_38' title='bbox 871 887 959 917; x_wconf 93' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_39' title='bbox 969 887 1054 917; x_wconf 93' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_40' title='bbox 1064 887 1151 917; x_wconf 94' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_41' title='bbox 1160 887 1246 917; x_wconf 95' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_42' title='bbox 1255 887 1341 917; x_wconf 94' lang='eng' dir='ltr'>virus</span>
</span>
<span class='ocr_line' id='line_1_10' title="bbox 333 946 1340 986; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_43' title='bbox 333 946 420 976; x_wconf 94' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_44' title='bbox 434 946 522 976; x_wconf 95' lang='eng' dir='ltr'>virus</span> <span class='ocrx_word' id='word_1_45' title='bbox 538 946 635 976; x_wconf 92' lang='eng' dir='ltr'>virus.</span> <span class='ocrx_word' id='word_1_46' title='bbox 655 947 701 976; x_wconf 95' lang='eng' dir='ltr'>Its</span> <span class='ocrx_word' id='word_1_47' title='bbox 715 946 864 986; x_wconf 94' lang='eng' dir='ltr'>enzymic</span> <span class='ocrx_word' id='word_1_48' title='bbox 880 946 1102 986; x_wconf 94' lang='eng' dir='ltr'>cut-and-past</span> <span class='ocrx_word' id='word_1_49' title='bbox 1116 946 1340 976; x_wconf 92' lang='eng' dir='ltr'>recombinant</span>
</span>
<span class='ocr_line' id='line_1_11' title="bbox 332 1005 1340 1046; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_50' title='bbox 332 1005 653 1046; x_wconf 90' lang='eng' dir='ltr'>wetware-splicing</span> <span class='ocrx_word' id='word_1_51' title='bbox 674 1015 804 1035; x_wconf 98' lang='eng' dir='ltr'>crosses</span> <span class='ocrx_word' id='word_1_52' title='bbox 827 1005 1029 1046; x_wconf 92' lang='eng' dir='ltr'>singularity</span> <span class='ocrx_word' id='word_1_53' title='bbox 1049 1005 1148 1035; x_wconf 91' lang='eng' dir='ltr'>when</span> <span class='ocrx_word' id='word_1_54' title='bbox 1170 1005 1340 1035; x_wconf 98' lang='eng' dir='ltr'>retroviral</span>
</span>
<span class='ocr_line' id='line_1_12' title="bbox 333 1061 1339 1106; baseline 0 -13; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_55' title='bbox 333 1063 698 1103; x_wconf 94' lang='eng' dir='ltr'>reverse-transcriptase</span> <span class='ocrx_word' id='word_1_56' title='bbox 708 1063 807 1093; x_wconf 92' lang='eng' dir='ltr'>clicks</span> <span class='ocrx_word' id='word_1_57' title='bbox 816 1063 851 1093; x_wconf 99' lang='eng' dir='ltr'>in</span> <span class='ocrx_word' id='word_1_58' title='bbox 862 1061 1032 1106; x_wconf 91' lang='eng' dir='ltr'>(enabling</span> <span class='ocrx_word' id='word_1_59' title='bbox 1040 1063 1246 1104; x_wconf 98' lang='eng' dir='ltr'>ontogenetic</span> <span class='ocrx_word' id='word_1_60' title='bbox 1256 1072 1339 1093; x_wconf 91' lang='eng' dir='ltr'><strong>DNA-</strong></span>
</span>
<span class='ocr_line' id='line_1_13' title="bbox 335 1119 1162 1163; baseline 0 -12; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_61' title='bbox 335 1130 408 1151; x_wconf 90' lang='eng' dir='ltr'>RNA</span> <span class='ocrx_word' id='word_1_62' title='bbox 421 1121 574 1161; x_wconf 92' lang='eng' dir='ltr'>circuitry</span> <span class='ocrx_word' id='word_1_63' title='bbox 586 1121 655 1151; x_wconf 98' lang='eng' dir='ltr'>and</span> <span class='ocrx_word' id='word_1_64' title='bbox 667 1121 895 1151; x_wconf 94' lang='eng' dir='ltr'>endocellular</span> <span class='ocrx_word' id='word_1_65' title='bbox 907 1119 1162 1163; x_wconf 92' lang='eng' dir='ltr'>computation).</span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_4' title="bbox 332 1179 1339 1501">
<span class='ocr_line' id='line_1_14' title="bbox 394 1179 1339 1209; baseline 0 0; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_66' title='bbox 394 1179 1339 1209; x_wconf 90' lang='eng' dir='ltr'><strong>ATAGGTCATGAATCTACCGATTGCAGCTGC</strong></span>
</span>
<span class='ocr_line' id='line_1_15' title="bbox 332 1238 1338 1268; baseline 0 0; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_67' title='bbox 332 1238 1338 1268; x_wconf 90' lang='eng' dir='ltr'><strong>TATTCCTCGATGATCGCATGGGCTGTGATG</strong></span>
</span>
<span class='ocr_line' id='line_1_16' title="bbox 333 1296 1338 1326; baseline 0 0; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_68' title='bbox 333 1296 1338 1326; x_wconf 76' lang='eng' dir='ltr'><strong>GCATCGTATCCGATCGATI‘CGAGCGATI‘GCAGC</strong></span>
</span>
<span class='ocr_line' id='line_1_17' title="bbox 332 1355 1337 1386; baseline 0 -1; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_69' title='bbox 332 1355 1337 1386; x_wconf 76' lang='eng' dir='ltr'><strong>TACGCTATI‘CCTCCGAGGGATTGCAGCTACGTC</strong></span>
</span>
<span class='ocr_line' id='line_1_18' title="bbox 333 1412 1338 1443; baseline 0 0; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_70' title='bbox 333 1412 1338 1443; x_wconf 88' lang='eng' dir='ltr'><strong>GCATCGGGCTCAGATGTAGGTCATGAATCTACC</strong></span>
</span>
<span class='ocr_line' id='line_1_19' title="bbox 334 1471 1302 1501; baseline 0 0; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_71' title='bbox 334 1471 1302 1501; x_wconf 76' lang='eng' dir='ltr'><strong>GA&#39;ITGCATGAC’I&#39;TATCCACGGTACA’ITCGACTC</strong></span>
</span>
</p>
<p class='ocr_par' dir='ltr' id='par_1_5' title="bbox 333 1530 1337 2025">
<span class='ocr_line' id='line_1_20' title="bbox 398 1530 1337 1571; baseline 0 -11; x_size 41; x_descenders 11; x_ascenders 10"><span class='ocrx_word' id='word_1_72' title='bbox 398 1530 598 1560; x_wconf 88' lang='eng' dir='ltr'>Ethnovirus</span> <span class='ocrx_word' id='word_1_73' title='bbox 614 1536 734 1571; x_wconf 99' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_74' title='bbox 749 1530 859 1560; x_wconf 98' lang='eng' dir='ltr'>brains</span> <span class='ocrx_word' id='word_1_75' title='bbox 872 1530 1092 1560; x_wconf 92' lang='eng' dir='ltr'>Technovirus</span> <span class='ocrx_word' id='word_1_76' title='bbox 1107 1536 1223 1571; x_wconf 95' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_77' title='bbox 1237 1530 1337 1560; x_wconf 94' lang='eng' dir='ltr'>socio-</span>
</span>
<span class='ocr_line' id='line_1_21' title="bbox 333 1588 1336 1628; baseline 0 -10; x_size 40; x_descenders 10; x_ascenders 10"><span class='ocrx_word' id='word_1_78' title='bbox 333 1588 506 1618; x_wconf 98' lang='eng' dir='ltr'>economic</span> <span class='ocrx_word' id='word_1_79' title='bbox 524 1598 586 1628; x_wconf 98' lang='eng' dir='ltr'>pro</span> <span class='ocrx_word' id='word_1_80' title='bbox 603 1598 665 1628; x_wconf 98' lang='eng' dir='ltr'>pro</span> <span class='ocrx_word' id='word_1_81' title='bbox 682 1588 887 1628; x_wconf 95' lang='eng' dir='ltr'>production</span> <span class='ocrx_word' id='word_1_82' title='bbox 904 1598 965 1628; x_wconf 98' lang='eng' dir='ltr'>pro</span> <span class='ocrx_word' id='word_1_83' title='bbox 982 1598 1157 1628; x_wconf 92' lang='eng' dir='ltr'>processes.</span> <span class='ocrx_word' id='word_1_84' title='bbox 1177 1588 1336 1618; x_wconf 87' lang='eng' dir='ltr'>Infovirus</span>
</span>
<span class='ocr_line' id='line_1_22' title="bbox 335 1646 1336 1687; baseline -0.001 -11; x_size 41; x_descenders 11; x_ascenders 9"><span class='ocrx_word' id='word_1_85' title='bbox 335 1652 449 1687; x_wconf 93' lang='eng' dir='ltr'>targets</span> <span class='ocrx_word' id='word_1_86' title='bbox 459 1646 572 1687; x_wconf 96' lang='eng' dir='ltr'>digital</span> <span class='ocrx_word' id='word_1_87' title='bbox 581 1654 1336 1676; x_wconf 89' lang='eng'>010010010001011110100001001101010101010</span>
</span>
<span class='ocr_line' id='line_1_23' title="bbox 335 1711 1335 1745; baseline 0 -10; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_88' title='bbox 335 1711 1335 1745; x_wconf 91' lang='eng' dir='ltr'>10001001101010010010100computers100101001011010010</span>
</span>
<span class='ocr_line' id='line_1_24' title="bbox 335 1771 1335 1792; baseline 0.001 -1; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_89' title='bbox 335 1771 1335 1792; x_wconf 88' lang='eng'>101111010001010101010101010010101001010110101001</span>
</span>
<span class='ocr_line' id='line_1_25' title="bbox 333 1829 1334 1851; baseline -0.001 0; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_90' title='bbox 333 1829 1334 1851; x_wconf 93' lang='eng' dir='ltr'>oooooo100010111010100100101010010100100101010101</span>
</span>
<span class='ocr_line' id='line_1_26' title="bbox 334 1887 1333 1909; baseline 0 0; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_91' title='bbox 334 1887 1333 1909; x_wconf 91' lang='eng' dir='ltr'>oo100010010010010010010010100100101011010100100</span>
</span>
<span class='ocr_line' id='line_1_27' title="bbox 335 1945 1333 1967; baseline 0.001 -1; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_92' title='bbox 335 1945 1333 1967; x_wconf 90' lang='eng'>10010101101010101010111101000010011010101010101000</span>
</span>
<span class='ocr_line' id='line_1_28' title="bbox 336 2003 1334 2025; baseline 0.001 -1; x_size 42.082825; x_descenders 11.044944; x_ascenders 10.48772"><span class='ocrx_word' id='word_1_93' title='bbox 336 2003 1334 2025; x_wconf 91' lang='eng'>1001101101010101001100100010001010101110100001010</span>
</span>
</p>
</div>
<div class='ocr_carea' id='block_1_3' title="bbox 811 2119 871 2142">
<p class='ocr_par' dir='ltr' id='par_1_6' title="bbox 811 2119 871 2142">
<span class='ocr_line' id='line_1_29' title="bbox 811 2119 871 2142; baseline 0 0; x_size 31.333334; x_descenders 7.8333335; x_ascenders 7.8333335"><span class='ocrx_word' id='word_1_94' title='bbox 811 2119 871 2142; x_wconf 84' lang='eng'>385</span>
</span>
</p>
</div>
</div>
</body>
</html>